ID: 1004471007

View in Genome Browser
Species Human (GRCh38)
Location 6:15929086-15929108
Sequence CCCTTGGCTGCCTATAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004470999_1004471007 28 Left 1004470999 6:15929035-15929057 CCTCTACTTAATTAGCGGTGGTG No data
Right 1004471007 6:15929086-15929108 CCCTTGGCTGCCTATAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004471007 Original CRISPR CCCTTGGCTGCCTATAGCTG TGG Intergenic
No off target data available for this crispr