ID: 1004471718

View in Genome Browser
Species Human (GRCh38)
Location 6:15935307-15935329
Sequence CTGGACAGTGAAGGGAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 2, 2: 4, 3: 28, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004471718 Original CRISPR CTGGACAGTGAAGGGAGCCT GGG Intergenic
900114672 1:1023421-1023443 CTGGACCCTGAAGGCAGCTTGGG - Intronic
901202512 1:7474719-7474741 CCGGACAGAGAAGGGAGCAGAGG + Intronic
901281160 1:8036253-8036275 GTGGACAGGGAAGGCAACCTTGG + Intergenic
902052513 1:13575424-13575446 ATGGATAAGGAAGGGAGCCTCGG + Intergenic
902447070 1:16474260-16474282 CTGCACAGTGCAGGGCACCTGGG + Intergenic
902772515 1:18653796-18653818 CTGGACTCTGAAGGCAGCCCTGG - Intronic
902995794 1:20223738-20223760 CTGCACAGGGAAGGGAGGCAGGG - Intergenic
903744404 1:25576986-25577008 CTGCCCGGTGCAGGGAGCCTGGG + Intergenic
903769393 1:25754353-25754375 CAGGACAGTGATCGGAGCCATGG - Intronic
903975268 1:27145649-27145671 AGGGACAGGGAAGGGGGCCTGGG + Intronic
904538136 1:31214895-31214917 CTGAACAGAGAAAGCAGCCTGGG + Intronic
904678658 1:32214011-32214033 CTGAAAAGTGAAGTGGGCCTTGG + Intronic
904855471 1:33494806-33494828 CTGACCAGTGTAGTGAGCCTGGG + Exonic
905364123 1:37439477-37439499 CTGGGCTGTGATGGGAGACTTGG - Intergenic
905931066 1:41788075-41788097 CTGGACAGAGGTGGGAGGCTGGG - Intronic
906033257 1:42736313-42736335 CTGGCCAGTGGAGGGGGCATGGG + Intronic
906693515 1:47809007-47809029 CTGGGCAGTGAAAGCAGACTGGG - Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
907961240 1:59283696-59283718 CTGGACAGTGCAGTGGGCCCTGG - Intergenic
908555774 1:65255001-65255023 GAGGACCTTGAAGGGAGCCTCGG - Intronic
908973495 1:69866781-69866803 CTGGAAATTTAATGGAGCCTTGG - Intronic
910579631 1:88808815-88808837 CTGTACAATGAAGAGAGCCCTGG + Intronic
912591907 1:110830756-110830778 GTGGACAGTGAAGGGAGAGCTGG + Intergenic
912723961 1:112042812-112042834 CCGGACAGAGAAGGGAGGGTGGG + Intergenic
913090389 1:115472807-115472829 CCTGAAAGGGAAGGGAGCCTTGG - Intergenic
915118107 1:153612857-153612879 AGGGGCAGTGAAGGGGGCCTGGG - Intronic
915312492 1:155011531-155011553 CCTGACAGTGAGGGGAGCCTGGG + Intronic
915835513 1:159172397-159172419 GTGGGCAGAGAAGGGGGCCTGGG + Intronic
917140163 1:171827403-171827425 CTGCACAGAGCAGGGAGCCCTGG + Intergenic
917979850 1:180262201-180262223 CAGGACAGTTAAAGGAGTCTTGG + Intronic
919518518 1:198557157-198557179 CGGGAGAGGGAAGGGAGGCTGGG + Intergenic
920172681 1:204081598-204081620 CTAGACAGGGAGGGGAGCCTTGG + Intronic
920437467 1:205956724-205956746 CAGGAGGGAGAAGGGAGCCTAGG - Intergenic
921042113 1:211442796-211442818 CTGGACAGTGAAGGGAGCCCAGG + Intergenic
921794198 1:219324003-219324025 CTGGGTAGTGAAGAGAGCATCGG - Intergenic
922143941 1:222919019-222919041 CTGGAGACTGGAGGGAGCCATGG + Intronic
922678609 1:227570522-227570544 CTGGACAGTATAGTGAGCTTTGG - Intronic
923129195 1:231060547-231060569 CTGGACTTTGAAAGCAGCCTGGG + Intergenic
923794815 1:237143505-237143527 CTGGACAGTTATGGGAGGCTGGG - Intronic
1064286784 10:13998566-13998588 CTGGTCAGTGATGACAGCCTGGG - Intronic
1065644771 10:27822731-27822753 TTGGTCAGTGAAGGGAGTCAAGG + Intronic
1066061115 10:31724328-31724350 CTGGAGAGTCTAGGGAGACTGGG + Intergenic
1066531905 10:36350191-36350213 ATGGGCAGTGAAGGAAGCCAAGG - Intergenic
1067663485 10:48254221-48254243 CTGAAGAGTGCAGGAAGCCTGGG + Intronic
1069273118 10:66555590-66555612 CCGAACAGTGAAGCGGGCCTGGG - Intronic
1071756085 10:88541848-88541870 CTTTATAGTGGAGGGAGCCTAGG + Intronic
1072483250 10:95829708-95829730 CTTCACAGAGAAGGTAGCCTTGG + Intronic
1072631356 10:97149069-97149091 TTGGACAGCCAAGGGAGCCCGGG - Intronic
1073029255 10:100511834-100511856 CTGGAGAATGAATGGAGCATTGG + Intronic
1073146684 10:101285930-101285952 GGGGAGAGGGAAGGGAGCCTGGG - Intergenic
1073435683 10:103514413-103514435 CTTGACAAGGAAAGGAGCCTGGG - Intronic
1074574932 10:114659809-114659831 CAGGACAATGCAGAGAGCCTAGG + Intronic
1074894565 10:117763808-117763830 CTGGGCAGTTCAGGAAGCCTAGG - Intergenic
1074945477 10:118276909-118276931 CTGCACATTGATGGGAGCCAGGG + Intergenic
1076774334 10:132686082-132686104 CTGGTCTCTGAAGGCAGCCTGGG - Intronic
1077220545 11:1413641-1413663 GTGGGCAGTGCAGGGAGCCCAGG - Intronic
1077471269 11:2761778-2761800 CTGGACAGAGCTGGGGGCCTGGG + Intronic
1078006076 11:7533344-7533366 GTGGAAAGTGAAGGGAGGCTGGG - Intronic
1081914318 11:46720868-46720890 CAGGACATGGAGGGGAGCCTGGG + Intronic
1083067950 11:59945299-59945321 CTGGACAGTAAATGAAGCCAGGG - Intergenic
1083254284 11:61486742-61486764 GTGGAGGGTGAAGAGAGCCTGGG + Intronic
1083343716 11:61975177-61975199 CGGGGCAGTGCAGGGAGCTTTGG - Intergenic
1083638637 11:64133625-64133647 CTGCACTGGGAAGGGAGGCTGGG - Intronic
1084266590 11:68008331-68008353 CTGGCCAGGGAGGGGACCCTCGG + Intergenic
1084322705 11:68382462-68382484 CTGTACTGTGAAGGCAGACTAGG - Intronic
1084436927 11:69148264-69148286 CTGCTCAGTGACAGGAGCCTGGG + Intergenic
1084672590 11:70616055-70616077 AAGGACAGTGAAGGGAGGATGGG - Intronic
1084877434 11:72143449-72143471 CAGGAAAGGGAAGGGAGTCTCGG - Intergenic
1085114827 11:73921644-73921666 CTGGACAGTGAAAGGAGCACGGG - Intronic
1087046136 11:93845447-93845469 CTGGACAGTAAAAGGAGCACAGG - Intronic
1087082856 11:94188437-94188459 CTGGGCAGTGAAGGGAGCCCGGG - Intergenic
1089683406 11:120132158-120132180 CTGCAAGGTGAAGGGAGCATGGG - Intronic
1091544683 12:1493716-1493738 CTTGACACTGAAGGCGGCCTTGG - Exonic
1094441250 12:30479381-30479403 CTTGACAGTGAACTGATCCTTGG + Intergenic
1096071844 12:48779943-48779965 CTGGACTGGGAAGGGAAGCTAGG - Intronic
1096743501 12:53711196-53711218 CTGGAGAGGGAGGGGGGCCTTGG + Intronic
1097017432 12:55997389-55997411 CTGGGCAGCGGAGGGGGCCTTGG + Intronic
1098024773 12:66189653-66189675 CTGCAAAGTCAAGGGAGCCGAGG + Intronic
1098893106 12:76030323-76030345 CTGGGCAGAGAGGGGAGGCTGGG - Intronic
1099895426 12:88640425-88640447 ATAGACAGAGAAGGCAGCCTAGG + Intergenic
1102011674 12:109622881-109622903 CTGGACAGAGGAGGGAGGCCTGG + Intergenic
1102120295 12:110435143-110435165 CTGGACAGTGAAGGGAGCCCGGG - Exonic
1102207455 12:111100062-111100084 CTGGACACTTCTGGGAGCCTTGG + Intronic
1103559069 12:121782824-121782846 CAGGACAGTGGTGGGAGTCTTGG + Intronic
1104298758 12:127543211-127543233 AGGGAGAGGGAAGGGAGCCTGGG + Intergenic
1104401400 12:128479594-128479616 CTGGAGTGTGAAGGCAGCCGCGG - Intronic
1104958383 12:132476828-132476850 CTGGACAGTGATGGAAGCTGGGG - Intergenic
1106401193 13:29432671-29432693 TTGGACAGTGAAGGGAGCTTAGG - Intronic
1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG + Intergenic
1110393796 13:75006805-75006827 CTGAAGAGTCAAGGCAGCCTGGG + Intergenic
1113951900 13:114076658-114076680 CCAGAGAGGGAAGGGAGCCTGGG + Intronic
1113976935 13:114234891-114234913 CTGGGCAGTGCACGGGGCCTGGG + Exonic
1115104809 14:29747766-29747788 CTGGACAATGGAGTGAGACTGGG - Intronic
1115307140 14:31944797-31944819 CTGGGCAGTGCAGGCAGCCTGGG - Intergenic
1116947079 14:50845772-50845794 CTGGTTAGTGAAATGAGCCTTGG + Intergenic
1118607430 14:67514485-67514507 CTGGGGAGTGGAGGGCGCCTAGG + Intronic
1119644649 14:76339633-76339655 CTGGACAGAGAAAGCAGCCTGGG + Intronic
1120619951 14:86750997-86751019 TTGGACAGTGAATGCAGCCCAGG - Intergenic
1121711289 14:96040455-96040477 CTGGAGACAGAAGGGAGCCTGGG - Intronic
1123433450 15:20237540-20237562 CAGGACAAGGAAGGGAGCCGTGG - Intergenic
1123895959 15:24829918-24829940 CTGCACAGAGAAGGGACCCCAGG + Intronic
1124871770 15:33550545-33550567 CTGGAAAGTGCAAGGAGCATAGG + Intronic
1125406182 15:39354413-39354435 CAGGACAGTGACGGGAGACATGG - Intergenic
1126427026 15:48538726-48538748 CTTGACAGACAAGGGAGGCTGGG + Intronic
1126514976 15:49524244-49524266 CTGCACAGAGCAGGGAGCCCTGG - Intronic
1128093380 15:64934141-64934163 CTGCATAGTGAAGGCAGCTTAGG - Exonic
1128801147 15:70497951-70497973 CTGTACAGGGAAGGGGGCTTTGG + Intergenic
1131436635 15:92427956-92427978 CTGGGCAATGAAGGGAGACTCGG + Intronic
1131514712 15:93069473-93069495 CTGGACACTGCAGAGGGCCTTGG + Intronic
1132743896 16:1428831-1428853 CTGGTCAGAGATGGGGGCCTAGG + Intergenic
1133231096 16:4366994-4367016 GTGGACAGTGGAGGGCGGCTGGG - Intronic
1135605574 16:23821420-23821442 ATGGTCAGTGAAGGGACCCTTGG + Intergenic
1135741586 16:24980054-24980076 CTGAACAGTGAAGGGAGTCAGGG + Intronic
1136851176 16:33613588-33613610 CAGGACAAGGAAGGGAGCCGTGG + Intergenic
1139613462 16:68075129-68075151 GTGGACACTGGAGGGAGGCTGGG - Intronic
1141831473 16:86511901-86511923 CTGGCCAGCGCTGGGAGCCTTGG - Intronic
1203112779 16_KI270728v1_random:1462049-1462071 CAGGACAAGGAAGGGAGCCATGG + Intergenic
1143975239 17:10824672-10824694 CTGAACAATGAAGGGAGGCCTGG - Exonic
1144794288 17:17880641-17880663 CAGGACACTGGAGGGAGCCCTGG + Intronic
1145777693 17:27540738-27540760 CTGGGCAGTGCTGGGAGCCAAGG + Intronic
1145779564 17:27553341-27553363 CTGGGGAGTGAAGGAAGGCTGGG + Intronic
1146005685 17:29159182-29159204 AAGGACAGAGAAGGGAGCCCTGG + Intronic
1146682107 17:34815796-34815818 CTAGAAAGTGAGAGGAGCCTTGG - Intergenic
1146943751 17:36860597-36860619 CCGGCCAGTGAGGGGAGCCCGGG + Intergenic
1147377634 17:40032381-40032403 CAGGGCAGTAAAGGGAGCCAGGG - Intronic
1148155819 17:45424917-45424939 CTGGGCGCTGAAGGGAGCCAAGG + Intronic
1148787828 17:50154065-50154087 CTGGAAAGAGAAGCCAGCCTTGG - Intergenic
1149697656 17:58629085-58629107 CTTGACAGAGAAGGGAGAGTGGG - Intronic
1150001158 17:61441190-61441212 CTGTACAGTTAAGGAAGCCGAGG + Intergenic
1150306710 17:64091735-64091757 CTGGGCAGGGGAGGGAGCCCAGG + Intronic
1150676066 17:67246168-67246190 CTGGAAAGTGTGGGGCGCCTTGG + Intergenic
1151380970 17:73725601-73725623 CTGGATGGTGAAGGGTGCATGGG - Intergenic
1151425889 17:74030859-74030881 CTGGGCAGAGATGGGGGCCTTGG - Intergenic
1151509023 17:74547039-74547061 GTGGAGAGTGATGGGAGTCTGGG + Intergenic
1152101385 17:78303804-78303826 CTGGACAGTGGTGGGCACCTGGG + Intergenic
1152201960 17:78952485-78952507 CTGGACAGTCAGGGGGACCTGGG - Intergenic
1152595954 17:81237735-81237757 CTGGTAAGTGCAGGGAGGCTGGG - Intronic
1152625043 17:81384196-81384218 GTGCACAGTGAGGGGAGCCCTGG - Intergenic
1152695321 17:81741167-81741189 CGGGGCTGTGAGGGGAGCCTGGG - Intergenic
1152926695 17:83090636-83090658 CTGCTCAGTGAGGGGACCCTCGG + Intronic
1153842581 18:9020331-9020353 ATGTACAGCAAAGGGAGCCTTGG - Intergenic
1155980973 18:32179176-32179198 CTCGAAAGTGAATGGAGGCTGGG + Intronic
1156494399 18:37516435-37516457 CTGGCCAGCAAAGGGAGCTTGGG + Intronic
1158773698 18:60552697-60552719 CTGCATAGAGAAGGAAGCCTGGG - Intergenic
1160723947 19:609301-609323 CTGAGCAGGGAAGGGAGCGTGGG - Intronic
1160980487 19:1814511-1814533 CAGAACCGGGAAGGGAGCCTTGG + Intergenic
1161578486 19:5067712-5067734 CTGGACAGAGGAGGTAGGCTGGG + Intronic
1163198173 19:15740671-15740693 CTGGACATGGAAGAAAGCCTTGG - Intergenic
1163224521 19:15948281-15948303 CTGGACATGGAAGAAAGCCTTGG - Intergenic
1163692136 19:18743758-18743780 CTGGACAGGGCAGGGATCCTTGG + Intronic
1163798746 19:19352566-19352588 CTGGACAGTGCAAGTGGCCTGGG + Intronic
1165029655 19:32988604-32988626 CAGGACAAGGAAGGGAGCCATGG - Intronic
1165117568 19:33538129-33538151 CTGGCCAGGGCAGGGAGACTAGG - Intergenic
1165845116 19:38813063-38813085 CTGGCAAGGGAAGGGAGACTAGG - Exonic
1166118996 19:40673732-40673754 CTGGGCAAGGAAGGCAGCCTTGG - Intronic
1166194848 19:41198782-41198804 CCGGACTGTGAAGGCAGCCAAGG - Exonic
1166246361 19:41529837-41529859 TTGGACAGGGTAGGGAGCCTAGG + Intergenic
1166972362 19:46577801-46577823 ATGGAGAGAGAAGGGAGCCAAGG - Intronic
1166977670 19:46614232-46614254 CTGGGAAGTGAGGGGATCCTTGG - Intergenic
1167367857 19:49064318-49064340 GTGGAGAGTGAAAGGAGCCCAGG + Intronic
1167744302 19:51341631-51341653 CTTAACAGTGAAGGAAGGCTTGG + Exonic
1167910907 19:52700927-52700949 CTGGACAGTGGAAGGGGCCCTGG + Intergenic
1168419484 19:56191857-56191879 CTGGACAGTGCAGCGACCCTGGG + Exonic
1168421513 19:56207233-56207255 CTGAACAGTGCAGGGACCCTGGG - Exonic
1168423928 19:56223638-56223660 CTGGACAATGCAGGGACCCTGGG + Exonic
1168426774 19:56245396-56245418 CTGGACAGTGCAGGGACCCTGGG - Exonic
925278296 2:2665824-2665846 CTGGACAGTGAAAGAAGGGTTGG - Intergenic
925741095 2:7006701-7006723 ATGGACAGGGAAGGGAGGATGGG - Intronic
927644783 2:24870702-24870724 AGGGTCAGTGCAGGGAGCCTGGG - Intronic
928273842 2:29880967-29880989 CCGGACAGAGAAAGGAGCCAAGG + Intronic
928936359 2:36682981-36683003 CAGGCCAGTGAAGGCATCCTAGG + Intergenic
929047700 2:37806140-37806162 CTGGACAGTGGTGGGAGGTTTGG - Intergenic
929167381 2:38896594-38896616 CTTGACAGTTGAGGGAGCATAGG + Intronic
930847701 2:55923578-55923600 CTGGACTGTGCAGGGTGTCTCGG - Intronic
932476244 2:72008106-72008128 CAGGACAGTGAAGGAAAACTGGG + Intergenic
932575104 2:72958512-72958534 CTGCACAGAGAAGGGACCCAGGG - Intronic
935072834 2:99710987-99711009 CTGTGCAGTGATGGGGGCCTTGG - Intronic
936906590 2:117542423-117542445 ATGTACAGGGAAGGGAGGCTGGG + Intergenic
939863645 2:147447878-147447900 CTGAACAGAGAAGGGAGCACTGG + Intergenic
944978733 2:205089558-205089580 ATGGACAGTGAAAGGAGCCAGGG - Intronic
945888939 2:215408103-215408125 CTGACCTGTGATGGGAGCCTGGG + Exonic
946749047 2:222874498-222874520 CTGGGCAGTATAGGGAGACTTGG + Intronic
947477261 2:230461494-230461516 CGGGGCAGTGCAGGTAGCCTGGG + Intronic
947833364 2:233157826-233157848 CTGGACATTGAAGAGAGGTTGGG + Intronic
948554439 2:238797661-238797683 CTGGACAGTGAAGGAGGCCAGGG + Intergenic
948674447 2:239588806-239588828 CTGAGCAGTGCAGGGTGCCTGGG - Intergenic
1170073418 20:12393201-12393223 GTGGACAATGAACAGAGCCTTGG - Intergenic
1171071139 20:22069780-22069802 CTGGACACTGGAGGCAGCCCCGG - Intergenic
1172660234 20:36563008-36563030 CTGGATAGTGACAGGAGGCTGGG + Intergenic
1174241057 20:49135006-49135028 CTGGACAGCGAAGGGAGCCCGGG + Intronic
1174920923 20:54701360-54701382 CTGTACACTGAAGGGAGTATTGG - Intergenic
1175056397 20:56202602-56202624 GTGAACACTGAAGGTAGCCTGGG + Intergenic
1175785112 20:61707355-61707377 TTGGACAGTAAAGGAAACCTGGG + Intronic
1176382030 21:6118430-6118452 CCTGACAGGGGAGGGAGCCTGGG - Intronic
1176952765 21:15065342-15065364 CTGGACAGAGCTGGGAGCCCGGG - Intergenic
1177443351 21:21157975-21157997 CTGGACTCTGAAGTCAGCCTGGG + Intronic
1177934668 21:27329142-27329164 CAAGAGAGTGAAAGGAGCCTAGG + Intergenic
1178216542 21:30605487-30605509 TTGGACAGTGAAGGGAATGTTGG + Intergenic
1179337048 21:40466616-40466638 CTGGACAGTGCAGGGAGAAACGG - Intronic
1179529576 21:42009731-42009753 CCGGACCGTGAAGGGAGCGGCGG + Intronic
1179741442 21:43419809-43419831 CCTGACAGGGGAGGGAGCCTGGG + Intronic
1179908323 21:44435455-44435477 CAGGAAAGTGAAGGCAGCCCCGG - Intronic
1180009775 21:45041621-45041643 CTCGGCAGGGCAGGGAGCCTGGG - Intergenic
1180137084 21:45868780-45868802 CGAGACAGGGAAGGGAGCCATGG + Intronic
1180218739 21:46344467-46344489 CTGGACAGGGAAGGGCGGCATGG - Intronic
1180832097 22:18911599-18911621 CTGGGCAGGGAAGGCAGCCCTGG + Exonic
1180857891 22:19059704-19059726 CAGGACTCTGACGGGAGCCTTGG + Intronic
1180967447 22:19798039-19798061 CTGGACACTGAGGCCAGCCTGGG - Intronic
1180979179 22:19870739-19870761 CTGGCCAGTGCAGGCAGTCTCGG + Intergenic
1181331280 22:22093788-22093810 CTGGAGAGAGGAGGGGGCCTGGG + Intergenic
1181561927 22:23709368-23709390 CTGGGGAGAGCAGGGAGCCTGGG + Intergenic
1181803927 22:25363926-25363948 CTGTACTGTGAAGGCAGGCTAGG + Intronic
1184093835 22:42305943-42305965 CTGGACCATGAAGGGAGCAGAGG - Intronic
1184108156 22:42380563-42380585 CAGGTCAGGGAAGGGAGACTGGG + Exonic
1184765583 22:46570387-46570409 AGGGACAGAGAAGGGAGCCCAGG - Intergenic
1203282182 22_KI270734v1_random:136904-136926 CTGGGCAGGGAAGGCAGCCCTGG + Intergenic
950476664 3:13219323-13219345 CTGGACAGTGTGGGCAGCCGCGG - Intergenic
950505635 3:13392814-13392836 GTGCTCAGTGAGGGGAGCCTGGG + Intronic
950655095 3:14431612-14431634 CTGGATGGTGGAGGGGGCCTAGG + Intronic
950878810 3:16304700-16304722 CAGGAGGGTGAAGGGAGCCTGGG + Exonic
952882043 3:37991338-37991360 CGGGAAAGAGAGGGGAGCCTGGG + Intronic
953889136 3:46737417-46737439 ATGGACAGTGTGAGGAGCCTGGG - Intronic
956198246 3:66675460-66675482 CTGGAAAGTGGAGAGAGCTTGGG - Intergenic
956680603 3:71775935-71775957 CAGGGCAGTGAGGGGAGCCTTGG - Intronic
959664416 3:108905154-108905176 CAGCAGAGTGACGGGAGCCTGGG + Intergenic
960874425 3:122282952-122282974 TTGGGCAGTGAAGGGAGCATGGG - Intronic
961048493 3:123726153-123726175 CAGGACAGTGAGGCGTGCCTGGG - Intronic
961703753 3:128767447-128767469 GAGTAGAGTGAAGGGAGCCTGGG + Intronic
961861998 3:129924705-129924727 GAGTAGAGTGAAGGGAGCCTGGG - Intergenic
962264265 3:133934432-133934454 CTCAACACTGAAGTGAGCCTGGG + Exonic
962372822 3:134834868-134834890 CTTGACAGAGAAGTCAGCCTGGG + Intronic
963310858 3:143708581-143708603 CTGGTCAGTGAATAGAGACTGGG - Intronic
963591718 3:147269408-147269430 CTGGACAGTTAAGGAAGTGTTGG + Intergenic
963718471 3:148832483-148832505 CTGGGAAGTGCAGGGAGCCCTGG + Intronic
963908946 3:150798581-150798603 CTGCACAGTGTGGGGAGCATGGG + Intergenic
967034440 3:185637608-185637630 CTTGACAGTGACGGGAGGCAAGG - Intergenic
970590846 4:17559601-17559623 GTAGACAGGGGAGGGAGCCTGGG - Intergenic
971148724 4:24008073-24008095 CACGACAGAGAAGGGAGACTGGG + Intergenic
972823102 4:42724719-42724741 CAGGATAGTGAAATGAGCCTGGG + Intergenic
973834284 4:54793537-54793559 CTATTCAGTGAAGGGTGCCTAGG + Intergenic
974163001 4:58164504-58164526 CTGAACAGTCAATGAAGCCTTGG + Intergenic
975863718 4:78704228-78704250 CTGGACAGTGAGACCAGCCTGGG + Intergenic
976768494 4:88623664-88623686 CTCGTCAGTCAAGGGAGCATGGG + Intronic
977049035 4:92103406-92103428 CTGGAAAGATAAGGAAGCCTGGG + Intergenic
977961309 4:103088511-103088533 CTGGACTGGGAAGGCAGCATGGG - Intronic
979259737 4:118635344-118635366 ATGGAGTGTGAAGAGAGCCTTGG - Intergenic
979812793 4:125060667-125060689 CAGGGCAGGGAAGGGGGCCTGGG - Intergenic
980112704 4:128649771-128649793 CTGGACAAGTCAGGGAGCCTGGG - Intergenic
981274276 4:142879771-142879793 ATGGACAATGAAGGGAGTCATGG + Intergenic
981412014 4:144442850-144442872 CTGCACAGAGCAGGGGGCCTAGG + Intergenic
981848868 4:149203890-149203912 CAGGACAGAGAAGAGACCCTGGG + Intergenic
985852663 5:2400027-2400049 CTGGAGAGTGATGTTAGCCTTGG + Intergenic
985983409 5:3490450-3490472 AAGGAGAGGGAAGGGAGCCTAGG + Intergenic
986006409 5:3672420-3672442 CTGGAGTGTGCAGGGAGCCTGGG + Intergenic
989453902 5:41619930-41619952 CTGTACAGTGAAGGGAGTATGGG - Intergenic
989753381 5:44922510-44922532 CTGCACAGAGTAGGGAGCCTTGG - Intergenic
992181609 5:74203333-74203355 CTGGACAGAGAAGAAAGCCCGGG + Intergenic
992228536 5:74641277-74641299 CTGGACAGTTTAGGGACACTCGG + Exonic
996451072 5:123625523-123625545 CAGGAAAGAGAAGTGAGCCTAGG + Intergenic
998449129 5:142220823-142220845 CTGGGCAGTGTGGGGAGCTTGGG + Intergenic
999126425 5:149249619-149249641 CTGGACAGGGAAGGGAGATGGGG + Intronic
999304016 5:150508281-150508303 CTGGACAGGGCAGGGGGCCAGGG - Intronic
999367002 5:151029763-151029785 CGGGGCAGTGGAAGGAGCCTAGG - Intergenic
999704648 5:154261339-154261361 CTGGACAGTGTGGACAGCCTGGG - Intronic
1001768279 5:174272404-174272426 CTGGACAGAAAAGGGGGCCAAGG + Intergenic
1001768502 5:174274186-174274208 ATAGACAGTGAAGGTGGCCTTGG - Intergenic
1001828050 5:174762168-174762190 CTGGACAGTGAGGAGATACTGGG - Intergenic
1002105124 5:176876260-176876282 CAGGCCAGTGAAGGGAGCAGTGG + Intronic
1002341997 5:178522975-178522997 CTGGACATAGATGGGAGGCTGGG - Intronic
1004235914 6:13874047-13874069 CTGGACAGTGACGGAAGCCAGGG + Intergenic
1004471718 6:15935307-15935329 CTGGACAGTGAAGGGAGCCTGGG + Intergenic
1005500078 6:26421852-26421874 CTGGCCAGAGAAGTGAGCCGAGG + Intergenic
1005504553 6:26458370-26458392 CTGGCCAGAGAAGTGAGCCGAGG + Intronic
1008742905 6:54631399-54631421 GTGGAAAGTGAAGGGAGCACAGG - Intergenic
1010212903 6:73376408-73376430 CTTGACAGTGAAGTGAACCCAGG - Intronic
1011790218 6:90890874-90890896 CTGGAAAGAGGAGGCAGCCTGGG - Intergenic
1012701080 6:102458505-102458527 CTGGGAAGTGCAGGGAGCCAGGG + Intergenic
1012968746 6:105704256-105704278 CTGGAAAGGGAAGGGATCATCGG - Intergenic
1015599956 6:134902414-134902436 CTAGACAGTGATGGGAGCACCGG - Intergenic
1016083074 6:139879030-139879052 TTGGAAAGTGAAGGAACCCTGGG + Intergenic
1016247105 6:141995320-141995342 CTGGGCAGTGAGGGTAGCATGGG - Intergenic
1016349388 6:143150775-143150797 CTGATCTGTGAAGGGAACCTGGG - Intronic
1017333176 6:153223391-153223413 CTATACAGTGAAGGCAGCCATGG + Intergenic
1021139073 7:17001453-17001475 CTGGAAAGTGTAGGGAGAATGGG - Intergenic
1021791860 7:24213757-24213779 CTGGGCAGAGGTGGGAGCCTGGG + Intergenic
1022120373 7:27302519-27302541 CTGCACTGTGAAGGCAGCCATGG + Intergenic
1023990795 7:45127134-45127156 TTGGACAGGGAAGGGGCCCTGGG + Intergenic
1024118427 7:46214031-46214053 CTGGACACTCAAGGCTGCCTAGG - Intergenic
1027911717 7:84260474-84260496 CTGGAGAGTGCAGGGATACTGGG - Intronic
1030606468 7:111643784-111643806 CTGAAAAGGGAGGGGAGCCTCGG - Intergenic
1031049983 7:116935099-116935121 CAGGCCAGTGGAAGGAGCCTGGG + Intergenic
1032264392 7:130360910-130360932 CTGCACAGAGCAAGGAGCCTGGG + Intronic
1033789321 7:144772218-144772240 CTGGACAGTAAAAGGATGCTGGG + Intronic
1034203968 7:149299714-149299736 CTGGAAAGTGCAGGGAGATTGGG + Intergenic
1034204296 7:149302369-149302391 GTGGGCAGTGCAGGGAGCCAGGG - Intergenic
1034263079 7:149769133-149769155 CTGGCCTCTGCAGGGAGCCTCGG + Exonic
1034345116 7:150381238-150381260 CTGGCCGGTGAAGGAAGTCTTGG + Intronic
1034672749 7:152870529-152870551 CTGGACATGGAAGGCAGCCAGGG + Intergenic
1034841893 7:154405682-154405704 GTGGACAGAGAAGGGAACCTGGG + Intronic
1034876640 7:154730239-154730261 CTGGATAGGGAAGGGAACCCAGG + Intronic
1035404614 7:158588877-158588899 GTGGACAGTGAATGGGGGCTGGG + Intergenic
1036491277 8:9227949-9227971 GTGCACAGTTAAGGGAGCATAGG - Intergenic
1036653119 8:10658509-10658531 CTTGGCAGTGCAGGGAGCCCTGG + Intronic
1037948804 8:23005626-23005648 TGGTGCAGTGAAGGGAGCCTGGG + Intronic
1042563713 8:70092635-70092657 CTGGACAATGAAGAGAACCAGGG + Intergenic
1046109361 8:109703130-109703152 CTGGTCAGGGCATGGAGCCTAGG + Intergenic
1046503285 8:115106364-115106386 CTGCACACTGAAGGTTGCCTGGG - Intergenic
1047055779 8:121163715-121163737 CTGGACAGAGAAGGGAACTGAGG - Intergenic
1047980578 8:130177011-130177033 CTGGACAGTGACGGGTACCATGG - Intronic
1048573242 8:135671955-135671977 CTGGACCGTGAAGGGCGCTTGGG + Intergenic
1049705341 8:144039614-144039636 GTGGTCAGAGAAGTGAGCCTGGG + Intronic
1050030457 9:1380280-1380302 TTGGAGAGTGAAGATAGCCTTGG - Intergenic
1054903471 9:70393445-70393467 CTGGACAGCTCAGGGAGTCTGGG - Intronic
1055758805 9:79584136-79584158 ATGGTCAGCGAAGGGAGCCCTGG - Intronic
1057311287 9:93944918-93944940 CTGGAGCCTGAAGGGAGCCCAGG - Intergenic
1057549164 9:96039514-96039536 CTGGACAGTGAAGCCAGCCAGGG + Intergenic
1059096582 9:111422600-111422622 CTCTACAGTGAAAGGAGCTTTGG - Intronic
1060404161 9:123364875-123364897 CAGGACAGTGCAGGGACACTGGG + Intronic
1060867938 9:127014666-127014688 CTGGACACTGCAGGGAGGCCTGG + Intronic
1061514680 9:131082087-131082109 CTGGACAGATGAGGAAGCCTGGG - Exonic
1061800083 9:133108969-133108991 CTGGACAGCCAAGGGGGCTTGGG - Intronic
1062006644 9:134241750-134241772 CTGGACAGAAAAGGGACACTAGG + Intergenic
1185871364 X:3667623-3667645 CTGGACAGTGAGGAGATCCAGGG - Intronic
1186795793 X:13044977-13044999 CAGGACATGGGAGGGAGCCTGGG - Intergenic
1187512245 X:19931101-19931123 CTGGACAGTATATGCAGCCTAGG - Intronic
1189270742 X:39750106-39750128 CAGCACAATAAAGGGAGCCTGGG + Intergenic
1190115747 X:47625458-47625480 CAAGACTGTGAACGGAGCCTTGG - Intronic
1190215525 X:48477212-48477234 GTGGACAGTGAGGGGAGAATGGG + Intronic
1190357253 X:49617254-49617276 GAGGACAGAGAAGGGACCCTGGG + Intergenic
1190702692 X:53000096-53000118 GAGGACAGAGAAGGGACCCTGGG + Intergenic
1192632575 X:72788896-72788918 CTGCACAGGGACGGGAGCCCAGG - Intronic
1192649134 X:72931905-72931927 CTGCACAGGGACGGGAGCCCAGG + Intronic
1194859533 X:98979869-98979891 CTGGACATTGAGAGGAGCATAGG + Intergenic
1197042071 X:121949059-121949081 CTGCACAGTGCAGTGAGGCTGGG + Intergenic
1197766122 X:130060435-130060457 CTGGAAAGTGAAGGGGGCTGGGG + Intergenic
1199044412 X:143152379-143152401 CTAGACACTGAAGGGTGCATAGG - Intergenic
1199487293 X:148362149-148362171 CTTGAGAGGGAAGGGAGCATGGG + Intergenic
1200059367 X:153477359-153477381 CTGGACGGTGATGGGAACCCCGG - Intronic
1200161749 X:154013195-154013217 GTGGAGAGTGACGAGAGCCTAGG - Exonic
1200792737 Y:7314039-7314061 CTGGACAGTGAGGAGATCCAAGG + Intergenic