ID: 1004479695

View in Genome Browser
Species Human (GRCh38)
Location 6:16006802-16006824
Sequence AGCTTCACTCATGCTCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004479690_1004479695 12 Left 1004479690 6:16006767-16006789 CCAGGGCGGACCAGCACATATTT No data
Right 1004479695 6:16006802-16006824 AGCTTCACTCATGCTCACCTTGG No data
1004479691_1004479695 2 Left 1004479691 6:16006777-16006799 CCAGCACATATTTCCTGTCCTGC No data
Right 1004479695 6:16006802-16006824 AGCTTCACTCATGCTCACCTTGG No data
1004479688_1004479695 20 Left 1004479688 6:16006759-16006781 CCCTGAAACCAGGGCGGACCAGC No data
Right 1004479695 6:16006802-16006824 AGCTTCACTCATGCTCACCTTGG No data
1004479689_1004479695 19 Left 1004479689 6:16006760-16006782 CCTGAAACCAGGGCGGACCAGCA No data
Right 1004479695 6:16006802-16006824 AGCTTCACTCATGCTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004479695 Original CRISPR AGCTTCACTCATGCTCACCT TGG Intergenic
No off target data available for this crispr