ID: 1004482760

View in Genome Browser
Species Human (GRCh38)
Location 6:16036912-16036934
Sequence TCTGGGCATGAATGTTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004482760_1004482766 3 Left 1004482760 6:16036912-16036934 CCACCTGAACATTCATGCCCAGA No data
Right 1004482766 6:16036938-16036960 GTGAGGTGTAGAAGGCAGTAAGG No data
1004482760_1004482765 -5 Left 1004482760 6:16036912-16036934 CCACCTGAACATTCATGCCCAGA No data
Right 1004482765 6:16036930-16036952 CCAGAGCTGTGAGGTGTAGAAGG No data
1004482760_1004482768 20 Left 1004482760 6:16036912-16036934 CCACCTGAACATTCATGCCCAGA No data
Right 1004482768 6:16036955-16036977 GTAAGGTGCCCCTGCCAGGCAGG No data
1004482760_1004482767 16 Left 1004482760 6:16036912-16036934 CCACCTGAACATTCATGCCCAGA No data
Right 1004482767 6:16036951-16036973 GGCAGTAAGGTGCCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004482760 Original CRISPR TCTGGGCATGAATGTTCAGG TGG (reversed) Intergenic
No off target data available for this crispr