ID: 1004488954

View in Genome Browser
Species Human (GRCh38)
Location 6:16095547-16095569
Sequence CAATTTAAGAGACACCTAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004488954_1004488957 6 Left 1004488954 6:16095547-16095569 CCGCTTAGGTGTCTCTTAAATTG No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488954_1004488956 1 Left 1004488954 6:16095547-16095569 CCGCTTAGGTGTCTCTTAAATTG No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004488954 Original CRISPR CAATTTAAGAGACACCTAAG CGG (reversed) Intergenic
No off target data available for this crispr