ID: 1004488956

View in Genome Browser
Species Human (GRCh38)
Location 6:16095571-16095593
Sequence TGGTAAATAATGAAAATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004488950_1004488956 12 Left 1004488950 6:16095536-16095558 CCTTGTCCACCCCGCTTAGGTGT No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488952_1004488956 3 Left 1004488952 6:16095545-16095567 CCCCGCTTAGGTGTCTCTTAAAT No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488945_1004488956 28 Left 1004488945 6:16095520-16095542 CCTTCCCCTCTTCTCTCCTTGTC No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488953_1004488956 2 Left 1004488953 6:16095546-16095568 CCCGCTTAGGTGTCTCTTAAATT No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488951_1004488956 6 Left 1004488951 6:16095542-16095564 CCACCCCGCTTAGGTGTCTCTTA No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488954_1004488956 1 Left 1004488954 6:16095547-16095569 CCGCTTAGGTGTCTCTTAAATTG No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488947_1004488956 23 Left 1004488947 6:16095525-16095547 CCCTCTTCTCTCCTTGTCCACCC No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488948_1004488956 22 Left 1004488948 6:16095526-16095548 CCTCTTCTCTCCTTGTCCACCCC No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data
1004488946_1004488956 24 Left 1004488946 6:16095524-16095546 CCCCTCTTCTCTCCTTGTCCACC No data
Right 1004488956 6:16095571-16095593 TGGTAAATAATGAAAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004488956 Original CRISPR TGGTAAATAATGAAAATCCT TGG Intergenic