ID: 1004488957

View in Genome Browser
Species Human (GRCh38)
Location 6:16095576-16095598
Sequence AATAATGAAAATCCTTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004488947_1004488957 28 Left 1004488947 6:16095525-16095547 CCCTCTTCTCTCCTTGTCCACCC No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488948_1004488957 27 Left 1004488948 6:16095526-16095548 CCTCTTCTCTCCTTGTCCACCCC No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488954_1004488957 6 Left 1004488954 6:16095547-16095569 CCGCTTAGGTGTCTCTTAAATTG No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488951_1004488957 11 Left 1004488951 6:16095542-16095564 CCACCCCGCTTAGGTGTCTCTTA No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488946_1004488957 29 Left 1004488946 6:16095524-16095546 CCCCTCTTCTCTCCTTGTCCACC No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488952_1004488957 8 Left 1004488952 6:16095545-16095567 CCCCGCTTAGGTGTCTCTTAAAT No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488953_1004488957 7 Left 1004488953 6:16095546-16095568 CCCGCTTAGGTGTCTCTTAAATT No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data
1004488950_1004488957 17 Left 1004488950 6:16095536-16095558 CCTTGTCCACCCCGCTTAGGTGT No data
Right 1004488957 6:16095576-16095598 AATAATGAAAATCCTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004488957 Original CRISPR AATAATGAAAATCCTTGGCA AGG Intergenic