ID: 1004491621

View in Genome Browser
Species Human (GRCh38)
Location 6:16122629-16122651
Sequence CAGGGTAAGGAGAAGCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004491612_1004491621 26 Left 1004491612 6:16122580-16122602 CCTGGTTCAGAATTCATGGACAA No data
Right 1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004491621 Original CRISPR CAGGGTAAGGAGAAGCAGAC TGG Intergenic
No off target data available for this crispr