ID: 1004492781

View in Genome Browser
Species Human (GRCh38)
Location 6:16131861-16131883
Sequence ATTTTGTTTCTGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 594}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004492777_1004492781 23 Left 1004492777 6:16131815-16131837 CCACTTTGCCTTGTAATCGAGCT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG 0: 1
1: 0
2: 6
3: 74
4: 594
1004492779_1004492781 15 Left 1004492779 6:16131823-16131845 CCTTGTAATCGAGCTTTAAAGGT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG 0: 1
1: 0
2: 6
3: 74
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004492781 Original CRISPR ATTTTGTTTCTGAATGAAGA TGG Intronic
901566831 1:10123610-10123632 AGTTTGTTTATGAATAAAGTAGG - Intronic
902267002 1:15274650-15274672 ATTTTGTTAGTGAATGAGAACGG + Intronic
903589384 1:24442593-24442615 TTTTTATTTCTAAAAGAAGAAGG + Intronic
904341734 1:29839496-29839518 ATTTTATTTTTTAATGAACAGGG - Intergenic
904748113 1:32723832-32723854 ATTTTTTTTTTTAATGGAGATGG - Intergenic
905573242 1:39022942-39022964 ATTTTGTTTCTTTTTGGAGATGG - Intergenic
906980669 1:50625068-50625090 ATTTTGTATTTTAATAAAGACGG + Intronic
907746975 1:57223297-57223319 ATTTTATTTTTAAAAGAAGAGGG + Intronic
908630231 1:66097031-66097053 TTTTTGATTCTTAATGAAGCTGG + Intronic
909734293 1:78936810-78936832 ATAATGTTTCTGCATGAAAATGG - Intronic
910212283 1:84805798-84805820 TTTTTTTTTCTGAATAGAGAAGG + Intergenic
910352430 1:86313574-86313596 GTTCTGTTTCTGACTGATGATGG - Intergenic
911253584 1:95608308-95608330 ATTATGTTTCTGAAAGAAGTGGG - Intergenic
911277111 1:95875592-95875614 AGTTTGATTCTTACTGAAGAGGG - Intergenic
911280848 1:95926644-95926666 AATTTGTATGTGAATGAGGAAGG + Intergenic
911368075 1:96963856-96963878 TTTTTGATTCTGAATGAATATGG + Intergenic
912124916 1:106523982-106524004 ATTTTATTTCTGAAGAAAAATGG - Intergenic
912671559 1:111632740-111632762 ATTTTTTTTTTTAGTGAAGACGG - Intronic
915298542 1:154938887-154938909 CTTTTGTTTCTTTATGCAGACGG + Intergenic
915403407 1:155640949-155640971 ATTTGGTTTCTGATTCAACAAGG + Intergenic
915415712 1:155741119-155741141 ATTTTTTTTTTTAATAAAGATGG + Intergenic
916240338 1:162632968-162632990 AGTTAGTTTCAGGATGAAGAAGG + Intronic
916622503 1:166515728-166515750 ATTTTTCTGCTGATTGAAGAAGG + Intergenic
916634267 1:166651464-166651486 AATTTTTTTCTCAGTGAAGACGG - Intergenic
917076325 1:171208997-171209019 TCTTTGTTTCTGGGTGAAGATGG - Exonic
917188233 1:172386384-172386406 ATTTTGTTGCAGGATGAAAATGG - Intronic
917586499 1:176432635-176432657 ATTTTTTTTTTTAATAAAGAGGG + Intergenic
917678517 1:177342414-177342436 TTTCTTTTTCTGAAGGAAGACGG - Intergenic
917726190 1:177829538-177829560 ATTTTGTTTCTGTTTGGTGAAGG + Intergenic
917993531 1:180409734-180409756 TTTTTGTGTCTGAGTGAATAGGG - Intronic
918304463 1:183233453-183233475 CTTCTATTTCTGAATAAAGAAGG + Intronic
919340894 1:196305176-196305198 AGTTAATTTCTGAATAAAGATGG + Intronic
919450015 1:197760294-197760316 ATTTTGTTTATAAATGGATATGG - Intronic
919543583 1:198882589-198882611 ATTTTATTTCTGAATGAGAATGG - Intergenic
919597966 1:199588152-199588174 TTTTTGTTTCTGATTATAGAAGG + Intergenic
920041409 1:203100078-203100100 TTTCTGTTTCTGAAAGCAGATGG + Intronic
920077567 1:203348269-203348291 ATTTTGTCTCTGCAAGAAGCGGG + Exonic
920574133 1:207044073-207044095 ATATTTTTTCTTAATGCAGATGG - Exonic
921008759 1:211119943-211119965 AATTTGATGCTGAATGAAGATGG - Intronic
921403987 1:214758805-214758827 AATTTGTTTCTGAAAAAGGATGG - Intergenic
921658448 1:217769259-217769281 AATGTGTTCCAGAATGAAGATGG + Intronic
922639246 1:227210492-227210514 ATTCTGTTTCTGAGACAAGATGG - Intronic
922988275 1:229883658-229883680 AGCATTTTTCTGAATGAAGATGG - Intergenic
923166977 1:231374827-231374849 ATTTTCTTTCTGATTGAAAGAGG - Intronic
923430647 1:233916972-233916994 ATTTGATGACTGAATGAAGAAGG - Intronic
923993805 1:239469559-239469581 TTTTTATTTTTTAATGAAGATGG + Intronic
924307027 1:242700236-242700258 ATTTTATTTCTGAATTCAAATGG - Intergenic
924662254 1:246031858-246031880 ATATTGTTTCTGAATTAAAATGG - Intronic
1062979156 10:1707525-1707547 ATCTTGTTACTTGATGAAGATGG + Intronic
1063754524 10:8992041-8992063 ATTTTCTTTCTGAAAGGAAAGGG - Intergenic
1064242596 10:13644772-13644794 ATAATGTTTCTGAATGGGGAAGG + Exonic
1064284879 10:13983610-13983632 CTTTTGTTTCTGCAACAAGAGGG - Intronic
1064331018 10:14394182-14394204 CTTTTGTGTCTGATTTAAGAGGG + Intronic
1065384108 10:25116759-25116781 ATATTGTTTCTGGATGCTGATGG - Intergenic
1065415140 10:25476818-25476840 CTTTTGTTTCCTAATGAAGAAGG - Intronic
1065609217 10:27454671-27454693 ATTTTCTTTCAGAAGGGAGAAGG + Intergenic
1065673332 10:28146233-28146255 ATTTTTGTTCTGAAAGAACAAGG - Intronic
1065777999 10:29140210-29140232 ATTTTGTTTGGGGATGAAAAAGG + Intergenic
1066055921 10:31680000-31680022 ATTTTTTTTCTCAATGGAGTGGG - Intergenic
1068086536 10:52380184-52380206 TTTTTTTTTCAGAATGAAGACGG + Intergenic
1068139542 10:52988311-52988333 ATTTTTTTTTTAAATAAAGATGG + Intergenic
1068258630 10:54547436-54547458 ATTTTATTTCTGATTGTAGGTGG - Intronic
1068601189 10:58958369-58958391 ATTGTGTTTTTCCATGAAGATGG - Intergenic
1068647393 10:59482632-59482654 ATTCTCTTTCTGAAAGAAGTTGG + Intergenic
1069055407 10:63839622-63839644 ATTTTGTTTCTGTATGGTTAGGG + Intergenic
1071217270 10:83422229-83422251 ATTTTGTTTCTCAATTCAGATGG - Intergenic
1071685811 10:87755317-87755339 ACTTTGTTTCTCATTGAAGTAGG - Intronic
1071974620 10:90942564-90942586 ATTTTTTTTTTAAATTAAGATGG + Intergenic
1072289022 10:93945500-93945522 ATTTTGTATCTGCATGAAACTGG - Intronic
1072400514 10:95094478-95094500 GTTTTGTTTCTGACTGATTATGG + Intergenic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1073097021 10:100986025-100986047 ATTTTATTTCTGCACAAAGAGGG + Intronic
1074010142 10:109470167-109470189 AATTTGTTTTTTAATCAAGAGGG + Intergenic
1074175191 10:110993195-110993217 ATTTTATTTCTTAGTCAAGATGG + Intronic
1074208599 10:111306443-111306465 ATTTTGTTTCTGGTTTAAAAAGG - Intergenic
1074243046 10:111658147-111658169 TTTTTTTTTTTAAATGAAGAGGG + Intergenic
1075463820 10:122636575-122636597 ATTTGGTTTCTATCTGAAGATGG + Intronic
1075704758 10:124493934-124493956 TTTGTTTTTCTGAATGAATAAGG + Intronic
1076216212 10:128695672-128695694 ATTTTGTTTAAGCAAGAAGAGGG + Intergenic
1077672537 11:4168702-4168724 TTTTTCTTTCTGTATCAAGATGG + Intergenic
1078226436 11:9395891-9395913 ATTTTTTTTTTAAATAAAGATGG + Intronic
1078228131 11:9412342-9412364 ATTTTCTCTCTTAAGGAAGAGGG + Intronic
1079016311 11:16871907-16871929 ATTTTGTTTTTAAAAGAGGAGGG - Intronic
1079413375 11:20210163-20210185 GTTTTGTTTCAGTATGAAGATGG - Intergenic
1079547460 11:21650860-21650882 ATTTTTTTTCTGAATTCCGAGGG - Intergenic
1079594658 11:22227563-22227585 ATTCTGTTTCTTGATGAGGATGG - Exonic
1079762725 11:24351263-24351285 ATTTTGGTTCTGAATAAAAAGGG + Intergenic
1079787808 11:24697614-24697636 TTTTGGTTTCCAAATGAAGAGGG - Intronic
1080962555 11:37177614-37177636 ATTTTGTTAATCAATGAAGAGGG - Intergenic
1082119466 11:48362844-48362866 GTTTTGTTTCTTGATTAAGAAGG + Intergenic
1082184831 11:49166187-49166209 AATGTGTTGCTGAATGAAAAAGG + Intronic
1082254835 11:50022318-50022340 GTTTTGTTTCTTGATTAAGAAGG - Intergenic
1082839200 11:57675139-57675161 ATTTTGGTTCTGGGTCAAGAGGG + Intronic
1082948143 11:58781889-58781911 ATTTTGTTACAGAATGATGCTGG - Intergenic
1083714524 11:64567921-64567943 GTTTTCTTTCTGAATGAGGGAGG + Intronic
1085135248 11:74081363-74081385 ATTTTTTCTCTCACTGAAGAAGG - Intronic
1085176415 11:74492470-74492492 ATTTTGTTTCTGGAGAAACAAGG + Intronic
1085319168 11:75563715-75563737 GTTTTCTTTCAGAATGAAAAAGG + Exonic
1086399736 11:86450658-86450680 ATTTTCTTTATGAATGATGATGG - Intronic
1086464483 11:87038618-87038640 TTTTTTTTTTTTAATGAAGAAGG + Intronic
1086681507 11:89679172-89679194 AATGTGTTGCTGAATGAAAAAGG - Intergenic
1086775960 11:90833253-90833275 ATTTTGCTTCTGCAGGAAGCAGG - Intergenic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087418561 11:97890045-97890067 TTTCTGTTTCTGAATGAATGTGG - Intergenic
1087556288 11:99725297-99725319 TTTTTGTTTTTGAAAGGAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088134753 11:106541461-106541483 ATTATGTTTTTATATGAAGATGG + Intergenic
1088597313 11:111450113-111450135 ATTGTGTTCATGAAAGAAGAGGG + Intronic
1089031037 11:115329769-115329791 ATTTTATTGCTGGATGGAGATGG + Intronic
1089119323 11:116122618-116122640 ATTTTTTTTCTGAACCATGAAGG - Intergenic
1090073949 11:123567536-123567558 ATTTTGTTTTTGTAGGAAGGGGG + Intronic
1092593340 12:9972788-9972810 ATTTTTTTTTAGAAAGAAGAAGG + Intronic
1093083325 12:14838906-14838928 TTTTTTTTTCTGAATCAAAAAGG + Intronic
1093288709 12:17297835-17297857 ATTTTGTCTCAGGAGGAAGATGG + Intergenic
1093564503 12:20586560-20586582 ACTTAGATTCTGTATGAAGATGG + Intronic
1093936334 12:25004894-25004916 AAATTATCTCTGAATGAAGATGG + Intergenic
1093969674 12:25363495-25363517 ATTTTATTTTTTAATAAAGATGG - Intergenic
1094024242 12:25945588-25945610 GTTCTGTTTCTGAATGATTATGG + Intergenic
1094068463 12:26386128-26386150 ATTTTGTTTCTGCTTGCTGAGGG - Intronic
1095142947 12:38689116-38689138 TTGTTGTTTATTAATGAAGAGGG + Intronic
1095144260 12:38705741-38705763 ATTTTGAATCTGAATGAACTGGG + Intronic
1095508312 12:42922053-42922075 ATTCTGTTTCTACATGAATAGGG - Intergenic
1095622837 12:44279247-44279269 ATTATGTTCATGAATGGAGAAGG - Intronic
1096013995 12:48250511-48250533 ATTTTGTACCTTAATTAAGAAGG - Intergenic
1096133260 12:49177957-49177979 ATTCTATTTCTGAATTAAGTTGG + Intergenic
1098013950 12:66084658-66084680 AATTTGTTTCAGAATGTAGGAGG + Intergenic
1098110286 12:67114315-67114337 ATGTTGTTTATGAATGATGGAGG + Intergenic
1098490551 12:71071306-71071328 ATTGTGTTTCTGATTCAAAATGG - Intronic
1098535376 12:71588451-71588473 TTTCTGGTTCTAAATGAAGAAGG - Intergenic
1098806075 12:75021239-75021261 ATTTTAATTCATAATGAAGAAGG - Intergenic
1099006202 12:77237374-77237396 ATTTTGTTTGTGAGTAGAGAAGG + Intergenic
1099208570 12:79757075-79757097 ATTTTGTTTCTTAGGGGAGAAGG + Intergenic
1099212849 12:79814508-79814530 AATTTTTTTTTTAATGAAGAGGG - Intronic
1099269445 12:80488792-80488814 TATTTGTTTCTGAATAAATATGG + Intronic
1100073353 12:90749167-90749189 ACTTTGTTTCTAACTGAGGATGG - Intergenic
1100133264 12:91521998-91522020 ATTTTTTTTCTTAAAGAAGTAGG + Intergenic
1100760885 12:97805412-97805434 AATTATTTTCTGAATGTAGAAGG - Intergenic
1101560106 12:105848954-105848976 ATTTTGTGAGTGAATGAAGGAGG - Intergenic
1101623889 12:106419447-106419469 TTTTTGACTCAGAATGAAGAAGG - Intronic
1102634423 12:114310563-114310585 ATGCTGTTTTTGAAAGAAGAGGG + Intergenic
1102657094 12:114491203-114491225 ATTTTGTTTTTCAGTGAAGAGGG + Intergenic
1104134206 12:125922042-125922064 ATTTTGTTATTTAATAAAGATGG - Intergenic
1104172271 12:126293335-126293357 CTCTTGTAACTGAATGAAGATGG + Intergenic
1104632979 12:130419891-130419913 ATTTTGTTTTTTAATCATGAAGG + Intronic
1105200878 13:18175425-18175447 ATTTTGTCTCTATATGAATATGG - Intergenic
1106574888 13:30965467-30965489 TTTGTCTTTCTGAATAAAGATGG + Intronic
1106579689 13:31006536-31006558 CTTTTGTTTCCAAGTGAAGATGG + Intergenic
1106725597 13:32481825-32481847 ACTTTGTATCTGAATGCAGATGG + Intronic
1106725867 13:32485144-32485166 ATTTTGTTTGTTACTGAAAATGG + Intronic
1107111479 13:36702572-36702594 ATTTTGTTTTTGAGTGATTATGG + Intergenic
1107282577 13:38753988-38754010 ATTTTATTTTTGAATGGAGCTGG + Intronic
1107478617 13:40765554-40765576 ATTTTGTTTCTAAAAGCAGGAGG + Intronic
1107885121 13:44868725-44868747 ATTTAGTTTCTGAATGCATTTGG + Intergenic
1108254356 13:48596056-48596078 TTTTTTTTTTTTAATGAAGAGGG + Intergenic
1108646665 13:52436775-52436797 ATTTTGTTTTCAAATGAATAAGG - Intronic
1108931188 13:55822600-55822622 TTGGTGTTTCTGAAAGAAGAAGG + Intergenic
1110048736 13:70865963-70865985 ATTATTTTTCTGAATAAAAAAGG + Intergenic
1110221793 13:73081441-73081463 ATTTTGTGTGTGTCTGAAGACGG + Intergenic
1110331829 13:74281936-74281958 ATATTATTTGTGAATGCAGAAGG - Intergenic
1110875018 13:80498436-80498458 TCTTTCTTTTTGAATGAAGATGG + Intergenic
1111401412 13:87740994-87741016 ATTGTGTTTCTTAATGCAAATGG + Intergenic
1112028616 13:95436639-95436661 ATTTTGACTCAGGATGAAGAAGG - Intronic
1112045970 13:95598141-95598163 CTCTTGTTTCTGAAAGAAGCAGG + Intronic
1112681641 13:101773633-101773655 ATTTAGTTATGGAATGAAGAAGG + Intronic
1112996587 13:105581654-105581676 AATATCTTTGTGAATGAAGATGG - Intergenic
1113073446 13:106445186-106445208 ATTTAATTTGTGAATGAGGATGG - Intergenic
1113333681 13:109357298-109357320 ATATTCTTTCTGAATGAAGAAGG + Intergenic
1113368455 13:109700442-109700464 TTCTTTTTTATGAATGAAGATGG - Intergenic
1113504944 13:110809692-110809714 ATTTTGTGTCAGAATTAAAAAGG - Intergenic
1114074732 14:19152790-19152812 ACTTTTTTTTTGAATGAGGAGGG - Intergenic
1114087535 14:19247185-19247207 ACTTTTTTTTTGAATGAGGAGGG + Intergenic
1114341498 14:21750182-21750204 AATTTTTTTTTTAATGAAGAAGG - Intergenic
1114436800 14:22713540-22713562 ATATTGTTTCTAAATCCAGAGGG + Intergenic
1114955177 14:27808374-27808396 CTTTTCTTTCTCAATGAAGAAGG + Intergenic
1115073601 14:29358318-29358340 ATTAGGTTTCTCACTGAAGATGG + Intergenic
1115437885 14:33397072-33397094 AGTTTGGTGCTGAATTAAGAAGG + Intronic
1115520205 14:34225985-34226007 ATTTTTTTTCTTAACGTAGAAGG - Intronic
1115905715 14:38201090-38201112 ATTTTATTTTGGAATGAAAAAGG + Intergenic
1116902640 14:50376576-50376598 ATGTTATTGCTGAGTGAAGAAGG + Intronic
1116999430 14:51357108-51357130 ATTATGTTTATGAATTAAGTTGG - Intergenic
1117523035 14:56570045-56570067 ATTTTTTTTCTGCCTGAAGGGGG - Intronic
1117556043 14:56884931-56884953 TTTTTGTTTCTGGAAGGAGAGGG - Intergenic
1118215794 14:63807386-63807408 AGGTTGTTTCAGAATGAAAAAGG + Intergenic
1118534988 14:66752460-66752482 ATGTTGTTTCTCAAGGAATAAGG + Intronic
1119338958 14:73858722-73858744 TTTGTGTTTCCCAATGAAGAGGG - Intronic
1120060058 14:79971699-79971721 ATTTTAATTCTGAAGTAAGATGG + Intergenic
1120246557 14:82012661-82012683 ATTTTGTTTCTTCATGATGCTGG - Intergenic
1120461573 14:84804054-84804076 ATTTTGTTTAAGCATGAGGATGG + Intergenic
1120526789 14:85585683-85585705 ATTTTTTTTGAGAATGAAGATGG + Intronic
1121159438 14:91723480-91723502 ATTTTGTGTCTAAATAAAAAAGG + Intronic
1121356753 14:93222252-93222274 ATTTTGTTTTTGAAAGCAAATGG + Intronic
1121895845 14:97646800-97646822 ACCTTGGTTCTGAATGCAGAGGG - Intergenic
1121996926 14:98609780-98609802 ATTTTTTTTCTATATGTAGATGG + Intergenic
1122056046 14:99099042-99099064 ATTGTGTTTGTGGAAGAAGAGGG - Intergenic
1122758655 14:104003395-104003417 GTTTTGTTTCTGACTGATTATGG - Intronic
1124078964 15:26473859-26473881 ATTTTGCATATGAGTGAAGAGGG + Intergenic
1124433062 15:29623668-29623690 GTTTTGTTTTTAAATCAAGAAGG + Intergenic
1124552236 15:30692461-30692483 ATGGTGTTTCTGAATGTAGAGGG - Intronic
1124679003 15:31713204-31713226 ATGGCGTTTCTGAATGTAGAGGG + Intronic
1124807482 15:32900173-32900195 TATTTGTTACTGAATGAACATGG - Intronic
1125220447 15:37326843-37326865 ATTTTTTTAATGAATTAAGATGG - Intergenic
1126192836 15:45896698-45896720 ATTTGATTTCTCAGTGAAGAAGG - Intergenic
1126376836 15:48005472-48005494 ATTATACTTCTGAATTAAGATGG - Intergenic
1126884403 15:53134183-53134205 ATTTTGGTTCAGAAAGAAAATGG + Intergenic
1127502889 15:59571075-59571097 TTTGTGTTTAAGAATGAAGATGG - Intergenic
1127568915 15:60221598-60221620 ATATTGTTTCTTAATGGAGAAGG - Intergenic
1130819022 15:87473160-87473182 GTTTTGTTTTTGTAAGAAGAAGG - Intergenic
1130838164 15:87672219-87672241 AGTTTCTTTCTCATTGAAGAGGG - Intergenic
1131082672 15:89549873-89549895 ATGCTATTTCTGAATAAAGAGGG + Intergenic
1131169250 15:90165230-90165252 ATTCTTTTTCAGAATGAAAATGG - Intronic
1132836495 16:1956122-1956144 ATTTAAGTTTTGAATGAAGAGGG + Intronic
1135332165 16:21569658-21569680 GTCTTGTTTCTGACTGAAAATGG - Intergenic
1135428201 16:22358141-22358163 ATTTTTTTTCTGAATCTAGAAGG + Intronic
1137742343 16:50792039-50792061 ATTTTGTCTCTTAATGAAGGGGG - Intronic
1138939790 16:61776447-61776469 ACTTTGGTTTTGGATGAAGAAGG + Intronic
1139248066 16:65467352-65467374 ATGTTGTTTCTACATGTAGAGGG - Intergenic
1140925889 16:79583145-79583167 ATTTTATTTCTGGATGATTACGG + Intergenic
1140929710 16:79616009-79616031 ATTTTCTTTCTGCATTAAGTAGG + Intergenic
1141218491 16:82047022-82047044 ATTCTGTGTCTGAATGCGGAAGG - Intronic
1141312077 16:82924279-82924301 ATATTGTCTCTGCATGAACAAGG - Intronic
1141449934 16:84092240-84092262 AGTCTGTTTAGGAATGAAGAAGG - Intronic
1142678435 17:1530542-1530564 ATTTTGTTTGTGAGTGATGAAGG - Intronic
1142826638 17:2516630-2516652 ATTTTGTTTCTTAATCCATATGG - Intergenic
1143230684 17:5351864-5351886 ATTTTGTTCTTGAGTGTAGATGG + Intronic
1143678455 17:8456463-8456485 CTTTTGTTTCTGAATGTATTAGG + Intronic
1144010660 17:11145755-11145777 ATTTGGATTCGGAATGTAGATGG + Intergenic
1146025042 17:29313064-29313086 ACTTTTTTTCTGTGTGAAGAAGG - Intergenic
1146605944 17:34257704-34257726 TTATTATTTATGAATGAAGAAGG + Intergenic
1146947170 17:36881590-36881612 ATGTTGTCTGTGAATAAAGATGG - Intergenic
1147329856 17:39691536-39691558 ATTTTTTTTTTTAATGTAGATGG - Intronic
1149294280 17:55247792-55247814 ATTTGGTTACTAAAGGAAGAAGG - Intergenic
1151136520 17:71951095-71951117 ATTTTGTTTTGGAAGGAAAAGGG + Intergenic
1152576885 17:81145351-81145373 ATTAGATTTCTGAATGGAGAAGG + Intronic
1153061315 18:997854-997876 GTTTTGTTTCTTAAGAAAGATGG + Intergenic
1154338205 18:13482517-13482539 CTTTTGTTTCTGAGTGGTGATGG - Intronic
1155008884 18:21755289-21755311 CTTTTGTTTCTGAGGGAAAATGG + Intronic
1155088861 18:22486384-22486406 CTTATGTTTCTGAGTGAAAAGGG - Intergenic
1155651436 18:28148231-28148253 ATTTTATTTTTAAATGAACATGG - Intronic
1156074717 18:33260027-33260049 TTTTTTTTTCTGAATGAGGGTGG - Intronic
1156348229 18:36278479-36278501 ATGTTATTTGTGAATGAAAATGG - Intergenic
1156843699 18:41638875-41638897 ATTTTATTTTTAAATGGAGATGG - Intergenic
1157440070 18:47704098-47704120 ATTTTGCTTCTGATTTAAGATGG + Intergenic
1158381112 18:56931301-56931323 AGATTCTATCTGAATGAAGAAGG - Intronic
1158641796 18:59209974-59209996 AGTTTGTTTCTCAAAGAACATGG - Intergenic
1158685845 18:59613726-59613748 ATTTTTTTTTTTAATAAAGATGG - Intronic
1159193765 18:65084565-65084587 ACTTTCTATCTGAATGAAAATGG - Intergenic
1159710624 18:71754327-71754349 ATTTTCTTTTTCACTGAAGAAGG - Intronic
1160140867 18:76321133-76321155 ATTTAGCTTCTCACTGAAGAGGG - Intergenic
1160471930 18:79144068-79144090 ATATTTTTTCTGAAATAAGATGG + Intronic
1161024406 19:2029015-2029037 ATTTTGTTTCTGTTTTGAGAGGG + Intronic
1163911767 19:20201701-20201723 ATTTGTTTTCTGTTTGAAGAGGG - Intergenic
1163922653 19:20307073-20307095 TTTTTTTTTCTGTTTGAAGAGGG - Intergenic
1163925435 19:20337376-20337398 ACTTTTTTTCTGTTTGAAGAGGG + Intergenic
1164216333 19:23153624-23153646 ATTTAGTTTCTAAATGTAAATGG + Intergenic
1165441794 19:35832581-35832603 ATTTTGTTTTTTAATTAAGACGG + Intronic
1166642196 19:44503338-44503360 ATTTTCTTTCACAATGAACAAGG + Intronic
1167175943 19:47864463-47864485 AGTTTGTTAATGAATGAAGATGG + Intergenic
1168182130 19:54668460-54668482 ATTTTGTTCCTGTATGGAAATGG - Exonic
1168610433 19:57795101-57795123 ATTTTATTTCTTAATGAAAACGG - Intronic
925077761 2:1032624-1032646 CTCATGTTTCTGAATTAAGAAGG + Intronic
925494309 2:4428958-4428980 ATTATGTTTCTGTATTTAGAAGG - Intergenic
925758053 2:7153573-7153595 ATTTTCTTTATGCCTGAAGAAGG - Intergenic
926250125 2:11150640-11150662 ATTTTTTTTTTTAATGAAGGTGG + Intergenic
926777458 2:16436731-16436753 TTTTTGTCTCAGAATGATGAAGG + Intergenic
926995185 2:18727643-18727665 AATTAGTTTCTAAATGAAGATGG + Intergenic
927257460 2:21052395-21052417 ACTTTCTTTCTGAATGAAAAGGG - Intergenic
927586199 2:24308005-24308027 AATTTCTTGCTGAGTGAAGAGGG + Intronic
928202869 2:29262001-29262023 ATCATGATTCTGAATGAACAGGG + Intronic
928842842 2:35631638-35631660 AATTTGTTTCTGCAGGAACAGGG - Intergenic
928899962 2:36307121-36307143 TTTTTGTTTTTGAATGAACATGG - Intergenic
929035007 2:37682374-37682396 ATTTTGTTTCTATATAAAAAAGG + Intronic
929126516 2:38527390-38527412 AGTTTGTTTTTGATTGAAGGGGG - Intergenic
929690642 2:44069816-44069838 AGTTTGTTTCAGAAGGAAGATGG + Intergenic
929949509 2:46395744-46395766 ATTTTTTTTTTTAATGGAGATGG - Intergenic
930166431 2:48208206-48208228 TTTTTTTTTCAGAATGATGAGGG - Intergenic
930392356 2:50778226-50778248 ATTTTGTCTTTTAATGAAAAAGG - Intronic
930455014 2:51596841-51596863 ATGTTTTCTCTGAAGGAAGATGG - Intergenic
930966060 2:57328262-57328284 ATTATGTCTATGAAAGAAGATGG - Intergenic
931790941 2:65663658-65663680 TTTTCGTGTCTGAATGAACAAGG + Intergenic
932129586 2:69175737-69175759 ATTTTGTATCTGAAGGGAGAGGG + Intronic
932312327 2:70753633-70753655 TTTCTGTTTCTCAATGAAGCTGG + Intronic
932795816 2:74695087-74695109 ATTTTGTTTTTGAACTAAAATGG + Intergenic
933088866 2:78093913-78093935 ATTTTCTTTCTAAATGTAAAGGG - Intergenic
933196543 2:79396506-79396528 TTTTTGTTGCTCACTGAAGAAGG + Intronic
933304071 2:80575948-80575970 ATTTGGGTGCTGAATGGAGAAGG - Intronic
933460436 2:82576799-82576821 AGTTTGTTTCTGATTCAACAAGG - Intergenic
933915270 2:86985490-86985512 AAATTGTTTAGGAATGAAGAAGG + Intronic
933919528 2:87030692-87030714 ATTTTATTTCTGAATTCTGAAGG + Intergenic
934003466 2:87739210-87739232 ATTTTATTTCTGAATTCTGAAGG - Intergenic
934007722 2:87784411-87784433 AAATTGTTTAGGAATGAAGAAGG - Intronic
934032551 2:88061379-88061401 TTTTTGTATCTGAATAAAGAAGG - Intergenic
934629014 2:95894943-95894965 AATTATTTTCCGAATGAAGACGG - Intronic
934629428 2:95900559-95900581 AATTATTTTCCGAATGAAGACGG - Intronic
934629843 2:95906175-95906197 AATTATTTTCCGAATGAAGACGG - Intronic
934630246 2:95911788-95911810 AATTAATTTCCGAATGAAGACGG - Intronic
934630520 2:95915524-95915546 AATTATTTTCCGAATGAAGATGG - Intronic
934685909 2:96321585-96321607 ATTTCATTTCGGAATGAAAAAGG - Intergenic
934803671 2:97195351-97195373 AATTATTTTCTGAATGAAGACGG + Intronic
934804087 2:97200959-97200981 AATTATTTTCTGAATGAAGACGG + Intronic
934832960 2:97550833-97550855 AATTATTTTCTGAATGAAGACGG - Intronic
934854484 2:97720520-97720542 TTTTTGTATCTTAATGGAGACGG + Intronic
935771360 2:106425330-106425352 AAATTGTTTAGGAATGAAGAAGG - Intronic
935908713 2:107870619-107870641 AAATTGTTTAGGAATGAAGAAGG + Intronic
936130496 2:109835733-109835755 AAATTGTTTAGGAATGAAGAAGG + Intronic
936214201 2:110535752-110535774 AAATTGTTTAGGAATGAAGAAGG - Intronic
936423338 2:112390311-112390333 AAATTGTTTAGGAATGAAGAAGG - Intronic
936695863 2:114947543-114947565 ATCTTGTTTTGGAATGAGGATGG - Intronic
936844720 2:116816925-116816947 ATTTTGCTTCTGTAGGAAAAAGG + Intergenic
937305591 2:120868598-120868620 ACTTTGTTTCTGAATGGCAAAGG - Intronic
937593427 2:123643551-123643573 ATTTTTATTCTGAAGAAAGATGG - Intergenic
937799697 2:126068753-126068775 AATTACTTTTTGAATGAAGATGG + Intergenic
938221959 2:129576749-129576771 TTTTAGTTTATAAATGAAGAAGG - Intergenic
938489060 2:131749285-131749307 ACTTTTTTTTTGAATGAGGAAGG - Intronic
938834920 2:135091904-135091926 ATTTGCTTAGTGAATGAAGAAGG - Intronic
938925933 2:136042468-136042490 ATTTTGGTCATGAATGAATATGG + Intergenic
939087261 2:137736261-137736283 ATTTGGTTTCTTAATAAGGAGGG + Intergenic
939087514 2:137739167-137739189 ATTTGGTTTCTTAATGAGGAGGG + Intergenic
939437614 2:142199087-142199109 ACTTTGTTTATGAATCAATAAGG - Intergenic
939561826 2:143741462-143741484 ATTTTTTTTCTGAGTGAAGAAGG + Intronic
940033950 2:149293766-149293788 ATTTTATTTGGGAATAAAGAAGG + Intergenic
940433603 2:153624028-153624050 ATTTTCTTTAACAATGAAGATGG + Intergenic
940671992 2:156681615-156681637 ATTTTTTTTCTGAATTTAAATGG + Intergenic
940794957 2:158068104-158068126 ATTTAGTTACTTAATGAAAATGG + Intronic
941386790 2:164862599-164862621 ATTTTGTTTGTGAATAATCAAGG - Intergenic
941576677 2:167241304-167241326 ATTTTGTTGCTTAAGGAAGTAGG + Intronic
941700497 2:168599360-168599382 AGTTTGTTTCTTTTTGAAGAAGG + Intronic
941771560 2:169350841-169350863 ATCTTGTTCCTGAAGAAAGAAGG - Intronic
942479585 2:176369634-176369656 GTTTTGTTTCTGTCTGAAGATGG + Intergenic
942529483 2:176894043-176894065 ATTCTGTTTTGGAATGATGAAGG - Intergenic
942745470 2:179227059-179227081 ATTAGGATTATGAATGAAGAGGG + Intronic
942985633 2:182137732-182137754 ATTATGTTTCTGAATTCAGATGG + Intergenic
943291753 2:186081638-186081660 ATTATGTTTCAGAATTAAAATGG - Intergenic
943356710 2:186865301-186865323 ATTTTGTTTCTGAATCATTGAGG - Intergenic
943688778 2:190847617-190847639 ATTTTTTTTCCCATTGAAGAGGG + Intergenic
943695012 2:190917916-190917938 ATTTTGTTTTTTAATAGAGATGG - Intronic
943925640 2:193775106-193775128 CTTCTGTTTCTAAAAGAAGATGG + Intergenic
944200006 2:197096657-197096679 ATATTGCTTATGAATGAAAATGG + Intronic
944791352 2:203131091-203131113 ATTTTGTTTCTTAATGAGAAAGG - Intronic
945105345 2:206307162-206307184 AATTAGTCACTGAATGAAGAGGG - Exonic
945218832 2:207463866-207463888 ATGTGGTTTCTGCATGATGAGGG + Intergenic
945495640 2:210504260-210504282 GTTTTGTTTCTTAATGAAGATGG - Intronic
945571906 2:211478815-211478837 GTTTTGTTTCTGAAGAAAAAAGG - Intronic
946030806 2:216703308-216703330 AATTTGTTGGTGAATGAGGAAGG + Intergenic
946070365 2:217029681-217029703 ATTTGGTTACTGATTGAATATGG + Intergenic
946095174 2:217268458-217268480 ATTTTTTTTCTTAAAGAAGAGGG - Intergenic
946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG + Intergenic
947164464 2:227247696-227247718 TTATTGTTTCTGAATGATTAAGG - Intronic
947173833 2:227339722-227339744 ATCCTGTCTCTTAATGAAGAAGG + Intronic
947174018 2:227343211-227343233 ATCTTGTTTCTGAAGGAGAATGG + Intronic
1168776230 20:449784-449806 ATGTTGTTTCAGAGTGAGGAGGG - Intronic
1169111842 20:3039219-3039241 CTTTTGTTTCTTAAAGAAGCTGG + Intergenic
1169646449 20:7815355-7815377 TTTTTGTTTTTGAGTAAAGACGG + Intergenic
1169764218 20:9131316-9131338 ATTTTGTTTCAGAAGGAGGGAGG - Intronic
1170170245 20:13402934-13402956 ATTTTCCTTTTGAAAGAAGAAGG - Intronic
1170177231 20:13485186-13485208 TATTTGTTTCTGGTTGAAGAGGG - Intronic
1172093113 20:32447490-32447512 ATTTTGTTTTTGAAAGAGGTGGG - Exonic
1172659600 20:36558570-36558592 TTTTTTTTTCTAAATAAAGATGG + Intergenic
1177041613 21:16119383-16119405 TTTTTGTGTCTTAATGAAAATGG - Intergenic
1177822350 21:26045170-26045192 ATTTTATTCCTGAGGGAAGATGG + Intronic
1178698547 21:34815059-34815081 ATTTTTTTTTTCAAAGAAGACGG - Intronic
1179119128 21:38526679-38526701 ATGTTATTTCTGAGTGAGGAGGG + Intronic
1179619253 21:42601777-42601799 ATTTTGTTTCTTAATGCACATGG + Intergenic
1180153262 21:45963688-45963710 TTTATGTTTCTAAATAAAGATGG + Intergenic
1182947418 22:34336500-34336522 TTTTTGTTTCAGTATGAAGTTGG - Intergenic
1183907555 22:41053519-41053541 TTTTTGTGTCTAAATGAACAAGG + Intergenic
1185381518 22:50510224-50510246 TTTTTGTTTTTAAATAAAGAGGG + Intronic
949585985 3:5437735-5437757 ATTGTGTGTCTGTATGAAAAAGG + Intergenic
950755803 3:15171482-15171504 ATTTTGATTCTTTATGAAAAAGG - Intergenic
950776658 3:15356142-15356164 TCTTTGTTTCTGAATTAAAAAGG + Intergenic
951465352 3:22995041-22995063 TGTTTGTTTCTTAAAGAAGACGG - Intergenic
951610280 3:24484193-24484215 ATTTTATTTTTGAGTGCAGATGG + Intronic
951925029 3:27900182-27900204 ATTTTGTTTTTCAATTAAAATGG + Intergenic
952995806 3:38881084-38881106 AATTGGTTTCTGGCTGAAGAAGG + Intronic
953038774 3:39236704-39236726 GTTCTTTTTCTGAATGAAGGAGG - Intergenic
953286396 3:41614425-41614447 AATGTGTATCTGACTGAAGATGG + Intronic
953955823 3:47231213-47231235 ATTTTTTTTCTCAATCATGAAGG - Intronic
954960136 3:54557282-54557304 ATTATGCTTCTGCAAGAAGAGGG - Intronic
954982328 3:54757619-54757641 ATTTTGAGTGGGAATGAAGATGG + Intronic
955474640 3:59323654-59323676 TTTTTGTCTCTGAAAGTAGATGG - Intergenic
955848860 3:63197375-63197397 ATTTTGCTTCTGTATGGAGTAGG + Intergenic
957051697 3:75416560-75416582 AATTTTTTTCTGAATGGGGATGG + Intergenic
957169788 3:76723570-76723592 ATTTTGTATGAGAATGAAGTGGG - Intronic
957171456 3:76742696-76742718 ATTTTTTTTCTGGATAAATAAGG + Intronic
958077442 3:88700555-88700577 ATTTTGTATCAGAATGATGTTGG + Intergenic
958156853 3:89766457-89766479 ATTTTTTTTCTACATGAAAAAGG + Intergenic
958440011 3:94145218-94145240 ATTTTGTTTCTGTACTAAGGGGG - Intergenic
958501605 3:94917476-94917498 CTTTTCTTTCTTAAAGAAGAAGG + Intergenic
958870967 3:99558580-99558602 ATATTTTTTCTGAATAAAGGAGG + Intergenic
959102513 3:102028332-102028354 ATATTGTCTATGAATAAAGATGG - Intergenic
959146042 3:102545881-102545903 ATTTTGTTTCAGAATGGATTGGG - Intergenic
959225924 3:103584636-103584658 GATTTATTTCTTAATGAAGAAGG - Intergenic
959377017 3:105600158-105600180 ATTTTGTCTCTTAATGCACATGG + Intergenic
959663264 3:108892877-108892899 ACTGTGTTTCAGAAGGAAGAAGG - Intergenic
959740200 3:109710093-109710115 AGCTTGTTTTTTAATGAAGAAGG - Intergenic
959909633 3:111749057-111749079 TTTTTGTTTTTCAATGAAAAAGG - Intronic
960292435 3:115901993-115902015 ATTTAGTTTCTAAATGGACAGGG - Intronic
960416867 3:117395919-117395941 ATTTTGCTTCTAAGTGATGAAGG + Intergenic
960509421 3:118530729-118530751 ATTTTGTTTCCTAAATAAGATGG - Intergenic
960600069 3:119448271-119448293 ATTTTCTTTCTGAATGAACTAGG + Intronic
961370438 3:126425316-126425338 ATTTTTTTTCTGAGAAAAGATGG - Intronic
961498402 3:127311722-127311744 AATTTTTTTCTGAATCATGAAGG + Intergenic
962241236 3:133753046-133753068 ATTTTTTTTCTGGGGGAAGATGG - Intronic
962781365 3:138720860-138720882 TTTTTCTTTCTGAATGAGGCAGG - Intronic
962823255 3:139073675-139073697 ATTTTGTTTCTTTGTGGAGAAGG - Intronic
962840891 3:139231468-139231490 ATTTTTTTTTTGCAGGAAGAGGG - Intronic
963197418 3:142548123-142548145 ATTTTATTTCTAAATAAAGTTGG - Intronic
963532708 3:146490838-146490860 ATATTGATTTTGAATGTAGATGG - Intronic
963650756 3:147977073-147977095 ATTTTGGTTCCTAAAGAAGATGG + Intergenic
963805560 3:149718238-149718260 ATTTTGTATCTCAAAGAAGCAGG + Intronic
964240271 3:154584618-154584640 AATTTATTTCTGATTAAAGAAGG - Intergenic
964240746 3:154591123-154591145 ATTTTGTTTCTTTATGAACATGG + Intergenic
964663496 3:159147596-159147618 ATTTTCTTTCTTTCTGAAGAAGG + Intronic
965134964 3:164752713-164752735 ATTTTGGATTTGAATGAATAAGG + Intergenic
965327306 3:167323193-167323215 ATCTTGTTTCAAAATGAAAAGGG - Intronic
965784600 3:172322477-172322499 ACTTTGTTTCTCAATGGATAGGG + Intronic
965905847 3:173705039-173705061 ATTGTAGATCTGAATGAAGATGG - Intronic
965949221 3:174284265-174284287 CTCTAGTTTCTGAATGAAAAAGG + Exonic
966657999 3:182381670-182381692 ATGTTGTTCCAGAATGAAGCTGG - Intergenic
967050735 3:185782130-185782152 CTTTTCTTTCTGAACGAAGAAGG - Intronic
967591954 3:191287678-191287700 ATTTTGTTTCTGATCCTAGAAGG - Intronic
967596752 3:191334329-191334351 ATTACTTTTTTGAATGAAGAAGG + Intronic
968660054 4:1795116-1795138 ATTTTTTTTATGAATGAAAGTGG + Intronic
969275532 4:6133342-6133364 ATTTTGTTTCCATATGAAAAAGG + Intronic
969340921 4:6540713-6540735 ATGTGGTTTCTGCATGAAGATGG + Intronic
970569504 4:17365993-17366015 ATTTTGTTTTTTAGTGGAGATGG - Intergenic
970919544 4:21376929-21376951 GTTTTGTGTCTGAGTAAAGATGG + Intronic
971495852 4:27264440-27264462 ATTTATTGTCTGAATGAAAAAGG - Intergenic
971820861 4:31553053-31553075 ATTTTTTATCTGAATTTAGATGG - Intergenic
971876235 4:32312427-32312449 TTTTTGTTTCTAAATCAAGATGG + Intergenic
971976036 4:33688253-33688275 ATTTTGGTTGTGCATAAAGAAGG - Intergenic
972646141 4:40969178-40969200 AATTTGTCTCTAAATGGAGATGG - Intronic
972795059 4:42407464-42407486 ATTTTGTTTTTGTATGCATAGGG - Intergenic
974512647 4:62864925-62864947 ATTTTGTTATTGTAGGAAGAAGG - Intergenic
974827507 4:67150068-67150090 AGTTTTCTTCTGAATGAAGGGGG + Intergenic
974841633 4:67306123-67306145 GTTTGCTTTCTGAAAGAAGAGGG - Intergenic
975170597 4:71227908-71227930 ATTTGGTTTCTGACAGAGGAAGG + Intronic
975537750 4:75469948-75469970 AATTTGTTTCTAAATTTAGAAGG - Intergenic
975600325 4:76093111-76093133 ATGCTGTTTCTGACTGAAGATGG - Intronic
975889283 4:79006455-79006477 ATTTTCTTTCTTAAGGATGAAGG + Intergenic
976161069 4:82200074-82200096 ATTTTCTTTATGACTAAAGATGG - Intergenic
976207936 4:82639900-82639922 ATCTTGCTTCTGAAAGAAGAGGG + Intronic
976429967 4:84951008-84951030 ATTGTGTTTATTAATGAATAGGG - Intronic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
976935096 4:90621342-90621364 GTTTTGTTTTTGAAAGAAGCAGG + Intronic
977317322 4:95466779-95466801 ATTTTCTTTCTTAAGAAAGATGG + Intronic
977716947 4:100192952-100192974 ATTTTCTTTCTGTAAGAAGATGG - Intergenic
978363069 4:107951449-107951471 AAATTGTTTCTAAATGTAGATGG + Exonic
978397088 4:108292739-108292761 GTTTTTCTTCTGAAAGAAGACGG + Intergenic
978451347 4:108837486-108837508 ATTTTTATTTTTAATGAAGAAGG - Intronic
978643568 4:110901010-110901032 TGTCAGTTTCTGAATGAAGAGGG + Intergenic
978919920 4:114171203-114171225 ATTTTGGTTCAGAAAGAAAATGG - Intergenic
978974369 4:114850830-114850852 AATTTGACTCTGAATGATGAAGG + Intronic
978987559 4:115032486-115032508 TTTTGGTTTCTGAATGAATGAGG - Intronic
979463868 4:121014047-121014069 ATTTTGTTTCTGAATCAACAAGG + Intergenic
979952878 4:126916632-126916654 ATTTTGTCTAAGACTGAAGATGG - Intergenic
980104971 4:128578871-128578893 ATTTTATTTCTGGATGACAAGGG + Intergenic
980297089 4:130934834-130934856 TTTTTGTATTTGAATAAAGATGG - Intergenic
980465103 4:133165498-133165520 ATTTCTATTCTGAATGAAAAAGG - Intronic
980543396 4:134225141-134225163 ATTGTGTTGCAAAATGAAGAGGG + Intergenic
980588135 4:134847048-134847070 ACTATGTTACTAAATGAAGAAGG - Intergenic
981181375 4:141749837-141749859 CTTTAGTTTGTTAATGAAGATGG - Intergenic
981413531 4:144460768-144460790 ATCTTATCTCTGAATGCAGAAGG + Intergenic
981652896 4:147079253-147079275 ATTTTCTTTCTGAAAGCAAAGGG + Intergenic
982213709 4:153062428-153062450 ATTTTTTTTCTGAATAAACATGG - Intergenic
982470536 4:155784573-155784595 TTTTTGTTTTTCAATGAAGGAGG - Intronic
982490107 4:156019675-156019697 CTTTTGTCTTTGACTGAAGATGG + Intergenic
982559828 4:156916134-156916156 ATTTTGTTCATGAATGAAATAGG - Intronic
982931583 4:161414715-161414737 ATTTTTTTTCCAAATGCAGAAGG - Intronic
982947346 4:161641449-161641471 ATTTTGTATGTGATTGAAGTTGG + Intronic
982993103 4:162304598-162304620 ATTTTGTTTAAAAAAGAAGAGGG - Intergenic
982995323 4:162336856-162336878 ATTGTGTTTCTGACTAATGATGG + Intergenic
983309264 4:166036926-166036948 ATTTTTTTTCCTCATGAAGAAGG + Intronic
983650744 4:170034023-170034045 ATTGTGTTTGTGAATGAACTGGG + Intergenic
984603770 4:181760189-181760211 ATTTTTTTTTTGGAGGAAGAGGG - Intergenic
985612232 5:896701-896723 ATTTTCCAGCTGAATGAAGATGG + Exonic
987264688 5:16240879-16240901 ATTTTGTGCCTGAAAGAAAATGG - Intergenic
987383185 5:17305025-17305047 ATTCTGATGCTGAATGAATATGG - Intergenic
987686668 5:21213504-21213526 ATTTTTTCTCTGAATGAAAAAGG - Intergenic
987717042 5:21585518-21585540 TTTTTGTTACAGAAAGAAGATGG + Intergenic
988418731 5:30979022-30979044 ATTTTTGTTAGGAATGAAGAGGG + Intergenic
988570902 5:32364731-32364753 TTTTTGTTTGTGAAGAAAGATGG - Intronic
988836870 5:35041774-35041796 ATTGTGTTTTTAAATGAAGATGG + Intronic
988973301 5:36490928-36490950 ATTCTGATTCTGGAAGAAGAGGG + Intergenic
989417637 5:41198945-41198967 ATTTTGTGTCTATATGAATAAGG - Intronic
989665663 5:43850845-43850867 AGTTTGTTCCTGAATGAACAGGG + Intergenic
989775136 5:45197390-45197412 TTTTTTTTTCTGAGTGAAGGAGG - Intergenic
989985862 5:50697094-50697116 TTTTTGTATCTGAATAGAGAAGG - Intronic
990788324 5:59448573-59448595 GTTTTGTTTCTGTATCAATATGG + Intronic
990995179 5:61726118-61726140 ATTTTGTTACTTAATGATGTGGG - Intronic
991100466 5:62786463-62786485 ATTTAGTTGCTGATTCAAGAGGG - Intergenic
991970614 5:72137459-72137481 CATTTAATTCTGAATGAAGATGG - Intronic
992366171 5:76092460-76092482 ATTTTCATTTTGAATGAAAAAGG + Intronic
992673457 5:79082101-79082123 AATTTGTTTCTAACTCAAGAGGG + Intronic
992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG + Intergenic
994693291 5:103044571-103044593 GTTTTGTTTCTGAATGATTAAGG + Intergenic
995077548 5:108004665-108004687 AGTTTTCTTCTGAATGAAAATGG + Intronic
996367942 5:122722716-122722738 ATTCTATTTCTAAAGGAAGATGG - Intergenic
996974261 5:129411620-129411642 ATTCTATTTCTGAATGTATAAGG + Intergenic
997154142 5:131533912-131533934 ATTGTGTTTCAGATGGAAGAGGG - Intronic
997761781 5:136455758-136455780 ATTGTGTTTCTCCAAGAAGATGG + Intergenic
998627523 5:143862508-143862530 ATCTTGTTTCTCAATGCACAGGG + Intergenic
999680387 5:154053578-154053600 TTTTGGTTTCTGACTGAAGGTGG - Exonic
1000474499 5:161688633-161688655 ATTTTTTTTCTAGATTAAGAAGG + Intronic
1000622231 5:163498848-163498870 ATTTTTTTTTTTTATGAAGATGG + Intergenic
1000759721 5:165207468-165207490 AATTTGTTTTTGAAGGAAAAAGG - Intergenic
1001159783 5:169302610-169302632 AATGTGTTTATGAATGATGAAGG - Intergenic
1002353162 5:178599586-178599608 ATTTTGTTTCTTTATAGAGATGG - Intergenic
1003096992 6:3149985-3150007 ATTTAGTTTCTGAATAAAAAGGG + Intronic
1003173198 6:3736252-3736274 ATTCCGTTTCTGAATGGAGGAGG - Intronic
1003772010 6:9316094-9316116 GTTTTGTTTCAGAATTAAAAAGG + Intergenic
1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG + Intronic
1005057400 6:21743056-21743078 TTTTTTTTTCTGAATGCAGTGGG + Intergenic
1006418163 6:33917517-33917539 GCTTTGGTTCTGAAAGAAGAGGG + Intergenic
1006474236 6:34244656-34244678 ATTCTTTTTATGAATGAAGCCGG + Intronic
1007305808 6:40903387-40903409 ATGTTGTTTATGAATGAAAGAGG - Intergenic
1007543444 6:42671657-42671679 ATTGAGTTTCAGAATGAAGAAGG - Intronic
1007568146 6:42869186-42869208 ATTTTGTTTCTGCAAGGACAAGG + Intergenic
1008219641 6:48839978-48840000 ATTTTGTATCAGAATGATGCTGG + Intergenic
1008383886 6:50865172-50865194 ATTTTGTATGTGAAAGAAGAGGG + Intergenic
1008444652 6:51573715-51573737 ATTTTCTTTCTGAAATAAGTAGG - Intergenic
1008489787 6:52074603-52074625 GTTTTGTTTCTAAACGAAGATGG + Intronic
1008709452 6:54206899-54206921 CATTTGTTTCTCAATCAAGATGG + Intronic
1008752030 6:54746585-54746607 TTTTTGTATTTTAATGAAGATGG + Intergenic
1008854254 6:56062767-56062789 ATTTTGTTTCTGAAGAAATGCGG + Intronic
1009244892 6:61224873-61224895 ATCTTGGTTCTGAATGATTATGG + Intergenic
1009702036 6:67196718-67196740 TTTTTGTTTCATAGTGAAGATGG - Intergenic
1009859055 6:69302342-69302364 CTTTTGGTTCTGTAAGAAGAAGG + Intronic
1011267119 6:85533790-85533812 ATTTTTTTCCAGATTGAAGAAGG - Exonic
1011717933 6:90126462-90126484 ATTTAGTTACGGGATGAAGAGGG + Intronic
1011802857 6:91037308-91037330 AATTTGTTTCTTCATGGAGAAGG - Intergenic
1011848931 6:91602152-91602174 TTTTGGTTCCTGAATAAAGAGGG - Intergenic
1012237015 6:96830651-96830673 AATTTGGTTCTGGATGTAGAAGG - Intronic
1012326144 6:97920236-97920258 ATTTTTTTTCTGTATGCACAAGG + Intergenic
1012556087 6:100513559-100513581 AATTTTTTTCTGAATAAATAGGG - Intronic
1012641435 6:101621478-101621500 TTTTGATTTCTGAATGGAGACGG + Intronic
1012695713 6:102380152-102380174 ATTTTGATTTTCAATGAAGTGGG - Intergenic
1012853529 6:104474798-104474820 ATTTTATTTCTGAATAACAAGGG - Intergenic
1013668292 6:112370543-112370565 ATTTTCTTTTTGAAAGAAAAGGG + Intergenic
1013789474 6:113820193-113820215 ATGCTGTTTCTGAAGGAAGAAGG - Intergenic
1014324942 6:119982413-119982435 TTTTTTTTTCTTAATTAAGATGG + Intergenic
1014354604 6:120390217-120390239 ATCTTGTCTCTGAATGAACTGGG - Intergenic
1014869205 6:126570755-126570777 ATTTTTTTTCTTGAAGAAGATGG - Intergenic
1015080286 6:129216623-129216645 ATTTTCTTTAAGAATGAAAATGG - Intronic
1015383249 6:132593519-132593541 ATTTGGTTTAGGAATGAAAATGG + Intergenic
1015815223 6:137203463-137203485 ATTTTTTTTCTAAATATAGAGGG - Intronic
1016169070 6:140986253-140986275 ACTAAGTTTCTGAAAGAAGATGG - Intergenic
1016591456 6:145749557-145749579 ATTTTGATTCTCAATGTAGAGGG + Intergenic
1016921963 6:149304420-149304442 CTTTTGTTACTGAAGGAATAGGG - Intronic
1017279194 6:152605371-152605393 CTTTTGTTTCTGATTTAAGAGGG - Intronic
1017469776 6:154727967-154727989 ATTTTGTTGCCTGATGAAGAGGG - Intergenic
1017809113 6:157971595-157971617 TTTTAGCTACTGAATGAAGAAGG + Intergenic
1018127255 6:160693369-160693391 ATTTTATTTCTGAATTCTGAAGG - Intergenic
1018149089 6:160921732-160921754 ATTTTGTGACTGATTGAAGTGGG + Intergenic
1018223771 6:161607959-161607981 ATTTTCTTTCAGAATGTTGAAGG - Intronic
1018602303 6:165557798-165557820 ATTTTGTTTTAGGATGAATAAGG + Intronic
1018602384 6:165558729-165558751 ATTTTGTTTTAGGATGAATAAGG + Intronic
1018677588 6:166236275-166236297 ATGCAGTTTCTGAATGACGAAGG - Intergenic
1018719150 6:166559282-166559304 ATTTTCTTTCTCAATGCACAGGG + Intronic
1019070218 6:169339344-169339366 ATTTCCTTTCTGACTTAAGAAGG - Intergenic
1019848006 7:3525790-3525812 TTTTTATTTCTCAAAGAAGAGGG - Intronic
1020611658 7:10404726-10404748 ATTTTATTTCTCAAGGAAAATGG + Intergenic
1020626735 7:10590273-10590295 ATTATAATTCTGAAGGAAGACGG - Intergenic
1021260877 7:18455723-18455745 ATTATGTTTCTAAATTTAGAAGG + Intronic
1021623307 7:22568883-22568905 TTTTTGTTTTTGATAGAAGAGGG + Intronic
1023255377 7:38307584-38307606 ATTTTGTTTCTAATTGAAATTGG - Intergenic
1023285432 7:38614223-38614245 ATTTTATTACTAAATGAAAAGGG + Intronic
1023580421 7:41676267-41676289 ATTTTGTATATAATTGAAGAAGG - Intergenic
1023649077 7:42349812-42349834 ATTGTGTATGTGAATGAAAAGGG + Intergenic
1023710495 7:42987404-42987426 ATTTTGTTTTTCATTGAATATGG + Intergenic
1023815816 7:43949250-43949272 ATATTCCTTCTGAATTAAGATGG + Intronic
1024134753 7:46395004-46395026 ATTTTCTTCCTGAAAGCAGAAGG - Intergenic
1024174915 7:46829050-46829072 ATTTTGTTTCAGAAGGCTGAAGG - Intergenic
1024614648 7:51100896-51100918 TTTTTGTTTCTTATTGAAGACGG - Intronic
1024854095 7:53756628-53756650 ATTTTGTTTATGCTTGAAGTTGG - Intergenic
1024864194 7:53885194-53885216 ATTTTGATTATATATGAAGATGG + Intergenic
1026012078 7:66644361-66644383 ATTTTGTTTTTTAATAGAGATGG - Intronic
1026230741 7:68481415-68481437 ATTCTGTCTCTGAAGAAAGAAGG + Intergenic
1027516695 7:79150352-79150374 TTTTGGTTTCTTAATGAAGATGG + Intronic
1028165906 7:87538386-87538408 ATTTTCTTTCTAAATGGTGATGG + Intronic
1028217258 7:88149285-88149307 ATTTTGTTTTTGTATTAAGTAGG + Intronic
1028678850 7:93501516-93501538 ATTTTGTTTGGGGATGCAGATGG + Intronic
1028941692 7:96528569-96528591 AGGTTGTTTTTGAATCAAGATGG - Intronic
1029147231 7:98455189-98455211 ATTTTGTTGCAGAATGGAGTTGG + Intergenic
1029573562 7:101387937-101387959 TTTTTGTTTCTTATTAAAGAGGG + Intronic
1029805189 7:102988665-102988687 GTTTTGGTTCTGCATGATGAAGG - Intronic
1029870569 7:103687569-103687591 GGTTTGTTAATGAATGAAGATGG - Intronic
1030555027 7:111013297-111013319 AATATGTTTCTGACTGAAGGAGG + Intronic
1030908512 7:115216315-115216337 CTTTTGTTTGTAAATAAAGAAGG + Intergenic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031234500 7:119156731-119156753 TCTCTGTTTATGAATGAAGACGG - Intergenic
1032976031 7:137223732-137223754 ATTTTGTCTCTTAATGAAGATGG - Intergenic
1032986927 7:137347306-137347328 ATTTTTGCTCTGAATGAAGTGGG + Intergenic
1034362790 7:150515297-150515319 ATTCTTTTTCTGTAAGAAGAGGG - Intronic
1035089963 7:156301394-156301416 GTCTTGTTTCTGAATTTAGATGG - Intergenic
1035133918 7:156681682-156681704 GTTTTGTTTCTGACTGGATAGGG - Exonic
1035220307 7:157402532-157402554 TGTTTGTCTCTGAATGGAGATGG - Intronic
1035992360 8:4506479-4506501 CCATTGTTTCTGAATGAAGAGGG - Intronic
1036106869 8:5850299-5850321 ATTTTGGTTTTAAATGCAGAGGG - Intergenic
1038955215 8:32460762-32460784 ATTTTGTATTCGGATGAAGAAGG - Intronic
1039306325 8:36267298-36267320 ATTTTATTGCTGAATGGAGGTGG + Intergenic
1039480286 8:37868115-37868137 GTTTTGTTTTTTAATGGAGATGG - Intronic
1039809814 8:41036732-41036754 CTTTTTTTTTTTAATGAAGATGG + Intergenic
1041537769 8:58946417-58946439 CTTTTGTCTCTGCATGAACAAGG + Intronic
1041689521 8:60675507-60675529 ATTTTGCCTCTAAATGATGAAGG - Intergenic
1041701623 8:60796002-60796024 ATTTTGTTTCTGACTGGTGGGGG - Intronic
1042345761 8:67725944-67725966 ATTTTTTTTCTGGATGACAATGG + Intronic
1042510828 8:69609176-69609198 ATTTTGTTTGTGCGTGGAGACGG - Intronic
1042845511 8:73166356-73166378 ATGTTATTTTTGCATGAAGATGG - Intergenic
1043050706 8:75381891-75381913 ATTTTTTTTCTAGAAGAAGAAGG - Intergenic
1043094087 8:75944166-75944188 AATTTGTTTCTGAAAAAATAAGG + Intergenic
1043983242 8:86664766-86664788 GTTTTGTTTTTTAATGAATATGG - Intronic
1044017660 8:87064430-87064452 ATTTTCTTTCTGAGTAAGGAAGG + Intronic
1044084725 8:87930275-87930297 ATATTATTTGTGAATGAACATGG + Intergenic
1044105407 8:88198931-88198953 ACTTTTTTTCTGAATGAAGGAGG + Intronic
1044172055 8:89066144-89066166 ATTTTGTATCTCAGTGAAAAGGG - Intergenic
1044448590 8:92307468-92307490 ATTTTGTTTCAGAATTTTGAAGG + Intergenic
1044515181 8:93129184-93129206 ATTTTTTTTCTTTATTAAGAGGG + Intergenic
1044979388 8:97700317-97700339 TTTTTTTTTTTAAATGAAGACGG - Intronic
1046310067 8:112424112-112424134 ATTTTGTATCTGAATGCAAAAGG + Intronic
1046707142 8:117467639-117467661 ATTGTGTTTTGCAATGAAGAAGG - Intergenic
1047015018 8:120714846-120714868 ATGTTGTTTCTGCAGGAAGCAGG - Intronic
1047462642 8:125082396-125082418 ACTGTGCTTCTCAATGAAGATGG - Exonic
1048116054 8:131524332-131524354 ATTTTATTTGTGAATTAAAAAGG + Intergenic
1050014021 9:1214088-1214110 CTTTTGTTTCTAAATAAAGAAGG - Intergenic
1050500323 9:6291428-6291450 ATATTTTTTCTTAATGAAGATGG - Intergenic
1051108180 9:13604258-13604280 ATTTTGGTTCTTAGTGAAGAAGG + Intergenic
1051534735 9:18143897-18143919 ATTTTGTTTCTGTAGGAAAATGG + Intergenic
1052486623 9:29109692-29109714 AATTTGTTACGAAATGAAGATGG - Intergenic
1053925460 9:43049911-43049933 CTTTTCTTTCTCAACGAAGAAGG + Intergenic
1055309483 9:74964128-74964150 ATTTTGGTTCTTTATGGAGAAGG - Intergenic
1056453213 9:86736355-86736377 ATATTGTTTCTGAAGGAAAATGG + Intergenic
1056833776 9:89937452-89937474 ATTATTTATCTGAAAGAAGAAGG + Intergenic
1057927611 9:99167152-99167174 ATTTTGTTTCTAAAGAAAGAAGG - Intergenic
1057940891 9:99282791-99282813 ATTTTTTTTCTCAAAGAAGGAGG + Intergenic
1058256978 9:102778646-102778668 ATTTTCTTTCTTATTGATGAAGG + Intergenic
1059091199 9:111360434-111360456 GATTTGTTTCTGATTGAAAAGGG - Intergenic
1059754358 9:117278533-117278555 ATTTCTCTCCTGAATGAAGAGGG - Intronic
1060690220 9:125651184-125651206 ATTCTATTTCTAAAAGAAGATGG - Intronic
1062120602 9:134832092-134832114 ATTTTGTTTTTTAATAGAGATGG - Intronic
1203583472 Un_KI270746v1:38521-38543 ATTTTGTCTCTATATGAATATGG + Intergenic
1185956698 X:4498636-4498658 ATTTTGTCTCTTATTGAACATGG + Intergenic
1186899625 X:14039914-14039936 ATTTTTTTTCTTAATGTAGAAGG - Intergenic
1186900912 X:14054760-14054782 AGTTTGTTTCTGAATAGATAGGG + Intergenic
1187156485 X:16724738-16724760 ATTTTCTTTCTTAATAAAAAGGG - Intronic
1189168755 X:38888388-38888410 GTGTTGTTTCTTAATGGAGATGG - Intergenic
1190361324 X:49651821-49651843 ATTTTGTTTCAAAATGAGAAAGG - Intergenic
1190860107 X:54336802-54336824 ATTTACTGTCTGAATGAATATGG + Intronic
1191077479 X:56470372-56470394 TTTTTATATCTTAATGAAGAAGG + Intergenic
1191128101 X:56979419-56979441 TTTTTGTTTCTGGGTTAAGATGG - Intronic
1191705005 X:64085151-64085173 GTTTTTTTTCTTACTGAAGATGG + Intergenic
1192422895 X:71049772-71049794 TTTTTGTTTTTTACTGAAGATGG - Intergenic
1192603299 X:72487356-72487378 ATATTTTTTCTGACTGAAGAAGG + Intronic
1192637314 X:72832007-72832029 ATTTTGATTGGGAATAAAGATGG + Intronic
1192644400 X:72888807-72888829 ATTTTGATTGGGAATAAAGATGG - Intronic
1192688935 X:73339342-73339364 GTTTTGTGGCTGAATAAAGATGG + Intergenic
1192780064 X:74284850-74284872 ACGTTGTTTCTGAAAGAAAATGG - Intergenic
1193032381 X:76912823-76912845 TTTTAGTTTCAGAATGATGATGG - Intergenic
1193301976 X:79899985-79900007 TTTTGGTTTCTGAATGATGCTGG - Intergenic
1193337999 X:80313237-80313259 ATTCTGTTTCCGAAAGAGGATGG - Intergenic
1194541790 X:95182150-95182172 ATTTTTTTGCTGGATGCAGAGGG + Intergenic
1194696167 X:97053712-97053734 ATTTCTTTTGTGAATGGAGAAGG - Intronic
1194981754 X:100448808-100448830 ATTATGTTTCTAAATTAAAAGGG - Intergenic
1195636137 X:107118245-107118267 ACTTTGTTTCTAAATGTGGAAGG - Intronic
1195652592 X:107300698-107300720 ATTTGGTTTCTGAAATAGGATGG + Intergenic
1196206737 X:112948343-112948365 TTTTTGTCTCTGGATCAAGAAGG + Intergenic
1196520891 X:116669339-116669361 ATTTTATATCTTAATGAGGAAGG - Intergenic
1196552039 X:117040188-117040210 AGTTAGTATATGAATGAAGAAGG - Intergenic
1196555126 X:117076923-117076945 ATTTTGTTTCTCAATTAACTTGG - Intergenic
1196744040 X:119052406-119052428 TTTTTGGTTCCGGATGAAGACGG - Intergenic
1197555363 X:127946521-127946543 ATTTTGTTTCTTAATGTGCATGG + Intergenic
1197694845 X:129539999-129540021 ATTTTTTTACTGAATGATGTGGG + Intronic
1199890912 X:152081007-152081029 TTTTTTTTTCTGTATGAATATGG + Intergenic
1200515312 Y:4137041-4137063 GTTTTGGTTCTGAGTGATGATGG + Intergenic
1200733735 Y:6771474-6771496 CTTTTGTATCAGAATGATGATGG + Intergenic
1201587448 Y:15576612-15576634 ATTTTTTTTCTGTAGAAAGAGGG - Intergenic