ID: 1004495305

View in Genome Browser
Species Human (GRCh38)
Location 6:16157243-16157265
Sequence GCAAGTAGTGAGATTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004495305_1004495308 26 Left 1004495305 6:16157243-16157265 CCAGCTTAAATCTCACTACTTGC No data
Right 1004495308 6:16157292-16157314 CTTCCTCCATTGTAATACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004495305 Original CRISPR GCAAGTAGTGAGATTTAAGC TGG (reversed) Intergenic
No off target data available for this crispr