ID: 1004498950

View in Genome Browser
Species Human (GRCh38)
Location 6:16191842-16191864
Sequence CCTTCTTTACAAAAGCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004498943_1004498950 8 Left 1004498943 6:16191811-16191833 CCAAATACAGATTCCTGGGGCCC No data
Right 1004498950 6:16191842-16191864 CCTTCTTTACAAAAGCTTAAAGG No data
1004498946_1004498950 -5 Left 1004498946 6:16191824-16191846 CCTGGGGCCCTCTCTGGGCCTTC No data
Right 1004498950 6:16191842-16191864 CCTTCTTTACAAAAGCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004498950 Original CRISPR CCTTCTTTACAAAAGCTTAA AGG Intergenic
No off target data available for this crispr