ID: 1004502680

View in Genome Browser
Species Human (GRCh38)
Location 6:16222992-16223014
Sequence ACCAGAAGTCTCCACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004502680_1004502682 0 Left 1004502680 6:16222992-16223014 CCAGGACAGTGGAGACTTCTGGT No data
Right 1004502682 6:16223015-16223037 GTGGCAGATGATTAAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004502680 Original CRISPR ACCAGAAGTCTCCACTGTCC TGG (reversed) Intergenic