ID: 1004502896

View in Genome Browser
Species Human (GRCh38)
Location 6:16224964-16224986
Sequence TCTGTATTTTGATGCTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004502896_1004502900 3 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502900 6:16224990-16225012 ATAGGCCCTCAGTAAAAGGGAGG No data
1004502896_1004502899 0 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502899 6:16224987-16225009 GAAATAGGCCCTCAGTAAAAGGG No data
1004502896_1004502903 11 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502903 6:16224998-16225020 TCAGTAAAAGGGAGGCACCCTGG No data
1004502896_1004502898 -1 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502898 6:16224986-16225008 AGAAATAGGCCCTCAGTAAAAGG No data
1004502896_1004502906 26 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502906 6:16225013-16225035 CACCCTGGTTTGGTTTAAGAGGG No data
1004502896_1004502905 25 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502905 6:16225012-16225034 GCACCCTGGTTTGGTTTAAGAGG No data
1004502896_1004502904 16 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502904 6:16225003-16225025 AAAAGGGAGGCACCCTGGTTTGG No data
1004502896_1004502907 27 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502907 6:16225014-16225036 ACCCTGGTTTGGTTTAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004502896 Original CRISPR TCTGTATTTTGATGCTTGTC AGG (reversed) Intergenic
No off target data available for this crispr