ID: 1004502902

View in Genome Browser
Species Human (GRCh38)
Location 6:16224996-16225018
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004502902_1004502905 -7 Left 1004502902 6:16224996-16225018 CCTCAGTAAAAGGGAGGCACCCT No data
Right 1004502905 6:16225012-16225034 GCACCCTGGTTTGGTTTAAGAGG No data
1004502902_1004502906 -6 Left 1004502902 6:16224996-16225018 CCTCAGTAAAAGGGAGGCACCCT No data
Right 1004502906 6:16225013-16225035 CACCCTGGTTTGGTTTAAGAGGG No data
1004502902_1004502907 -5 Left 1004502902 6:16224996-16225018 CCTCAGTAAAAGGGAGGCACCCT No data
Right 1004502907 6:16225014-16225036 ACCCTGGTTTGGTTTAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004502902 Original CRISPR AGGGTGCCTCCCTTTTACTG AGG (reversed) Intergenic
No off target data available for this crispr