ID: 1004502905

View in Genome Browser
Species Human (GRCh38)
Location 6:16225012-16225034
Sequence GCACCCTGGTTTGGTTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004502901_1004502905 -6 Left 1004502901 6:16224995-16225017 CCCTCAGTAAAAGGGAGGCACCC No data
Right 1004502905 6:16225012-16225034 GCACCCTGGTTTGGTTTAAGAGG No data
1004502896_1004502905 25 Left 1004502896 6:16224964-16224986 CCTGACAAGCATCAAAATACAGA No data
Right 1004502905 6:16225012-16225034 GCACCCTGGTTTGGTTTAAGAGG No data
1004502902_1004502905 -7 Left 1004502902 6:16224996-16225018 CCTCAGTAAAAGGGAGGCACCCT No data
Right 1004502905 6:16225012-16225034 GCACCCTGGTTTGGTTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004502905 Original CRISPR GCACCCTGGTTTGGTTTAAG AGG Intergenic
No off target data available for this crispr