ID: 1004503058

View in Genome Browser
Species Human (GRCh38)
Location 6:16226342-16226364
Sequence CTGCAGACCTTCACAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004503054_1004503058 15 Left 1004503054 6:16226304-16226326 CCAGAGAATTCATGGTCTTGCTG No data
Right 1004503058 6:16226342-16226364 CTGCAGACCTTCACAAATGAGGG No data
1004503052_1004503058 19 Left 1004503052 6:16226300-16226322 CCTCCCAGAGAATTCATGGTCTT No data
Right 1004503058 6:16226342-16226364 CTGCAGACCTTCACAAATGAGGG No data
1004503053_1004503058 16 Left 1004503053 6:16226303-16226325 CCCAGAGAATTCATGGTCTTGCT No data
Right 1004503058 6:16226342-16226364 CTGCAGACCTTCACAAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004503058 Original CRISPR CTGCAGACCTTCACAAATGA GGG Intergenic
No off target data available for this crispr