ID: 1004503311

View in Genome Browser
Species Human (GRCh38)
Location 6:16227755-16227777
Sequence GCCTCCGGAGTGAGCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004503307_1004503311 8 Left 1004503307 6:16227724-16227746 CCTCAAGCTTCAGCCATGCATAG 0: 3
1: 10
2: 29
3: 58
4: 234
Right 1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG No data
1004503309_1004503311 -5 Left 1004503309 6:16227737-16227759 CCATGCATAGACTGGTCAGCCTC 0: 3
1: 6
2: 25
3: 41
4: 140
Right 1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004503311 Original CRISPR GCCTCCGGAGTGAGCAGAGC AGG Intergenic
No off target data available for this crispr