ID: 1004504382

View in Genome Browser
Species Human (GRCh38)
Location 6:16236155-16236177
Sequence TAGGTTGAACTAACTATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004504382_1004504391 8 Left 1004504382 6:16236155-16236177 CCTCCCATAGTTAGTTCAACCTA No data
Right 1004504391 6:16236186-16236208 AATGAACAAGGACACCTTGGCGG No data
1004504382_1004504387 -4 Left 1004504382 6:16236155-16236177 CCTCCCATAGTTAGTTCAACCTA No data
Right 1004504387 6:16236174-16236196 CCTACACCCAGGAATGAACAAGG 0: 112
1: 232
2: 474
3: 549
4: 618
1004504382_1004504390 5 Left 1004504382 6:16236155-16236177 CCTCCCATAGTTAGTTCAACCTA No data
Right 1004504390 6:16236183-16236205 AGGAATGAACAAGGACACCTTGG No data
1004504382_1004504393 23 Left 1004504382 6:16236155-16236177 CCTCCCATAGTTAGTTCAACCTA No data
Right 1004504393 6:16236201-16236223 CTTGGCGGTTAAAAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004504382 Original CRISPR TAGGTTGAACTAACTATGGG AGG (reversed) Intergenic
No off target data available for this crispr