ID: 1004505719

View in Genome Browser
Species Human (GRCh38)
Location 6:16245301-16245323
Sequence CATTCACCCAGGACGCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004505716_1004505719 23 Left 1004505716 6:16245255-16245277 CCTCACTGATGGCTGTGTGAGGC 0: 1
1: 0
2: 0
3: 20
4: 161
Right 1004505719 6:16245301-16245323 CATTCACCCAGGACGCCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 133
1004505717_1004505719 1 Left 1004505717 6:16245277-16245299 CCTGTGCAGTCATGTTTATGACA 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1004505719 6:16245301-16245323 CATTCACCCAGGACGCCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004505719 Original CRISPR CATTCACCCAGGACGCCTTC TGG Intronic
900655174 1:3753254-3753276 CATTCACCCAGGAAGCTGCCAGG - Intronic
900736723 1:4303881-4303903 CACTCACCCAGGAAGCATGCAGG + Intergenic
903451266 1:23455345-23455367 CAGTCACCAAGGAGGCCATCGGG + Intronic
905925625 1:41747364-41747386 CAGTCACCCAGGACCCAATCTGG + Intronic
913559748 1:120005562-120005584 TATTCCCCCAAGAAGCCTTCTGG + Exonic
913638110 1:120784978-120785000 TATTCCCCCAAGAAGCCTTCTGG - Intergenic
914280335 1:146164984-146165006 TATTCCCCCAAGAAGCCTTCTGG + Exonic
914541380 1:148615924-148615946 TATTCCCCCAAGAAGCCTTCTGG + Intronic
914625260 1:149455322-149455344 TATTCCCCCAAGAAGCCTTCTGG - Intergenic
915070269 1:153260823-153260845 CATCCTCCCAGGGCTCCTTCAGG - Intronic
920175814 1:204101130-204101152 CATTCACCCAGAAAGCCACCAGG - Intronic
921135682 1:212257147-212257169 CATTCAAACAGGAAGCCATCTGG + Intergenic
924617698 1:245627392-245627414 TATTTACCCAGGACTCATTCAGG - Intronic
1067067854 10:43113660-43113682 CACTCACCCTGGATGTCTTCGGG - Exonic
1067252292 10:44597064-44597086 CATTTACCCAGGAGTCATTCAGG - Intergenic
1073243050 10:102070695-102070717 CCTTCACCCAGGATGCTTGCTGG - Intergenic
1076266267 10:129111928-129111950 CATTCACCAAGGACTTCCTCCGG + Intergenic
1076694353 10:132240013-132240035 AGTTCACCCAGGCTGCCTTCCGG + Intronic
1077334872 11:1998758-1998780 CAATCACCCAGCAGGCCCTCTGG + Intergenic
1082927740 11:58568794-58568816 CATAAACCCAGGACTCTTTCAGG + Intronic
1083038938 11:59668418-59668440 CATTCACACAGGCTACCTTCAGG - Intronic
1083276294 11:61598910-61598932 CAATGGCCCAGGACGCCTTCTGG + Intergenic
1084077239 11:66789410-66789432 CATTCTCCCAGGAAGCCCTTGGG + Intronic
1085415730 11:76318106-76318128 GAATCACCCAGAGCGCCTTCAGG - Intergenic
1086041645 11:82486557-82486579 CAGAAACCCAGGAGGCCTTCTGG + Intergenic
1087292602 11:96336470-96336492 TATTCTCCCAGGAAGCCTGCTGG + Intronic
1088746007 11:112805722-112805744 CAATCACCCATGAGGCCTTCTGG - Intergenic
1090765153 11:129870037-129870059 AATTGACCCAGGACCTCTTCGGG - Exonic
1202817855 11_KI270721v1_random:53940-53962 CAATCACCCAGCAGGCCCTCTGG + Intergenic
1097379360 12:58876653-58876675 CATTCACCCGGGATGCCTGTGGG - Intronic
1100941372 12:99725887-99725909 TATTTACCCAGGAGTCCTTCAGG - Intronic
1103506594 12:121445274-121445296 CATCCACCCTGGATGCCTTAAGG - Exonic
1108328173 13:49355949-49355971 CATTCACCCACCACAGCTTCAGG - Intronic
1111423615 13:88050996-88051018 AATTCACCCAGGATGCTCTCAGG + Intergenic
1117889830 14:60407710-60407732 TATTTACCCAGGAGTCCTTCAGG + Intronic
1119255673 14:73194115-73194137 CATTAACCCAGGCAGCTTTCAGG + Intronic
1121627697 14:95398670-95398692 CTTTCTCCCTGGACCCCTTCAGG + Intergenic
1122079315 14:99256114-99256136 CCATCACCCAGGACGCAGTCAGG - Intronic
1123820082 15:24020399-24020421 CATTTACCCAAGACTCATTCAGG - Intergenic
1123918620 15:25055213-25055235 CATACCCTCTGGACGCCTTCAGG - Intergenic
1123920432 15:25066052-25066074 CATTCCCTCTGGACGCCTTTGGG - Intergenic
1123921267 15:25071427-25071449 CATTCCCTCTGGATGCCTTCGGG - Intergenic
1127300328 15:57646711-57646733 CATTCAGGAAGGACACCTTCAGG - Intronic
1127718364 15:61674107-61674129 CATCCCCCAAGGAAGCCTTCTGG - Intergenic
1129041504 15:72690709-72690731 CATTGACACAGGAACCCTTCTGG - Intronic
1129294874 15:74594672-74594694 CATGCTCCCAGGAGGCCTGCAGG - Intronic
1129884878 15:79031028-79031050 CTGTCACCCAGGACCCCCTCTGG + Intronic
1132222407 15:100114770-100114792 CCTCCACCCAGGAAGCCTTGCGG - Intronic
1132783909 16:1643829-1643851 CATTCAGCCATGCCGCCTTCTGG - Intronic
1132843607 16:1990186-1990208 CACTCACCCAGGACGCGACCCGG - Exonic
1133970194 16:10561960-10561982 AATTCACCCATGAAGCCATCTGG - Intronic
1136465736 16:30442418-30442440 CTTTCACCTAGGAGGCCTTGTGG + Intergenic
1139197405 16:64936026-64936048 TATTCACCAAGGAAGCCATCTGG - Intergenic
1139666393 16:68459792-68459814 AACTCACCCATGACGGCTTCTGG - Intergenic
1142414578 16:89934453-89934475 CATTCACCCAGGATCCCCTCAGG + Intronic
1143108144 17:4539615-4539637 CATTCACCTGGGACGGCTTCTGG + Exonic
1143943057 17:10563199-10563221 GACTCACCCAGGGCGACTTCCGG - Intergenic
1144875933 17:18397251-18397273 CAGTCACACACGAAGCCTTCTGG + Intergenic
1145156295 17:20547169-20547191 CAGTCACACACGAAGCCTTCGGG - Intergenic
1151220426 17:72607629-72607651 CATTCATCCACGAAGCCATCTGG - Intergenic
1151284990 17:73104425-73104447 CATTCACCCAGGACACATCCAGG - Intergenic
1153857471 18:9164645-9164667 TATTCACCCAGGAGTCATTCAGG + Intronic
1155032473 18:21996658-21996680 CTTTCACCCAGGCGGCCTTTGGG + Intergenic
1155848067 18:30733817-30733839 TATTTACCCAGGAATCCTTCAGG - Intergenic
1159076931 18:63690952-63690974 CATTTACCCAGGAGTCATTCAGG - Intronic
1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164139770 19:22448688-22448710 ATTTCACCCAGGAGGCCTGCAGG + Intronic
1164168717 19:22704071-22704093 CATTCACACAGGTGACCTTCTGG + Intergenic
1164183535 19:22840879-22840901 GTTTCACCCAGGAGGCCTGCAGG + Intergenic
1165417635 19:35704564-35704586 CATACACCCAGGACGGCTTAAGG - Exonic
1166540560 19:43602591-43602613 CATTCAGCCAGCACCCATTCAGG - Intronic
1167407303 19:49320901-49320923 AATTCACCCATGAAGCCATCAGG - Intronic
1168715023 19:58521933-58521955 CCTTCACCCAGGACAGCTACTGG + Intronic
926554246 2:14338811-14338833 AATTCACCCATGAAGCCATCTGG - Intergenic
927963548 2:27255424-27255446 GCTTCAGCCAGGACGGCTTCAGG + Exonic
929966584 2:46541917-46541939 CATTCTCCGAGGTCGCCTTTCGG - Intronic
933131677 2:78680743-78680765 GACTCACCCAGGACAACTTCCGG - Intergenic
933659798 2:84918030-84918052 CATTCACCCACGCAGGCTTCTGG + Intergenic
933878130 2:86640283-86640305 AATTCACCCATGATGTCTTCTGG + Intronic
935004075 2:99053141-99053163 AATTCACCCATGAAGCCATCTGG - Intronic
935210335 2:100934572-100934594 CATTCACCCAGAAGGCCTGCTGG - Intronic
937148130 2:119664897-119664919 GATTCACCCAGGAGTCATTCAGG - Intergenic
939884262 2:147664288-147664310 CAAACACCCAGTACACCTTCTGG - Intergenic
1169012133 20:2259630-2259652 CATTAACCCAGACCGCCTTTTGG - Intergenic
1169692362 20:8345753-8345775 CTTTCACCCAGCACATCTTCAGG - Intronic
1172207617 20:33175495-33175517 CATTCTCCCAGGACGGCAACAGG - Exonic
1174110979 20:48197589-48197611 CGTTCACCCATCACTCCTTCTGG - Intergenic
1174377033 20:50133123-50133145 CACTCACCCAGGAGGCATCCAGG - Intronic
1174913554 20:54632109-54632131 CATTCAGCCACGACCCCTGCAGG - Intronic
1175466364 20:59193113-59193135 CAGTCACCAAGGAGGCCTCCAGG - Exonic
1181557345 22:23678767-23678789 CATTCACCCACCTCGCCCTCTGG - Intergenic
1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG + Intergenic
952103340 3:30040351-30040373 TATTTACCCAGGACTCTTTCAGG - Intergenic
952919551 3:38275436-38275458 TATTGACCGAGGCCGCCTTCTGG - Exonic
954553607 3:51501999-51502021 CATTCCTCCAGCACTCCTTCAGG + Intergenic
958598603 3:96263413-96263435 AATTCAGCCATGAAGCCTTCTGG - Intergenic
958656202 3:97006855-97006877 CATTTACCCAGGAGTCATTCAGG + Intronic
959543649 3:107569864-107569886 CAATCACCTTGGAAGCCTTCTGG - Intronic
960679829 3:120236253-120236275 TATTCACCCAGGAGTCATTCAGG + Intronic
963532272 3:146485690-146485712 CATTTACCCAGGAGTCATTCAGG - Intronic
965082658 3:164054383-164054405 CATTCACCAGGGAAGCCATCAGG + Intergenic
967014075 3:185465971-185465993 CATTCACCCAACATTCCTTCCGG + Intronic
968649514 4:1754935-1754957 CATTCACCAAGGAGGCTTCCTGG + Intergenic
969198725 4:5584742-5584764 CGGTCACCCGGGACGCCTTCTGG + Exonic
970460762 4:16272560-16272582 CTCTCTCCCAGGACTCCTTCTGG + Intergenic
972885307 4:43478074-43478096 AATTCACCCATGAAGCCATCTGG + Intergenic
974836371 4:67256193-67256215 CATTTACCCAGGAGTCATTCAGG - Intergenic
977295338 4:95202994-95203016 AAGTCACCCAGGACGCATGCCGG + Intronic
977462264 4:97339758-97339780 TATTCACCCAGGAGTCATTCAGG - Intronic
979104879 4:116671838-116671860 AATTCACCCAGTATGCCTTGAGG + Intergenic
979489786 4:121312303-121312325 TATTCACCCATGATGCCATCTGG - Intergenic
984625819 4:182006980-182007002 CATTTACCCAGGAGTCATTCAGG + Intergenic
986267457 5:6202637-6202659 TAATCACCCAGGCTGCCTTCTGG - Intergenic
987188632 5:15450831-15450853 CATTCACGTAGGAATCCTTCTGG - Intergenic
988482933 5:31644721-31644743 TATTCACTCAGAACGCATTCTGG - Intronic
993598933 5:89895837-89895859 AATTCACCCATGAAGCCATCTGG - Intergenic
994240978 5:97420906-97420928 CAATCACCCAGTATGCCTTGTGG + Intergenic
1003458096 6:6302598-6302620 CACTCACCCAGGGCTACTTCTGG - Intronic
1004505719 6:16245301-16245323 CATTCACCCAGGACGCCTTCTGG + Intronic
1005039601 6:21588935-21588957 CCTTCAGGCAGAACGCCTTCCGG - Intergenic
1007498029 6:42274970-42274992 CAGCCACCCAGTACCCCTTCTGG + Intronic
1011556008 6:88572246-88572268 CATTCACCCAGGACCTTTGCTGG - Intergenic
1013461805 6:110381474-110381496 TATTCACCCAGGAGTCATTCAGG - Intergenic
1014228056 6:118870989-118871011 AATTCAGCCATGAAGCCTTCTGG - Intronic
1024994671 7:55263742-55263764 AATTCACCCATGAAGCCATCTGG - Intergenic
1032140179 7:129322078-129322100 AATTCACCAAGTAAGCCTTCTGG + Intronic
1034986940 7:155522157-155522179 CATTGACTGAGGATGCCTTCTGG + Intronic
1035729139 8:1842367-1842389 CACACACCCAGGACGCCACCAGG - Intronic
1039454184 8:37696907-37696929 AGTTCACCCAGGACCCCTGCGGG - Intronic
1041743357 8:61179731-61179753 TATTCACCCAGGAGTCCTTCAGG - Intronic
1047528921 8:125657644-125657666 CATGCACCCAGCACTCCCTCTGG - Intergenic
1049779960 8:144424396-144424418 CGTTCACCCAGGAGGCCTGCAGG - Intronic
1051803811 9:20968058-20968080 AATTCACCAATGAAGCCTTCTGG + Intronic
1056565990 9:87772588-87772610 CATTCTCCCAGGAATCCCTCTGG - Intergenic
1057042928 9:91860305-91860327 CATTCATCCAGGGAGCCTTGGGG - Intronic
1057056811 9:91969463-91969485 AATTCACCAAGGATGCCCTCTGG - Intergenic
1059483961 9:114612711-114612733 CCTTCCTCCAGGAAGCCTTCCGG + Intronic
1185976048 X:4721412-4721434 CATTCACCCAGGAGGGCAACTGG + Intergenic
1187846525 X:23543606-23543628 CATTGACCCAGCAGTCCTTCAGG - Intergenic
1191034639 X:56011360-56011382 TATTTACCCAGGAGGCATTCAGG - Intergenic
1191064640 X:56334723-56334745 TATTCACCCAGGAGTCATTCAGG + Intergenic
1191186330 X:57616605-57616627 CATTTACCCAGGAGTCATTCAGG - Intergenic
1192303032 X:69926409-69926431 CATTTACCCAGGAGTCATTCAGG + Intronic
1197881107 X:131167597-131167619 GATTCACCCAAGACTCCATCTGG - Intergenic