ID: 1004506182

View in Genome Browser
Species Human (GRCh38)
Location 6:16248727-16248749
Sequence AGCAGAGCAGGGAAAGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1149
Summary {0: 1, 1: 1, 2: 15, 3: 124, 4: 1008}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004506182_1004506189 29 Left 1004506182 6:16248727-16248749 CCTCACCCTTTCCCTGCTCTGCT 0: 1
1: 1
2: 15
3: 124
4: 1008
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506182_1004506188 28 Left 1004506182 6:16248727-16248749 CCTCACCCTTTCCCTGCTCTGCT 0: 1
1: 1
2: 15
3: 124
4: 1008
Right 1004506188 6:16248778-16248800 TATGTGTTAGTATAAAAGTGAGG No data
1004506182_1004506190 30 Left 1004506182 6:16248727-16248749 CCTCACCCTTTCCCTGCTCTGCT 0: 1
1: 1
2: 15
3: 124
4: 1008
Right 1004506190 6:16248780-16248802 TGTGTTAGTATAAAAGTGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004506182 Original CRISPR AGCAGAGCAGGGAAAGGGTG AGG (reversed) Intronic
900120812 1:1047955-1047977 AGCAGGGCCAGGAAGGGGTGAGG - Intronic
900972626 1:5999974-5999996 AGCAGAGCAGGATATGGATGGGG - Intronic
900977253 1:6025508-6025530 GGCAGAGCAGGGAGAGGCCGCGG + Intronic
901229662 1:7634666-7634688 AGGAGAGCTGGGACAGGCTGGGG + Intronic
901264691 1:7901845-7901867 AGCAGATCACGGAACGTGTGAGG + Intergenic
901307479 1:8243193-8243215 AGAAGAGAAGGGAAGGGGAGGGG + Intergenic
901470193 1:9450633-9450655 ATCAGAGCAGGGACAGGGCAAGG - Intergenic
901528009 1:9836152-9836174 AGCAGACCAGGGACAGAATGAGG - Intergenic
901536011 1:9883405-9883427 GGCAGAGCAGGGCAGGGGAGAGG + Intronic
901769098 1:11521480-11521502 GGGAGAGGAGGGAAAGGGTGGGG + Intronic
902106199 1:14038226-14038248 AGCAGAGCAGGAAAGGGATCTGG + Intergenic
902113082 1:14099235-14099257 ACCTGTGCAGGGACAGGGTGGGG + Intergenic
902552320 1:17226461-17226483 ACCAGAGGAGGGAACGGGTGTGG - Intronic
902623583 1:17664330-17664352 TGGAGAGCGGGGAGAGGGTGTGG + Intronic
902963189 1:19979009-19979031 TGCAGAGCTGGGAACGGGTCAGG - Intronic
902982783 1:20137884-20137906 AGCTGGGCAGAGGAAGGGTGGGG + Intergenic
903011939 1:20337589-20337611 GGGACAGCAGGGAAAGAGTGGGG - Intronic
903130299 1:21274864-21274886 AACAGAGAAAGGAAATGGTGGGG + Intronic
903172824 1:21564233-21564255 AGCCGGGCAGGGACGGGGTGAGG + Intronic
903227916 1:21904294-21904316 AGCAGAGAAGGGGAAGAGTGCGG + Intronic
903704476 1:25274996-25275018 AGGAGAGCAGGGACTGGGTGTGG + Intronic
903722767 1:25418316-25418338 AGGAGAGCAGGGACTGGGTGTGG - Intronic
904119883 1:28191041-28191063 AGCAAGGGAGGGAAAGGGTGAGG - Intronic
904163638 1:28538734-28538756 AGCAGAGCAGGGTATGGGGTGGG + Intronic
904344648 1:29859874-29859896 CACAGAGCAGGGAAGTGGTGAGG - Intergenic
904346981 1:29879120-29879142 CACAGAGCAGGGGAAGGGGGAGG - Intergenic
904489613 1:30850279-30850301 AGCAGGGCAGGGACACGGTCAGG + Intergenic
904595007 1:31638410-31638432 AGCATAGGATGGAAAGGGAGTGG + Intronic
904706581 1:32395308-32395330 AGGGGAGTAGGGAAACGGTGAGG - Intergenic
904821982 1:33251464-33251486 GGCAGAGTAGGGAAGCGGTGGGG - Intergenic
904860552 1:33534464-33534486 AGCAGAGCAGGGAGGGAGGGTGG - Intronic
905037967 1:34929731-34929753 AGCCGAGCAGGGAGAGGGAGAGG + Intergenic
905472873 1:38206675-38206697 AGCAGAGCAGAGACAGAGAGAGG - Intergenic
906199857 1:43952988-43953010 AACAGATCAGGGCAAGTGTGTGG + Intronic
906244221 1:44261929-44261951 GAAAGAGCAGGAAAAGGGTGAGG - Intronic
906288285 1:44602735-44602757 GGCAGGGCAGGGGAAGGGTCTGG - Intronic
906322999 1:44828179-44828201 AGCAGAGCAGGGACTGGAAGAGG + Exonic
906986250 1:50686580-50686602 GGGAGAGGAGGGAAAGGGAGAGG + Intronic
907271798 1:53295595-53295617 AGCAGAGGAGGGGAGGGGTAGGG + Intronic
907612453 1:55886130-55886152 AGCAAAGCAGGAGAAGGGTGAGG + Intergenic
907969440 1:59366462-59366484 CTCAGAGCGGGGAAAGGGTTTGG - Intronic
908003108 1:59701001-59701023 AGCAGAGAAAGGAAAGAGAGAGG - Intronic
908383146 1:63615520-63615542 AGAAGAGGAGAGAAATGGTGAGG - Intronic
908471411 1:64447536-64447558 AGCAGAGCAGGGGAGGGAAGAGG + Intergenic
908570964 1:65409688-65409710 AGTAGAGGAGAGAAAGGCTGAGG + Intronic
908959953 1:69684894-69684916 AGCAGAGCAGGGATGGCCTGGGG - Intronic
909029619 1:70524064-70524086 AGCAGGGCAGAGAAAGGTAGGGG - Intergenic
909642631 1:77885178-77885200 AGCTGAGTAGGTGAAGGGTGAGG - Intergenic
910097584 1:83541159-83541181 AGCAAAGCAGGATAAGGGTGTGG - Intergenic
910740527 1:90510788-90510810 AGCAGAGCAGCAAAAGGGAAAGG - Intergenic
911016028 1:93333686-93333708 AGCAAAGAAGGGAAAGAGGGAGG + Intergenic
911237468 1:95426450-95426472 TGCAGAGCAGGGGCAGGGTAAGG + Intergenic
911550687 1:99275891-99275913 AGCACAGTAGGGAGAGGGAGAGG + Intronic
911584272 1:99672489-99672511 AGGAGAGCAAGGAAAGTGTTAGG - Intronic
912501706 1:110127032-110127054 AGGAGGGCAGGGAAAGGGTCTGG - Intergenic
912516086 1:110217488-110217510 AGCAGAGCTTGGACAGTGTGGGG + Intronic
912698218 1:111856858-111856880 AGCAGGGCAGGAAGAGGGGGAGG + Intronic
912888812 1:113505622-113505644 AGCAGGGAAGGGAAAAGGAGAGG + Intronic
912934996 1:113995263-113995285 AGAAGAGAAGGGAAAGGGTGAGG + Intergenic
912971683 1:114289770-114289792 AGTAGAGCAGAAAAAGGGGGTGG + Intergenic
913173049 1:116249591-116249613 AGCAGGACAGGGAATGCGTGGGG + Intergenic
913435410 1:118842530-118842552 AGCAGTGCTGGGAGTGGGTGAGG + Intergenic
913958544 1:143322927-143322949 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
914052861 1:144148307-144148329 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
914126336 1:144818234-144818256 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
914224849 1:145711923-145711945 AGAAGAGCAAGGAAAGTGTCAGG + Intergenic
914936777 1:151988698-151988720 AGAAGAGAAGGAAAAGGGTGTGG - Intronic
915154221 1:153861054-153861076 GGCAGAGGAGAGAAAGTGTGTGG + Intronic
915227030 1:154418954-154418976 AGAAGAGCAGGGAAGAGGAGAGG + Intronic
915357374 1:155263408-155263430 AGGAGGGCAGGAAAAAGGTGAGG + Intronic
915584884 1:156839099-156839121 TGCAGGGCAGGGGAGGGGTGGGG + Intronic
915622242 1:157092846-157092868 GGCAGGGCTGGGACAGGGTGCGG - Exonic
915662727 1:157417276-157417298 ACCAGAGCTGGGAAAGGCGGGGG - Intergenic
915706767 1:157851225-157851247 AGCAGAGTAGGGAGGAGGTGTGG - Intronic
916138767 1:161675632-161675654 GGCAGAGCTGGCAAAGGATGGGG + Intronic
916264128 1:162873177-162873199 AACAGTGCAGGGAAGAGGTGTGG - Intergenic
917307064 1:173637968-173637990 AGCAACGCAGGGAAAGAGAGAGG + Intronic
917603213 1:176598217-176598239 TGCAGAGCAAGGACAGAGTGTGG - Intronic
917845939 1:179020268-179020290 AGCAAAGCAGGCCAAAGGTGAGG - Intergenic
918046920 1:180947208-180947230 TGCAGAGCAGGCAACGGGTTGGG + Exonic
918084933 1:181237320-181237342 AACAGAGCAGGGAAAGGGCAGGG + Intergenic
918363800 1:183785457-183785479 AGTAGAGCAGGCACAGGATGTGG - Intronic
918573913 1:186032535-186032557 AGCAGTGCAGAGCAAAGGTGGGG - Intronic
918734643 1:188043602-188043624 GGCACAGCAGGGCAGGGGTGGGG - Intergenic
919021942 1:192117117-192117139 AATAAAGCAGGGAAAGGGTGAGG - Intergenic
919621126 1:199865707-199865729 AGCAAAGCAAAGAAAGGATGAGG + Intergenic
919788548 1:201275605-201275627 AGCAGCACAGGGAAAGGCCGTGG - Intergenic
919837110 1:201582589-201582611 AGAAGAGCTGGGGAATGGTGAGG + Intergenic
919979911 1:202636374-202636396 TCCAGAGCAGGGAGAGGGAGAGG + Intronic
920003024 1:202812223-202812245 AGCAGGGCAGGGAATGGGGGAGG - Intergenic
920218784 1:204380118-204380140 AACAGAGAAGGGAAAGGGGCTGG + Intergenic
920255594 1:204652104-204652126 AGCAGAGAAGACAAAGGTTGCGG + Intronic
920701922 1:208224366-208224388 TGGGGAGCAGGGAGAGGGTGGGG + Intronic
920833301 1:209484716-209484738 AGGAGAGCAGGGATAGGGTGGGG - Intergenic
920838682 1:209535660-209535682 AGCAGAGCAAGGGAAAGGTGGGG - Intergenic
921686486 1:218094946-218094968 AGTAGAGGAGGGAAAGGATACGG - Intergenic
922048254 1:221967134-221967156 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
922176659 1:223202642-223202664 GGCAGAGCAGGGATGGGGAGGGG + Intergenic
922204060 1:223431281-223431303 ACCAGGGAAGGGAAGGGGTGTGG - Intergenic
922720268 1:227896699-227896721 AGATGAGCAGGGACAGGGTGAGG + Intergenic
922750869 1:228069517-228069539 AGCATAGCAGGGATAGTGTAGGG + Intergenic
922750916 1:228069680-228069702 AGCATAGCAGGGATAGCGTGGGG + Intergenic
922810885 1:228414929-228414951 AGCTGAGCTGGGAAAAGGCGAGG - Exonic
922930453 1:229385219-229385241 GGCACAGCAGGGTGAGGGTGAGG - Intergenic
923077394 1:230622324-230622346 ACCAGGGAAGGGAAACGGTGAGG - Intergenic
923355215 1:233148273-233148295 AGCAGAGATGGGAAAAGGTGAGG + Intronic
923634812 1:235684980-235685002 AGCAGGGCAGGAAAAGATTGAGG - Intronic
923669825 1:236030920-236030942 AGCTGTGCAGGGAAGGAGTGGGG + Intronic
923770899 1:236936782-236936804 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
924007987 1:239633292-239633314 AGGAGAGCGGGGAGAGGGTGCGG + Intronic
924348206 1:243092494-243092516 AGCAGAGCAGGTGATGGGAGAGG + Intergenic
924617269 1:245622672-245622694 TGCAGAGTAGGGAAAGGCAGAGG + Intronic
1062933503 10:1368352-1368374 AACACAGCAGGGAAATGGTGGGG + Intronic
1062986325 10:1772669-1772691 AGCAGACCCGGGAGAGGGTCTGG - Intergenic
1063865034 10:10354576-10354598 AGCAGAGTAAGGAAAGATTGTGG + Intergenic
1064361539 10:14669763-14669785 ACCAGAGTCAGGAAAGGGTGCGG + Intronic
1064414351 10:15135855-15135877 AGCAGAGAAGGGAAGGGAAGGGG + Intronic
1064663979 10:17631360-17631382 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1064850284 10:19701751-19701773 AGAAGAGAAGGGGAAGGGAGAGG - Intronic
1064969667 10:21052002-21052024 AGGAGAGCAGAGAAGGGGAGAGG + Intronic
1065010986 10:21420475-21420497 AGAACAGCAGGGAAAGGTCGGGG + Intergenic
1065128320 10:22595733-22595755 AGCAGCACAGGGTAATGGTGAGG + Intronic
1065390243 10:25175385-25175407 AGAAGAGGAGGGAACGGGAGGGG - Exonic
1065595629 10:27308478-27308500 AGCATAGGAAGGAAAGGGGGAGG - Intergenic
1065755184 10:28924557-28924579 AGCAGAGGAGAAAAAGGTTGTGG - Intergenic
1065928348 10:30456442-30456464 AGTTGAGCAGGGTTAGGGTGGGG + Intronic
1066380847 10:34900135-34900157 ATCAGAGCAGCAAAGGGGTGAGG - Intergenic
1066412953 10:35191774-35191796 AGCTCAGCAGGAAGAGGGTGGGG - Intronic
1066413369 10:35195476-35195498 AGAAGAGGAGGGGAAGAGTGGGG - Intronic
1066523331 10:36247786-36247808 AGGCGAGGAGGGAAAGGGAGGGG - Intergenic
1066759116 10:38737637-38737659 TGCAGAGCCAGGAAAGGGTCAGG - Intergenic
1066763566 10:38782119-38782141 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1066962512 10:42235133-42235155 TGCAGAGCCAGGAAAGGGTCAGG + Intergenic
1067292777 10:44956470-44956492 ATCAGAGCAGGGAGAAGGAGAGG + Intergenic
1067463953 10:46480019-46480041 AGCAGGGCCAGGAAAGGATGCGG - Intergenic
1067523519 10:47025424-47025446 AACAGAGCAGGGAACGTGTGAGG + Intergenic
1067623242 10:47904632-47904654 AGCAGGGCCAGGAAAGGATGCGG + Intergenic
1068379236 10:56227671-56227693 AACAGAGAAGATAAAGGGTGTGG + Intergenic
1068533464 10:58214030-58214052 AGCAAAGCAGGTTAAAGGTGGGG + Intronic
1068733638 10:60387782-60387804 AGCAAAATAGGGAAGGGGTGAGG - Intronic
1068945315 10:62723688-62723710 AGCCTAGCAGGGGAAGGATGAGG + Intergenic
1069344223 10:67448191-67448213 AGGAGAGCAGGGAAAGGGACTGG + Intronic
1069584958 10:69593361-69593383 AGCAGAGGAGGTAATGAGTGGGG + Intergenic
1069661798 10:70127814-70127836 ACCAGAGCAGGGCCAGGGAGGGG + Intronic
1069857401 10:71448880-71448902 AGCAGGCCAGGGAGAGGGGGAGG + Intronic
1070060597 10:72979765-72979787 AGAAAAGAAGGGAAAAGGTGAGG - Intergenic
1070116621 10:73534967-73534989 AGCAGGGTAGGGAAAGGGATGGG - Intronic
1070178830 10:73995873-73995895 AGCAAAGTGGGGACAGGGTGAGG + Intergenic
1070342586 10:75511255-75511277 AGCACAGGAGGTCAAGGGTGCGG + Intronic
1070513207 10:77179655-77179677 AGAAGAGCAGAGGAAGAGTGTGG + Intronic
1070762807 10:79035269-79035291 AGCAGGGCAGGGCAAGGGTGTGG - Intergenic
1071280808 10:84100928-84100950 TGCAGAGAAGAGGAAGGGTGAGG + Intergenic
1071438164 10:85666275-85666297 AGCAGATCAGTGTAGGGGTGTGG - Intronic
1071616870 10:87082573-87082595 AACAGAACAGGGACAGGGAGGGG + Intronic
1072003006 10:91216316-91216338 AGCAGAGGTGGGGAAGGGTGAGG + Intronic
1072193348 10:93093860-93093882 AGCAAAGCAGGGAAGGGCAGAGG - Intergenic
1072633217 10:97161190-97161212 AGGGGAGGAGGGAAAGGGTCTGG - Intronic
1073072572 10:100803824-100803846 AGCAAAGGAGGGGAAGGGGGAGG - Intronic
1073302800 10:102481216-102481238 AGCATTGTAGGGAAAGGGAGCGG - Intronic
1073303437 10:102484890-102484912 AACAGAGCATGGACAGGCTGTGG + Intronic
1073319447 10:102605678-102605700 GGCAGAACTGGAAAAGGGTGTGG - Intronic
1073649253 10:105341230-105341252 TGCAGAGCAGAGCAGGGGTGAGG - Intergenic
1073849922 10:107602935-107602957 AGAAGAGGAGGGAGAGGGAGGGG - Intergenic
1074058095 10:109940865-109940887 AGAAGAGGAGGGAAAGGGAAAGG - Intergenic
1074165604 10:110871788-110871810 AGCTGAGGAGGAAAAGGGAGAGG - Exonic
1074189328 10:111122436-111122458 AGCAGAGCAGAGAAAGGTGGAGG + Intergenic
1074283251 10:112073318-112073340 ACCAGGGCAGGGAAGGGGTATGG - Intergenic
1075470223 10:122683251-122683273 AGCTGAGCAGGGAGAGGAGGTGG - Intergenic
1075482601 10:122795627-122795649 GGCAGAGCAGGGTTAGAGTGAGG - Intergenic
1075654726 10:124153308-124153330 AGCAGAGGAAGGAGAGGCTGGGG + Intergenic
1075990753 10:126836761-126836783 TGCAGTGCAGAGAATGGGTGGGG - Intergenic
1076819929 10:132933205-132933227 AGCAGAGCAGGGGGAGGAGGAGG - Intronic
1076919102 10:133442076-133442098 AGCAGTGCAGGCTGAGGGTGGGG - Intergenic
1076990425 11:270767-270789 AGCAGAGAAGGGAGGTGGTGTGG + Intergenic
1077695593 11:4389944-4389966 TTCAGAGCAGGGAATGGGAGAGG - Intronic
1077854241 11:6106138-6106160 ACCAGAGGCCGGAAAGGGTGGGG + Intergenic
1077915898 11:6611479-6611501 AGCAGAGCGGGAGGAGGGTGAGG + Intronic
1078004826 11:7524737-7524759 GGCAGAAAAGGGAAGGGGTGGGG + Intronic
1078103414 11:8343551-8343573 GAAAGAACAGGGAAAGGGTGGGG + Intergenic
1078478334 11:11653776-11653798 AGTGGAGCAGGGAAATGGAGAGG + Intergenic
1078513716 11:12006429-12006451 GGCAGAGCAGGGACTGGATGAGG + Intronic
1078825892 11:14930106-14930128 AGCAGAGCAGGGATAAGGGTGGG + Intronic
1078849120 11:15148053-15148075 AGCACAGCAGGGACAAGGCGAGG + Intronic
1078988957 11:16625808-16625830 AGATGCACAGGGAAAGGGTGTGG - Intronic
1079142705 11:17823400-17823422 AGTAGAGCATGGAAAGGGGTTGG - Intronic
1079316237 11:19410095-19410117 AGCAGGGCAGGAAATGGGTAGGG - Intronic
1080037187 11:27722070-27722092 AGCGCAGCAGGGAGGGGGTGGGG + Intergenic
1080662059 11:34304681-34304703 AGGAGAGGAGGGAAATGGAGGGG + Intronic
1081211259 11:40337008-40337030 AGCGAATCAGGGAAAGGGAGTGG + Intronic
1081766237 11:45612315-45612337 AGCAGAGCATAGAAAGGGCAAGG - Intergenic
1081812489 11:45921932-45921954 AGCAGGCCAGGGAATGGGTGGGG - Intronic
1081931652 11:46875683-46875705 TGCAGAGGAAGGAGAGGGTGGGG + Intronic
1081963131 11:47152955-47152977 AGCAGGGCAGGCAAAGGCTCTGG - Intronic
1082764676 11:57157582-57157604 AGCAGAGGATGTAAAGTGTGTGG + Intergenic
1082881253 11:58040653-58040675 AGCAGCTCAGGGACAGGGAGGGG + Intronic
1082933885 11:58636966-58636988 AACAGAGAAGGCAAAGGGGGAGG - Intergenic
1083682175 11:64356718-64356740 AGGAGAGCAGGGGAGGGGTCAGG + Intronic
1083682933 11:64359547-64359569 GGCTGTGCCGGGAAAGGGTGGGG - Intronic
1083715190 11:64571320-64571342 AGCCTGGCAGGGAAAGGGAGGGG - Exonic
1083718449 11:64592224-64592246 AGCAGGGCCAGGACAGGGTGAGG - Intronic
1083783907 11:64933071-64933093 TGAAGGGCAGGGAAAGGGAGAGG + Intronic
1083902373 11:65649880-65649902 AGGAGAGCAGGGGAGGGGTTGGG + Intronic
1084161942 11:67354916-67354938 CCCAGAGCAGGGAAAGGAGGAGG - Intronic
1084236142 11:67788964-67788986 AGCAGAGCAGTTGAAGGCTGAGG + Intergenic
1084323869 11:68388065-68388087 AGCACAGCAGGCAGAGGGCGGGG + Intronic
1084341153 11:68502611-68502633 TGCAGAGAAGGGAAAGTGTAAGG + Intronic
1084858016 11:72001138-72001160 AGCAGAGCAGGGTAGGGGAAGGG + Intronic
1084959526 11:72709212-72709234 AGCAGAGAAGTGGAAGGGTTGGG + Intronic
1085044841 11:73346773-73346795 AGGAGGGCAGGGAGAGGGTGTGG + Intronic
1085453223 11:76650220-76650242 AGCAGAGTAGGGTATGGGTGGGG - Intergenic
1086511427 11:87562275-87562297 AGGAAAGTAGGGAAAGGGTAAGG - Intergenic
1086537536 11:87866151-87866173 ACCAGAGCAGGGAGAGTGTGGGG + Intergenic
1086837165 11:91639057-91639079 AGCAGAGAAGAAAAAGGGTTAGG + Intergenic
1088443687 11:109900801-109900823 AGGAGAGGAGGGAGAGGGAGAGG + Intergenic
1088684136 11:112270959-112270981 TGCAGAGCAGAAACAGGGTGAGG + Intergenic
1088692443 11:112339110-112339132 AACTGAGCAGGGGGAGGGTGGGG + Intergenic
1088938267 11:114426343-114426365 AGAAGAGAAGGGAAAGAGGGAGG - Intronic
1089095778 11:115918817-115918839 AGCAGAGTAGGGAACTGGGGAGG + Intergenic
1089348939 11:117810459-117810481 AGAAAAGCAGAGAAAGGGTTGGG - Intronic
1089618307 11:119707581-119707603 GGCATAGCAGGGACAAGGTGGGG - Intronic
1089767424 11:120777972-120777994 AGTAGAGCAGGGTAAGGATGAGG + Intronic
1089931895 11:122321167-122321189 AGCAGAGCAGGCTAAGGCTGGGG - Intergenic
1090399930 11:126442695-126442717 TGCAGAGCAGGCAGAGGGAGGGG - Intronic
1090425236 11:126602891-126602913 AGCACAGCAGGGCAAGGGGCAGG + Intronic
1090990718 11:131814925-131814947 AGCAGAGCTGGGAGAGGTAGTGG - Intronic
1091235137 11:134016846-134016868 TGATGAGCATGGAAAGGGTGGGG + Intergenic
1091572976 12:1706763-1706785 ACCAGAGGAGGGGAGGGGTGTGG - Intronic
1091697825 12:2639902-2639924 AGCAGAGCAGGCACAGGGAGGGG + Intronic
1091794649 12:3291097-3291119 GGGAGAGGAGGGAAAGAGTGAGG - Intergenic
1091838914 12:3605196-3605218 AGGAGAGAAGGGAAAGGAAGGGG + Intergenic
1091871437 12:3894471-3894493 AACCGAGCTGGGAAAGGCTGTGG - Intergenic
1091918216 12:4284150-4284172 AGCAGAGGAGGGGCAGGTTGGGG + Intronic
1092000341 12:5026524-5026546 ACCAGTGCATGGAAAAGGTGTGG - Intergenic
1092214663 12:6672542-6672564 AGGAGAGGAGGGAAGGGGGGAGG + Intronic
1092894226 12:12997685-12997707 AGCAGAGCAGGGAATGGGTGAGG + Intronic
1093578655 12:20764557-20764579 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1093584676 12:20821533-20821555 AGAAAAGCAGAGAAAGGGTTGGG + Intronic
1094090677 12:26645534-26645556 AGCAGAGCATGGACAGAGGGAGG + Intronic
1095178912 12:39124631-39124653 AGGAGAGAAGGGTAAGGGGGTGG + Intergenic
1095370184 12:41457973-41457995 AGAAGAGCAGGGAAAAGGGAGGG + Intronic
1095615509 12:44183731-44183753 AGAAGAGGTGGGAAAGGGGGCGG + Intronic
1095857306 12:46874409-46874431 GGCAGAGCAGAGATTGGGTGAGG + Intergenic
1096002236 12:48139696-48139718 GGCAGAGCAGGGACAGGGCAGGG - Intronic
1096449071 12:51721998-51722020 GGCAGAGCAGGGAAAGAGGAGGG - Intronic
1096473985 12:51896904-51896926 GGCAGAGCAGGGCATGGGTCAGG - Intergenic
1096490406 12:52009764-52009786 AGTAGAGAAGGGAAACTGTGGGG - Intronic
1096529964 12:52236273-52236295 TGCAGAGTAGGGAAGGTGTGGGG + Intronic
1096973698 12:55686347-55686369 AGCAGAGGATGGAAAGATTGAGG + Intronic
1097079175 12:56417068-56417090 AGCACAGCAGGGGAAGGGCTGGG + Exonic
1097087010 12:56476405-56476427 TGGAGATCAGGGATAGGGTGGGG - Exonic
1097398426 12:59103017-59103039 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1097857601 12:64481887-64481909 AGCAGATCAGGAAAAGTGTTGGG + Exonic
1099297641 12:80849554-80849576 AGCACAGCAGGGACATGGTCAGG - Intronic
1099552730 12:84068605-84068627 AGCAGAGCTGGGAAAGTCTGAGG + Intergenic
1099792674 12:87356734-87356756 TGCAGAGTGGGGTAAGGGTGCGG + Intergenic
1100237144 12:92672415-92672437 AACAGAGCAGGACAAGGGGGAGG + Intergenic
1100362226 12:93889524-93889546 TGCAGTGGAGGGCAAGGGTGAGG - Intronic
1100480889 12:94977863-94977885 ACCAGAGCAGGGGAAGAGTATGG + Intronic
1100848771 12:98687584-98687606 AGCAGAGAAGGGAGAGAGTGAGG + Intronic
1100957198 12:99922049-99922071 AACTGAGCAGGGAAAGGTTAAGG - Intronic
1100991244 12:100254013-100254035 ATCAGAGCAGGAAAAGGGAGGGG - Intronic
1101133989 12:101720542-101720564 AGCAGAGAGGAGAAAGGGTAGGG + Intronic
1101157356 12:101940510-101940532 AGGAGAGGAGGGAAGGGGAGAGG + Intronic
1101347700 12:103901689-103901711 TGCAAGGCAGGCAAAGGGTGTGG + Intergenic
1101580426 12:106037502-106037524 GGGAGAGCAGGGGAAGGGAGGGG - Intergenic
1101788601 12:107908534-107908556 AGCAAGGCAGGGAAGGTGTGGGG + Intergenic
1101851139 12:108403441-108403463 AGGAGGGGAGGGAAAGGGAGAGG - Intergenic
1101858370 12:108462957-108462979 AGCAGAGGAGGGGAAGGAAGGGG + Intergenic
1102080997 12:110098002-110098024 AGCAGGGGAGGGAATGGGAGGGG - Intergenic
1102209016 12:111110944-111110966 TGCAGGGGAGGGGAAGGGTGAGG + Intronic
1102214065 12:111147720-111147742 GGCAGAGGAGGGAGAGGGCGAGG + Intronic
1102454383 12:113062835-113062857 AGCCCAGCAGGGGAAAGGTGAGG - Intronic
1102535182 12:113575884-113575906 AGCAGAGTTGGGAAGGGGAGAGG + Intergenic
1102999041 12:117371146-117371168 AGCAGTGCAGGGACAGAGGGAGG - Intronic
1103134992 12:118499404-118499426 AGGAGAGGAGGGGAAGGGAGGGG - Intergenic
1103158258 12:118706208-118706230 GGCAGAGCAGGGGAGGGGTGTGG - Intergenic
1103403740 12:120660376-120660398 TGCAGAGGACGGCAAGGGTGAGG - Intronic
1103455175 12:121059761-121059783 AGAAGGGCAGGGAGATGGTGTGG + Intergenic
1103793516 12:123488096-123488118 TCCAGAACAGGGAAAGGGAGAGG + Intronic
1103873330 12:124106940-124106962 GGCAGAGCAGGGACAAAGTGAGG + Intronic
1104181812 12:126388966-126388988 TGCAAAGCAGAGAAAGGGAGGGG - Intergenic
1104626414 12:130359450-130359472 AGCAGGGCAGGGAATGGTTATGG - Intronic
1104635994 12:130438145-130438167 AGCAGGGCAGGGGATGAGTGAGG + Intronic
1105586663 13:21751232-21751254 AGCTGAGCAGGATAAGGGAGAGG - Intergenic
1106075297 13:26455358-26455380 GGTAGAGGAGGGAAGGGGTGGGG + Intergenic
1106206749 13:27604268-27604290 AGCATAGCATGGAAAGAGCGTGG - Intronic
1106232335 13:27830239-27830261 AGCAGAGGAGGGCAAGGGAGAGG - Intergenic
1106785086 13:33099492-33099514 AGCAGAGCAGGGAGAGAGCCAGG - Intergenic
1106841077 13:33685521-33685543 AGGAGAACAGGGGAAGGTTGTGG - Intergenic
1107713149 13:43170501-43170523 AGCAGAGCAGAGAAACAGTGAGG - Intergenic
1108259989 13:48646649-48646671 AGTAGAGCAGGGTAGAGGTGAGG + Intergenic
1108590849 13:51911866-51911888 AGCAGAGCAGTGGGAGGGAGTGG - Intergenic
1109194985 13:59368835-59368857 AGGAGGGCAGAGAAAGGGTTAGG - Intergenic
1110451358 13:75640538-75640560 AGGAGAGAAAGGAATGGGTGGGG - Intronic
1110643641 13:77855414-77855436 AGCAGTGGAGGGAAAAGGTGGGG + Intergenic
1110703217 13:78574210-78574232 AGAAGAGGAGGGAAGGGGTGGGG - Intergenic
1111173990 13:84568059-84568081 AGCAGAGGAGGGACAGAATGAGG - Intergenic
1111630287 13:90840623-90840645 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1112204732 13:97313536-97313558 AGCAGAGCAGGGAAAAGTCCTGG - Intronic
1112261615 13:97882677-97882699 CGCTGAGCAGGGTCAGGGTGAGG - Intergenic
1112289180 13:98129904-98129926 ATCAGACCAGGGTAGGGGTGAGG - Intergenic
1112369831 13:98784837-98784859 AGCAGCGTAGGAAGAGGGTGTGG + Intergenic
1112490408 13:99858028-99858050 AGAAGTGCATGGAAAGGGTGAGG - Intronic
1112781153 13:102902802-102902824 AGCAGAGAAGGCCAAGGGGGTGG + Intergenic
1113005247 13:105694505-105694527 AGAAGAGCAAGGAAAGAGAGAGG + Intergenic
1113324176 13:109266522-109266544 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1113411396 13:110093492-110093514 AGAAGAGCAGGAAAAGAGTTTGG - Intergenic
1113619463 13:111703077-111703099 GGGAGAGCAGGGCAAGGGTTTGG + Intergenic
1113624992 13:111788338-111788360 GGGAGAGCAGGGCAAGGGTTTGG + Intergenic
1113697384 13:112355679-112355701 TGCAGAGTAGAGAAAGGGAGAGG - Intergenic
1113707728 13:112445277-112445299 AACAGAGCAGGGTGGGGGTGAGG + Intergenic
1113737514 13:112689520-112689542 TGCAGAGCAGGAAAAGCCTGCGG + Intergenic
1113884638 13:113652167-113652189 AGCACAGCAGGGGATGGCTGGGG - Intronic
1114365932 14:22027048-22027070 AGCTCAGCAGGGAAAGCTTGTGG + Intergenic
1114567429 14:23643124-23643146 ATCAGAGCAGAGCATGGGTGAGG - Intronic
1114674446 14:24431005-24431027 AGGAGAGCAGGGAAGAGGAGGGG + Intronic
1114804188 14:25815161-25815183 AACAGGGCAGTGATAGGGTGTGG - Intergenic
1115270402 14:31545157-31545179 AGTAGAGTACGGAAAAGGTGAGG - Intronic
1115637132 14:35300734-35300756 AGAAGAGCGGGGAAAGTGCGTGG - Intronic
1116183600 14:41567946-41567968 TACAGAGCATGGGAAGGGTGTGG + Intergenic
1116867348 14:50041489-50041511 AGCAGGGAAGGGAAGGGGAGAGG + Intergenic
1117420476 14:55539992-55540014 TGCAGAGCAGGAGAAGAGTGAGG - Intergenic
1117548933 14:56814685-56814707 TGCAGAGCAAGGTTAGGGTGAGG + Intergenic
1118443671 14:65833454-65833476 AGCAGGTCAGGGACAGGGAGGGG - Intergenic
1118701596 14:68439010-68439032 AGTAGAGCAGGGGAAGGGCAGGG - Intronic
1118883730 14:69850013-69850035 AGCAAAGCAGAGAAAGGAGGGGG + Intergenic
1119165215 14:72486814-72486836 AGGAGAGCAAGGAAAGGGTAAGG + Intronic
1119201590 14:72756934-72756956 AGAAGAGAAGAGAAAGGGAGAGG + Intronic
1119372100 14:74155379-74155401 AGCAGAGCAGTGAAATAGAGAGG + Intronic
1119391805 14:74295996-74296018 GGGAGAGAAGGGAGAGGGTGTGG + Intronic
1119694571 14:76702457-76702479 ATCAGGCGAGGGAAAGGGTGAGG + Intergenic
1119941926 14:78650243-78650265 AACAAAACTGGGAAAGGGTGGGG - Intronic
1120479626 14:85033859-85033881 AGCAGTGCAGAGCAAAGGTGGGG - Intergenic
1120550352 14:85863730-85863752 AGCAGGGCTGGGGAAGGGTTTGG + Intergenic
1120645119 14:87064800-87064822 AGCAGAGCTGGGTAAGGAGGTGG + Intergenic
1120721989 14:87899600-87899622 TGCAGAACAGGGAATGGATGAGG - Intronic
1121007298 14:90498708-90498730 AGCTTAGCAGGGTAAGGGGGTGG + Intergenic
1121173849 14:91875753-91875775 TTCAGAGCAGGCAAGGGGTGTGG - Intronic
1121502356 14:94448384-94448406 GGCTGGGCAGGGCAAGGGTGTGG + Exonic
1121677124 14:95762576-95762598 AGCATAGCATGGACAGGGGGAGG + Intergenic
1121680580 14:95789683-95789705 AGCTGGGCTGGGAAAGAGTGGGG + Intergenic
1121720383 14:96104944-96104966 AGCAGCCCAGGGAAAGGCTGTGG - Intergenic
1121776446 14:96593820-96593842 GGCAGAGCAGAGCAGGGGTGAGG + Intergenic
1121832682 14:97065749-97065771 GGCAGAGAAGGAAAAGGGTCAGG + Intergenic
1121917712 14:97851449-97851471 AGGAGAGCAGGGTGGGGGTGGGG - Intergenic
1122050155 14:99053290-99053312 AGCAGAGGAGGGATAGGAAGTGG - Intergenic
1122236439 14:100333087-100333109 AGCAGGGGAGGGCAGGGGTGGGG + Intergenic
1122302078 14:100737018-100737040 AGGACAGGAGGGGAAGGGTGGGG - Exonic
1122471500 14:101970276-101970298 ACCAGAGCAGGGAGTGGTTGTGG + Intronic
1122787688 14:104171521-104171543 AGCAGAGCAGGGAGAAGGTGAGG - Intronic
1202934872 14_KI270725v1_random:78350-78372 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1123422440 15:20143980-20144002 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
1123442565 15:20302362-20302384 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
1123531668 15:21150520-21150542 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
1123541077 15:21292140-21292162 AGAAGAGAAGAGAAAGGGAGGGG + Intergenic
1124119297 15:26875399-26875421 AGCAGAGCAGGGGCAGAGTGGGG + Intronic
1124178406 15:27449106-27449128 AGAAAAGCAGGGCAAGGATGAGG - Intronic
1124369224 15:29093973-29093995 AGCGGAGCAAGGCAAGGGTCTGG - Intronic
1124495527 15:30184414-30184436 TCCAGAGCAGGGACAGGGAGAGG + Intergenic
1124748046 15:32354232-32354254 TCCAGAGCAGGGACAGGGAGAGG - Intergenic
1124839750 15:33230572-33230594 TGCAGTGCAGTGAAGGGGTGGGG - Intergenic
1125410620 15:39402103-39402125 AACAGAGCAGGGAAAGGCCAGGG + Intergenic
1125697580 15:41651897-41651919 AGTGGAGAAGGGAAAGGGAGGGG - Intronic
1125725348 15:41865730-41865752 CTGAGAGCAGGGAAAGAGTGTGG - Intronic
1126088351 15:45029790-45029812 AGCAGAGAAGGGAACTGGAGAGG + Intronic
1126167523 15:45666729-45666751 AGGAGAGGAGGGAAGGGGAGGGG - Intronic
1126356890 15:47805534-47805556 TGCTGATCAAGGAAAGGGTGAGG + Intergenic
1126667022 15:51084657-51084679 AGCAGAGTTGGGAAAAAGTGAGG + Intronic
1126713338 15:51485152-51485174 AGAAGAAAAGGGAAAAGGTGAGG + Intronic
1126777225 15:52110996-52111018 ATCTGAGAAGGGAAAGGGAGTGG - Intronic
1126878759 15:53072112-53072134 ATCAGATCAGGGAAAGCCTGAGG + Intergenic
1126912560 15:53431368-53431390 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1127179000 15:56395114-56395136 AGGGGAGCAGGGTCAGGGTGTGG - Intronic
1127889359 15:63235002-63235024 GGCAGAGCAGGGAAGTGGGGTGG - Intronic
1127988492 15:64093882-64093904 AGGAGAGCAGAGAAAAGGCGGGG + Exonic
1128074334 15:64816826-64816848 AGCAGGGCTGGTAAAGGGTCAGG - Intronic
1128339106 15:66808208-66808230 AGCAGAGCAGGGACAGGGAGGGG - Intergenic
1128636495 15:69305705-69305727 AGCAGAGGAGGGAGAGAGGGTGG + Intronic
1128766807 15:70256153-70256175 AGCAGAGTAGTTAAGGGGTGGGG - Intergenic
1128978174 15:72168148-72168170 AGCAGAGCAGGGAAAGGTCAGGG - Intronic
1129054533 15:72809515-72809537 TGAAGAGAAGGGGAAGGGTGTGG + Intergenic
1129239196 15:74241606-74241628 AGCAGAGGAGAGAGAGGGTCTGG + Intronic
1129669076 15:77597169-77597191 TGCTGAGCAGGGACAGGGTGGGG + Intergenic
1130119681 15:81037023-81037045 AACAGAGAAGGGCAAGGGAGAGG + Intronic
1130230912 15:82096157-82096179 AACAGAGCAGTGAGAGGTTGTGG + Intergenic
1130247600 15:82266378-82266400 AGCAGAGAAGTGATAGGGTTTGG - Intronic
1130736017 15:86549854-86549876 AGGAGGGGAGGGGAAGGGTGGGG + Intronic
1130967050 15:88705411-88705433 GGAAGAGGAGGCAAAGGGTGGGG + Intergenic
1131723435 15:95196645-95196667 GGCAGAGCAGGACAGGGGTGAGG + Intergenic
1131882674 15:96876361-96876383 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1132207939 15:99999344-99999366 AGCAGAACAGGGAGTGGGTGGGG + Intronic
1202949390 15_KI270727v1_random:19281-19303 AGAAGAGAAGAGAAAGGGAGGGG + Intergenic
1132515550 16:364193-364215 GGGAGGGCAGGGAAGGGGTGGGG + Intergenic
1132623357 16:878727-878749 GGCAGGGCAGGGGAAGGGCGGGG + Intronic
1132732827 16:1371280-1371302 TGCAGGGGAGGGAAAGGGAGAGG + Intronic
1132889940 16:2198889-2198911 AGCTGAGCAGAGAACAGGTGAGG - Intergenic
1133010346 16:2907123-2907145 AGCAGACCAGGAAAGGGGGGGGG - Intergenic
1133126057 16:3646755-3646777 AGCAGGGCAGCCAAAGGGAGAGG + Intronic
1133221593 16:4321248-4321270 AACAGAGCTGGACAAGGGTGTGG - Intronic
1133819520 16:9224137-9224159 AGGAGAAAAGGGAAAGGGCGGGG - Intergenic
1134241997 16:12513191-12513213 AGTAGGGCAGGGCAAGGGAGAGG - Intronic
1134332691 16:13265192-13265214 AGAAGTGGAGGGAAAGGGAGGGG - Intergenic
1135224162 16:20641098-20641120 AGCTGAGTAGGGAAAGAGAGAGG + Intronic
1135408656 16:22216761-22216783 ACCAGTGTAGGGATAGGGTGGGG + Intronic
1135758054 16:25114507-25114529 AGCAGAGAAGGGAAGGAGAGTGG - Intronic
1136082104 16:27859034-27859056 CCCAGGGCAGGGAAAGAGTGAGG + Intronic
1136379470 16:29885799-29885821 AGGAAAGCAGGCAAGGGGTGAGG - Intronic
1136842010 16:33547595-33547617 TGCAGAGCCAGGAAAGGGTCAGG + Intergenic
1136862393 16:33711702-33711724 GGCAGAGCAGGGAAAGGCGATGG - Intergenic
1136903475 16:34065027-34065049 TGCAGAGGAGGGGAATGGTGTGG + Intergenic
1137584966 16:49658813-49658835 AGCGATGCTGGGAAAGGGTGGGG - Intronic
1138101329 16:54254440-54254462 GGCAGCGCAGGGATGGGGTGGGG + Intronic
1138233669 16:55360995-55361017 AGCATAGCTGGGAAAATGTGTGG - Intergenic
1138351342 16:56347771-56347793 GGGAGAGGAGGGAAAGGGAGGGG - Exonic
1138481163 16:57304216-57304238 TCCGGAGCAGGGAATGGGTGAGG - Intergenic
1138575903 16:57907204-57907226 AGCAGAGCAGGGCAGGGGTGGGG - Intronic
1138656186 16:58492885-58492907 AGGAGAGGAGGGAAAGGATGGGG - Intronic
1138813460 16:60177747-60177769 AGCAGAGCAGGGGAAAGTTGGGG - Intergenic
1139575805 16:67841522-67841544 AGGAGAGCAGAGAAATGGGGGGG - Intronic
1139649910 16:68357023-68357045 AGAAGAGCAGGAAGATGGTGAGG - Intronic
1139656314 16:68389181-68389203 AGCAGAGCAGGGAGGGCCTGGGG + Intronic
1139675860 16:68523103-68523125 AGGAGGGCAGAGAAAGAGTGAGG - Intergenic
1139690900 16:68641454-68641476 AGCAGAGCAGAGAAAGTGCAGGG - Intronic
1139799544 16:69510603-69510625 AGAGGAACAGGAAAAGGGTGGGG + Intergenic
1139967995 16:70756195-70756217 AGCAGAGCAGAGCTGGGGTGAGG - Intronic
1140043668 16:71425810-71425832 AGGAGGGCAGAGAAGGGGTGTGG - Intergenic
1140281506 16:73559003-73559025 AGCAGAGAAGGGAGAGGAGGAGG - Intergenic
1141056471 16:80819879-80819901 AGTACAGTATGGAAAGGGTGAGG + Intergenic
1141239700 16:82254299-82254321 AGAAGAGCAGGGAAAGGGCAGGG + Intergenic
1141304153 16:82845320-82845342 AGCAGAGATGGGAAAGGAGGGGG - Intronic
1141330838 16:83109171-83109193 AGTAAAGCAGGGAAAAGATGAGG + Intronic
1141865381 16:86746570-86746592 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1141999002 16:87653321-87653343 AGCAGAGCGGGGACAGGCAGGGG - Intronic
1142079653 16:88142289-88142311 AGCAAAGCAGGGCAGGGCTGTGG - Intergenic
1142182298 16:88677166-88677188 AACAGGGCAGGGCAAGGGTCTGG + Intergenic
1142234306 16:88914739-88914761 AGCAAAGCCTGGAAAGGCTGGGG + Intronic
1142263325 16:89052448-89052470 AGCAGCGCAGGTAAAGCGTGCGG - Intergenic
1142302521 16:89266814-89266836 AGCTCAGAAGGAAAAGGGTGAGG + Intergenic
1203123886 16_KI270728v1_random:1559885-1559907 GGCAGAGCAGGGAAAGGCGATGG - Intergenic
1203152175 16_KI270728v1_random:1847892-1847914 TGCAGAGCCAGGAAAGGGTCAGG + Intergenic
1142602229 17:1059266-1059288 AACAGGGCAGGGAAAGGGCTTGG - Intronic
1142850504 17:2702407-2702429 GGGAGAGCAGGGCAAGGCTGTGG - Intronic
1143465119 17:7131367-7131389 AGCAGAGGAGGCAGAGGATGGGG + Intergenic
1143478193 17:7214734-7214756 AGCAGCGCGGGGAAAGGGGGAGG + Intronic
1143711420 17:8738291-8738313 GGCAGAGGTGGGAAAGTGTGGGG + Intronic
1144161933 17:12568476-12568498 AGAAAAGCAGAGAAAGGGAGTGG + Intergenic
1146167371 17:30600578-30600600 AGGAGAGGAGGGAAAGGCCGCGG + Intergenic
1146169400 17:30621376-30621398 AGCAGGCCAGGGAAACAGTGAGG + Intergenic
1146170162 17:30626073-30626095 AGCAGGCCAGGGAAACAGTGAGG - Intergenic
1146343614 17:32042102-32042124 AGCAGGCCAGGGAAACAGTGAGG - Intronic
1147044361 17:37742654-37742676 AGCAGGGCAGGGAGAGGGACTGG - Intronic
1147460625 17:40565812-40565834 AGCAGAGCAAGGGAAGGATGGGG - Intergenic
1147497073 17:40926887-40926909 AGAAGAGGAGGGGAAGGGAGGGG - Intronic
1147740827 17:42670171-42670193 AGCAGGGCAGCGGAAGGGGGCGG + Exonic
1147930426 17:43977169-43977191 AGCGGGGCAGGGAGAGGGAGGGG + Intronic
1148456947 17:47816291-47816313 AGCAGATCTGGGTCAGGGTGGGG - Intronic
1148742483 17:49900730-49900752 GGCAGAGAAGGGGAAGGGAGAGG - Intergenic
1148772408 17:50075105-50075127 GACAGAGCAGGGAAATGGGGTGG + Intronic
1148780763 17:50120304-50120326 AGGAGAGCAGAGGAAGGGAGAGG + Intronic
1148855077 17:50574576-50574598 AGCCCAGGAGGGAAAGGGAGTGG - Intronic
1148870894 17:50658358-50658380 AGCAGAGTAGGGAAATGGAGGGG - Intronic
1148906301 17:50914695-50914717 ACCAGAGCAGGGAGATGGTCGGG - Intergenic
1149582781 17:57762790-57762812 AGCGGAGCAGGGAGCGGGAGTGG + Intergenic
1150120701 17:62599414-62599436 TACAGAGCAGCGAAAGGGCGAGG - Intronic
1150221261 17:63497077-63497099 GGCAGGGCAGGGCAAGGGTGCGG - Intronic
1150470637 17:65434373-65434395 AGCAGCGCTGGCAGAGGGTGTGG + Intergenic
1151393594 17:73804284-73804306 CACAGAGCAGGGGAAAGGTGGGG + Intergenic
1151453805 17:74214527-74214549 AGCAGAGTAGGGAAAGGGCGGGG - Intronic
1151593312 17:75061267-75061289 AGCAGCTCAGGCAGAGGGTGAGG - Intronic
1151870666 17:76834320-76834342 AGCAGAGGAGGGAATGGCAGGGG + Intergenic
1151890361 17:76947799-76947821 AGGAGAGCAGTGTCAGGGTGGGG - Intronic
1152103837 17:78317736-78317758 AACAGGGAAGGGCAAGGGTGGGG + Intergenic
1152142808 17:78548123-78548145 AGCAGAGAAGGGAAAGGACATGG - Intronic
1152250175 17:79208375-79208397 AGCAGTCCGGGGAAGGGGTGGGG + Intronic
1152328579 17:79657163-79657185 AGGAGAGAAGGGAGAGGATGGGG + Intergenic
1152558723 17:81067366-81067388 ACCTGAGCAGGGGAAGGGGGCGG + Intronic
1152640199 17:81446047-81446069 AGCAAAGCTGGGAGAGGGAGGGG + Intronic
1152743263 17:82027842-82027864 AGCAGAGGTGGGAAATGGTGAGG + Intronic
1152880148 17:82809790-82809812 AGAAGAGCAGGGGAGGCGTGTGG + Intronic
1152983413 18:300384-300406 AGCACAGCATGGAAAGGAAGAGG - Intergenic
1153365325 18:4249090-4249112 AATAGAGCAGGGAAAGGGAGGGG - Intronic
1153581947 18:6582411-6582433 CTCAGAGCCGGGAAAGAGTGGGG + Intronic
1153777500 18:8466730-8466752 AGCAGTGCAAGGGAAGGATGGGG + Intergenic
1153922571 18:9804546-9804568 AGGACAGAAGGGAAAGGGAGTGG - Intronic
1154032747 18:10767679-10767701 AGCAGAGCAGGGCCTGTGTGAGG + Intronic
1154176089 18:12087884-12087906 GCCAGAGCAGGGTAAGGGTCAGG - Intergenic
1154176134 18:12088029-12088051 AGCAGTGCAAGGCCAGGGTGGGG - Intergenic
1154176368 18:12088877-12088899 AGCAGAGCAGGGCCAGGGCCAGG - Intergenic
1154261531 18:12838357-12838379 TGCATAGCTGGGCAAGGGTGTGG - Intronic
1155047913 18:22119372-22119394 ACCAGAGGCTGGAAAGGGTGAGG - Intergenic
1155172243 18:23275530-23275552 GGCAGAGCAGGTAAATGGAGCGG + Intronic
1155464466 18:26120136-26120158 AACAGAGCCGGGACTGGGTGGGG + Intergenic
1155468155 18:26162305-26162327 GGCAGAGGAGGGAAAGGGGATGG - Intronic
1155478746 18:26262348-26262370 AGCTGAGAAGGGAAAGAGAGGGG + Intronic
1155486696 18:26351350-26351372 AGTAGAGGATGGAAAGGGTCTGG + Intronic
1155500137 18:26479524-26479546 AGCAGAGCAGGCAAGGGGTGTGG + Intronic
1156043739 18:32854587-32854609 AGGAGAACTGGGAAAGGGTAGGG + Intergenic
1156674536 18:39511897-39511919 AGAAGAATAGGGAAAGGGAGAGG + Intergenic
1157224973 18:45854423-45854445 TGCAGAGCAGGGAATGGGAGAGG + Intronic
1157589531 18:48828030-48828052 AGCAGAACAGTCAAAGGGTGGGG - Intronic
1157665515 18:49483538-49483560 ATAAGAGCAGTGAAAGGGGGTGG - Intronic
1158058687 18:53312900-53312922 AGGAGGGAAGGGAAAGGGAGGGG + Intronic
1159381458 18:67665374-67665396 AGCAGAGGAGTGACAGGGTCTGG - Intergenic
1159551716 18:69902338-69902360 AGCACACATGGGAAAGGGTGAGG - Intronic
1159878938 18:73839762-73839784 ACCAGGGCAAGGAAAGGGTGGGG - Intergenic
1159985021 18:74831741-74831763 TGCACAGCAGGGCAGGGGTGAGG - Intronic
1160019041 18:75166206-75166228 AAGAAAGCAGGGAGAGGGTGTGG + Intergenic
1160024399 18:75206627-75206649 AACAGAGTAGGGAAAGCGGGAGG + Intronic
1160073381 18:75648387-75648409 CACAGAGCAGGGAAAGCATGTGG - Intergenic
1160103374 18:75945434-75945456 AGATCAACAGGGAAAGGGTGGGG + Intergenic
1160192904 18:76729760-76729782 AGGAGAGGAGGGAGAGGGTGGGG - Intergenic
1160353294 18:78204038-78204060 AACAGAGCAGGGGAAGGATGGGG + Intergenic
1160559831 18:79749323-79749345 AGCAGAGCAGGGGCAGGGGCAGG - Intronic
1160593017 18:79954516-79954538 AGCAGAGCCTGGAAAGCATGAGG - Intergenic
1160952290 19:1673586-1673608 ACCACAGCAGGAAGAGGGTGCGG - Intergenic
1160990344 19:1857791-1857813 AGGAGAGCCAGGAAAGGCTGGGG + Intronic
1161061424 19:2217074-2217096 AGAAGAGCAGTGAGAAGGTGCGG + Exonic
1161423068 19:4186369-4186391 ACCTGAGGAGGGCAAGGGTGGGG - Exonic
1161766458 19:6211478-6211500 ATCAGAGCAGGGACAAGATGAGG + Intergenic
1162023267 19:7878729-7878751 TCTAGAGCAGGGAAGGGGTGGGG - Intergenic
1162931099 19:13958231-13958253 ACCAGCCCAGGGAAAGGGCGTGG + Intronic
1163427328 19:17246524-17246546 ACCCGAGCAGAGAAAGGGTGGGG - Intronic
1165031139 19:32998954-32998976 AGGAGAGGAGGGGAAGGGAGGGG + Intronic
1165497166 19:36159933-36159955 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1165794346 19:38510397-38510419 AGCAGAGTTGGGAAATGATGGGG - Intronic
1166197590 19:41217267-41217289 GGCAGAGGTGGGAAAGGGTTTGG + Intergenic
1166327534 19:42060323-42060345 AGCAGACCAGGTACAGGATGAGG + Intronic
1166373988 19:42316781-42316803 AGCAGGGCAGGGGCAGGGTTGGG + Intronic
1166662516 19:44656671-44656693 AGCAGAGAAGGGAATGGGACTGG + Intronic
1167098741 19:47390870-47390892 AGCAGAGAAGGGACAGAGTCGGG - Intergenic
1167253927 19:48415892-48415914 AGCAGACCAGTGACAGGGTGAGG - Intronic
1167550778 19:50159320-50159342 AGGAGAGCAGGTAAGGGGTGAGG + Intronic
1167678291 19:50902967-50902989 AGAAGAGAAGGGAAGGGGAGGGG - Intergenic
1167698923 19:51030903-51030925 AGCAGATCCGGGAATGGGTCTGG + Exonic
1167720411 19:51176003-51176025 AGCAGACCAGAGCAGGGGTGGGG - Intergenic
1167723973 19:51198799-51198821 AGCAGAGAAGGGGAATGGAGTGG - Intergenic
1167725611 19:51211052-51211074 AGCAGAGAAGAGGAAGGGAGTGG - Intergenic
1167762196 19:51456992-51457014 AGGGGAGCAGGGACAGGATGGGG + Intronic
1167768643 19:51500408-51500430 AGCAGAGAAGGGGGAGGGAGAGG + Intronic
1167772871 19:51531650-51531672 AGCAGAGAAGGGGAAGGGAGTGG + Exonic
1168136620 19:54356217-54356239 AGGACAGCAGGTAAAGGGGGAGG - Exonic
1168320516 19:55506831-55506853 AGCAAAGCAGGGGAAGGGGCAGG + Intronic
1202692257 1_KI270712v1_random:100731-100753 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
925023913 2:593356-593378 AGCAGAGCGGGCAGAAGGTGCGG + Intergenic
925052878 2:830986-831008 AGCACAGCAGGGAAAGGAAAGGG - Intergenic
925095856 2:1201379-1201401 ATCAGAGGCTGGAAAGGGTGTGG + Intronic
925225831 2:2183371-2183393 AGGGGAGGAGAGAAAGGGTGGGG + Intronic
925450864 2:3968305-3968327 AGGAGAGGAGGGAAGGGGAGGGG + Intergenic
925642980 2:6005158-6005180 AGCAGAGGAGGGAGAGGTTGGGG + Intergenic
925730695 2:6917849-6917871 AGCAGAGCAGGGACGAGGTCAGG - Intronic
925872268 2:8281704-8281726 AGTACAGCAAGCAAAGGGTGAGG - Intergenic
926292028 2:11538966-11538988 AGGAGAGGAGGGGAAGGGAGGGG - Intronic
926341824 2:11910192-11910214 AGCTGAGCAGGGGGAGGGTGGGG + Intergenic
926754503 2:16224475-16224497 CGCACAGCAGGGAGAGGCTGTGG + Intergenic
926980995 2:18568064-18568086 AGCAGAGCATTGAAATGCTGTGG + Intronic
927045628 2:19275380-19275402 AGCAGAGCTGGGGAAAGGTCTGG - Intergenic
927223305 2:20736011-20736033 CGTAGAGCAGGGAAAGAGAGGGG + Intronic
927254171 2:21025439-21025461 GGCTAAGCAGGGAACGGGTGGGG - Intronic
927843911 2:26461672-26461694 TGCAGAGCAGGGCAGGGATGGGG - Intronic
927932462 2:27053867-27053889 AGCAGAGGAGGAAGAGGGAGGGG - Intronic
928127544 2:28626833-28626855 AACAGGGCAGGGATGGGGTGAGG - Intronic
928352333 2:30570824-30570846 AGCAGAGCAGGAAGAGGCTAAGG + Intronic
928425805 2:31176896-31176918 AGCAGACCAGGGAAGCTGTGGGG - Intronic
928687437 2:33763268-33763290 AAGAGAGGAGGGAAAGGGAGGGG + Intergenic
928851467 2:35752668-35752690 ACCAGAGGATGGGAAGGGTGTGG - Intergenic
929069723 2:38017850-38017872 AGCAAAGGAAGGTAAGGGTGGGG + Intronic
929171265 2:38935162-38935184 AGCAGAGAAGTGATAGGGTCTGG + Intronic
929425295 2:41838906-41838928 AGAAGAGAAGGAAATGGGTGGGG + Intergenic
929948819 2:46390474-46390496 AGGAAAGCAGGGAAATGGAGTGG + Intergenic
930019832 2:46994867-46994889 AGCACTGCAGGGAATGGCTGGGG - Intronic
930512152 2:52358886-52358908 AGCAGAGCTGCCAAAGGCTGTGG + Intergenic
930878665 2:56248001-56248023 AGCAGAGCAGGTAAAGCATGGGG - Intronic
930982780 2:57547777-57547799 GGCAGCGAAGGGAAAGGGAGAGG + Intergenic
931026554 2:58117940-58117962 AGAAAAGCAGAGAAAGGGTTGGG + Intronic
931549785 2:63430217-63430239 AGTAGAGCAGGGAGAGAGGGAGG + Intronic
931709616 2:64977225-64977247 AGGAGAGGAGGGGAAGGGAGGGG - Intergenic
932178678 2:69625895-69625917 AGAAGAGTAGGGAAAGGATATGG - Intronic
932378170 2:71256601-71256623 AGGAGAGGAGGGAAAAGGGGTGG + Intergenic
932580973 2:72992550-72992572 AGCAGAGCTGGAAATGGGCGAGG - Intronic
932833260 2:75010850-75010872 AGCAGAGGAGGGAACTGGGGAGG + Intergenic
932854371 2:75218332-75218354 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
933329678 2:80878995-80879017 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
933954141 2:87353241-87353263 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
934238336 2:90249461-90249483 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
934274853 2:91567249-91567271 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
934306368 2:91825932-91825954 ATCTGAGCAGGGGAAGGATGTGG - Intergenic
934322449 2:91981986-91982008 TGCAGAGCCAGGAAAGGGTCAGG - Intergenic
934326888 2:92026810-92026832 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
934460761 2:94212821-94212843 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
934465266 2:94257365-94257387 ATCTGAGCAGGGGAAGGTTGTGG + Intergenic
934603228 2:95674436-95674458 AGCAAAGCATGGGAAGGGCGGGG + Intergenic
934651339 2:96092781-96092803 AGGAGAGGAGGGAAAGGCTAAGG + Intergenic
935259403 2:101342020-101342042 TCGAGAGCAGGGAGAGGGTGGGG + Intergenic
935358765 2:102229564-102229586 AGCAAAGCCGGGAAATGTTGAGG + Intronic
935913848 2:107927307-107927329 GGCAGAGCAGGGACAGTGAGAGG + Intergenic
936016850 2:108965853-108965875 AGCACAGAAGGGAAAGGTGGAGG - Intronic
936402143 2:112173121-112173143 GGCAGAGCTGAGAAAGTGTGAGG + Intronic
936517858 2:113193393-113193415 AGCAAAGCAGGGAAACTTTGGGG + Intronic
936582634 2:113716738-113716760 AGCAGGGCAGGGAAGGGCAGGGG + Intronic
936871120 2:117134953-117134975 AGCAGAGGAAGGTAAGGGTAGGG - Intergenic
936883182 2:117279922-117279944 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
937231418 2:120400186-120400208 GGGAGAGCAGGGAGAGGGAGAGG + Intergenic
937246683 2:120498553-120498575 AGCAGGGGAGGGAAAGGGTGAGG + Intergenic
937271687 2:120656903-120656925 AGCAGAGAAGGGAGAGGGAGAGG - Intergenic
937324529 2:120982622-120982644 AGCAGAGCAGAGAAGGGGGTGGG + Intronic
937457450 2:122054828-122054850 TGCAGATCAGGCAAAGGCTGTGG - Intergenic
937730137 2:125220740-125220762 AGAAGAGAAGGGGAAAGGTGAGG - Intergenic
938084725 2:128391350-128391372 AGCAGGGAAGGGAACGTGTGAGG + Intergenic
938104353 2:128520028-128520050 AGCAGAGCAGGGCATGGTGGGGG + Intergenic
938817602 2:134919404-134919426 ACGAGAGCCGGGAAAGGCTGCGG - Intronic
939720673 2:145646541-145646563 AGAAGAATAGAGAAAGGGTGAGG - Intergenic
940274566 2:151925682-151925704 AGAGGAGCAGGGAGGGGGTGGGG + Intronic
941116850 2:161481529-161481551 AGAAGAGAAGGGAAAAGGTGAGG + Intronic
941143030 2:161808563-161808585 ACCAGAGCAGGGAAGGAGGGTGG - Intronic
941163785 2:162063783-162063805 AAGAGAGCAGAGAAAGGGAGTGG + Intronic
941186740 2:162327656-162327678 AGCTGAGAGGGGAAAGGGTAAGG + Intronic
941231045 2:162913063-162913085 AAGAGAGCAGAGAAAGGCTGAGG + Intergenic
941340244 2:164297032-164297054 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
942169521 2:173276277-173276299 AGGAGAGGAGGGAAGGGGAGAGG - Intergenic
942593816 2:177573478-177573500 CACAGAGGTGGGAAAGGGTGGGG - Intergenic
942787853 2:179720518-179720540 AGGAGAGGAGGGAATGGGAGGGG + Intronic
944597208 2:201271873-201271895 GGCAGAGCTGGGAAAGACTGCGG + Intronic
944852376 2:203733118-203733140 ATCACAGCAGGGCAGGGGTGAGG - Intronic
944860336 2:203810176-203810198 GGCAGAGGAGGGGAGGGGTGAGG + Intergenic
945394143 2:209300404-209300426 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
945435950 2:209817714-209817736 AGGACAGCAGGGAGAGTGTGGGG - Intronic
946035258 2:216736858-216736880 AGGAAAGGAGGGAAGGGGTGGGG - Intergenic
946074777 2:217064703-217064725 AGCAGAGAAAGACAAGGGTGAGG - Intergenic
946169826 2:217888276-217888298 AGGAGGGCAGGGAAAGAGAGAGG - Intronic
946215194 2:218178554-218178576 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
946399577 2:219461327-219461349 AGCTGAGAAGGGAAAGGGGGAGG + Intronic
947524629 2:230870636-230870658 GACAGAGCAGGGAGAAGGTGAGG - Intronic
947870005 2:233429784-233429806 AGCAGAGCTGGGAGAGAGTGAGG - Intronic
948046386 2:234948820-234948842 AGATGAGCAGGGAAAGATTGGGG - Intergenic
948402996 2:237697716-237697738 AGCAGAGCAGGCAAAGGTGAAGG + Intronic
948842120 2:240656780-240656802 AGCAGAGGGGGGTAAGGGGGAGG + Intergenic
1169247562 20:4035505-4035527 AGGAGAGCAGCGCAAGGTTGTGG + Intergenic
1170543077 20:17408287-17408309 AGCAGAGAAGGGAATGGGGAAGG + Intronic
1170820868 20:19755658-19755680 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1170948106 20:20909998-20910020 AGCAGGGAAGGGAAAGGGGGAGG + Intergenic
1171255753 20:23688122-23688144 AGCAGAGCAGAGGAGGGGTTAGG - Intronic
1171263094 20:23750045-23750067 AGCAGAGCAGAGGAGGGGTCAGG - Intronic
1172048547 20:32098965-32098987 AGCAGAGTCGGGGAAGGCTGGGG - Intronic
1172306116 20:33882103-33882125 ATCAGAGCAGGGTGAGGGTGGGG - Intergenic
1172329721 20:34066902-34066924 AGTAGAAAAGGGAAAGGGTGAGG + Intronic
1172842723 20:37911718-37911740 AGCAAGGCAGGCACAGGGTGGGG - Intronic
1172978818 20:38926171-38926193 CGCAGAGCAGGGACAGAGCGGGG - Intergenic
1173101695 20:40094204-40094226 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1173118712 20:40270238-40270260 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1173384088 20:42572409-42572431 AGCAGAGAAGGTAAGGGGTGAGG - Intronic
1173427371 20:42954873-42954895 AGGAGAGAAGGGAAAGGAGGAGG + Intronic
1173427836 20:42958274-42958296 AGGAGAGGAGGGAAGGGGAGAGG + Intronic
1173441076 20:43076840-43076862 AGGAGGGGAGGGAAAGGGAGAGG - Intronic
1173579380 20:44136368-44136390 AGCAGAATAGGCAAAGGGTGAGG - Intronic
1173586518 20:44187045-44187067 AGAAGCCCAGTGAAAGGGTGGGG + Exonic
1173645392 20:44629942-44629964 AGCAGAGCCGGGATGGGATGAGG - Intronic
1173902203 20:46599061-46599083 ATCAAAGCAGGAAAAGGGTGGGG - Intronic
1174147001 20:48459077-48459099 AGCACAGCAGGGGAAGGGCCAGG + Intergenic
1174645450 20:52081392-52081414 CCCAGAGCTGGGATAGGGTGAGG - Intronic
1174736660 20:52972076-52972098 AGGTGAGGAGGGAAGGGGTGCGG - Intergenic
1175224824 20:57439104-57439126 AGGAGAGCAGGGCAGGGGGGCGG - Intergenic
1175257256 20:57654950-57654972 AGCAGAGGAGTGGCAGGGTGTGG - Intronic
1175490978 20:59381142-59381164 AGCAGAGAAGGGTGAAGGTGAGG - Intergenic
1175766157 20:61594236-61594258 AGCTGAGCAGGGGAAGAGGGTGG + Intronic
1175959546 20:62628538-62628560 AACAGAGCAAGGAAGGGCTGAGG - Intergenic
1176221479 20:63971069-63971091 AGGAGAGGAGGGGAAGGGAGGGG - Intronic
1176596289 21:8700572-8700594 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1176866575 21:14057729-14057751 AGCAGTGCAAGGACAGGGTAGGG + Intergenic
1177279063 21:18954810-18954832 AGTAGAGCAGGGAAACTTTGAGG + Intergenic
1177711808 21:24785431-24785453 AGTAGAGCAGCAAAAGGGTGAGG + Intergenic
1177794679 21:25761463-25761485 CGCAGAGCTGGAAAAGGTTGGGG - Intronic
1178684034 21:34697418-34697440 AGAAGAGAAGGGAAGGGGAGGGG - Intronic
1179044545 21:37832676-37832698 AGCTGAGCAGGTTAAGGGTGAGG - Intronic
1179769807 21:43606131-43606153 AGCAGAGCAGGGAGGCCGTGAGG + Intronic
1179831863 21:44001845-44001867 AGAACAGCAAGGAAAAGGTGGGG + Intergenic
1179914753 21:44469075-44469097 AGAAGAGAAGGGAAGGGGAGGGG + Intergenic
1180279200 22:10678021-10678043 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1180586415 22:16896556-16896578 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1180982740 22:19886534-19886556 GGCATAGGAGGGAAATGGTGGGG - Intronic
1181355490 22:22293946-22293968 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
1181512273 22:23394322-23394344 AGCAGAGCAGGTCCAGGGTGGGG + Intergenic
1181669824 22:24420846-24420868 AGCCCAGTAGGGGAAGGGTGGGG + Intronic
1181890667 22:26060421-26060443 AACAGAGCAGGGAAAAGGTCAGG - Intergenic
1181951748 22:26558715-26558737 GGCAGGGCAGGAACAGGGTGAGG + Intronic
1183017699 22:35003175-35003197 AGCAGAGGAGGGTGAGGGTTTGG + Intergenic
1183208147 22:36433403-36433425 AGCAGAGCTGGGGAAGGGACGGG - Intergenic
1183263988 22:36814587-36814609 AGCAGAGAAGGAGAAGGCTGTGG - Intronic
1183339784 22:37273863-37273885 AGGAGAGCAGGGCACGGGAGAGG - Intergenic
1183353592 22:37346877-37346899 AGCAGTGCAGAGACAGGGCGTGG + Intergenic
1183579419 22:38714819-38714841 AGGACAGCTGGGAAAGGCTGAGG + Intronic
1183625554 22:38999345-38999367 AGAAGAGGAGGGAAGGGGAGGGG - Intergenic
1183743765 22:39681889-39681911 AGGAGAGCAGTGTAGGGGTGCGG - Intronic
1183796037 22:40118916-40118938 ACCAGAGGAGGGAAAGGCAGAGG + Intronic
1184224319 22:43120505-43120527 AACAGAGCAGTGACAGGGTCAGG + Intronic
1184375926 22:44112514-44112536 AGCAGAGACAGAAAAGGGTGAGG - Intronic
1184608555 22:45588119-45588141 TGCAGAGCAGGGGAGGGGAGTGG + Intronic
1184839312 22:47043302-47043324 GACAGAGCAGGCGAAGGGTGTGG + Intronic
1184903318 22:47461496-47461518 TGCAGTGCAGGGGAAGGGCGTGG + Exonic
1185098705 22:48826126-48826148 ACCAGAGCCGGGAGAGGCTGGGG - Intronic
1185208420 22:49553325-49553347 AGCCCAGCAGGGTGAGGGTGGGG + Intronic
949741415 3:7238806-7238828 AGGAGAGGAGGGAAAAGGAGAGG - Intronic
949820694 3:8112502-8112524 AGCAGAGCAGTGGGAGGCTGGGG + Intergenic
949855611 3:8458357-8458379 GGCAGAGCAGGCACAGGGTGAGG + Intergenic
949923551 3:9023041-9023063 ACCAGAGTAGGGAAAGGGTGGGG + Intronic
949935096 3:9110276-9110298 AGAGGAGCAGGTCAAGGGTGGGG + Intronic
950142113 3:10622578-10622600 AGCAGAGCAGGCAGTGGATGCGG + Intronic
950298070 3:11849028-11849050 AGGAGACCAGGGCAAGGGAGCGG + Intergenic
950318353 3:12025780-12025802 AGCAGAGAAGGCACAGGGTAGGG - Intronic
950445802 3:13037079-13037101 AGGAGAGCATGTAAATGGTGTGG - Intronic
950453709 3:13080148-13080170 AGTAGAGGAGGGACATGGTGAGG + Intergenic
950480854 3:13242864-13242886 AGGAGAGGAGGGGGAGGGTGAGG + Intergenic
950523019 3:13507594-13507616 ATAAGAGCAGGGACAGGCTGAGG + Intergenic
950540316 3:13608546-13608568 AGCAAAGCAGAGAAAGGAAGAGG - Intronic
950863906 3:16173988-16174010 AGCAGAGCAGGGATGGGGCTGGG - Intergenic
951365964 3:21783019-21783041 AGAATAGCAGGGTAAGGGTCAGG - Intronic
951380483 3:21977936-21977958 AGCAGAGGAGAGAATTGGTGGGG - Intronic
951590726 3:24261559-24261581 AGGGGAGCAGGGAAATGGAGTGG - Intronic
952471199 3:33653702-33653724 AGCAGGGCTGGGAAAAGATGGGG + Intronic
952734221 3:36672942-36672964 AGCAGAGTAGGAGGAGGGTGAGG + Intergenic
952885541 3:38009236-38009258 AACAGAGCAGGGGAGTGGTGGGG + Intronic
953149252 3:40309585-40309607 AGCAGAGCCCGGAAAGCCTGAGG - Intergenic
953335215 3:42088784-42088806 AGAAGAACAGGGAGAGTGTGGGG - Intronic
953466777 3:43128771-43128793 AGCAATGCAAGGGAAGGGTGTGG - Intergenic
953540897 3:43817215-43817237 GACAGAGCAGGGCCAGGGTGGGG + Intergenic
953544435 3:43853965-43853987 AGCTGGCCAGGGAAAGGGTGAGG - Intergenic
953548603 3:43883420-43883442 AGGAACACAGGGAAAGGGTGGGG - Intergenic
953589514 3:44237913-44237935 AGCAGGGCAGAAAAAGGGTATGG + Intergenic
954152731 3:48665712-48665734 AGAAGACCAGGGTAAGGGTGTGG + Intergenic
954443957 3:50536621-50536643 GGCTGAGCAGGGAGTGGGTGGGG - Intergenic
954448150 3:50557622-50557644 AGGGGTGCAGGGGAAGGGTGGGG - Intergenic
954593086 3:51800925-51800947 GGCAGAGCAGAGTAAGGGAGGGG + Intergenic
954672698 3:52299195-52299217 GGGAGAGCAGGGACAGGGTGAGG + Intergenic
954675864 3:52315142-52315164 GTCAGAGAAGGGAATGGGTGAGG - Intergenic
954969428 3:54639026-54639048 AGAAAAGCAGAGAAAGGGTTGGG + Intronic
955400946 3:58591207-58591229 TGTAGAGAAGGGAAAGGGGGTGG + Intronic
955541961 3:59985973-59985995 AGGAGAGCAGAGAAAGGATGGGG + Intronic
955672609 3:61417824-61417846 ACTAAAGAAGGGAAAGGGTGGGG - Intergenic
955757322 3:62238639-62238661 AACAGAGCAGGTGCAGGGTGGGG - Intronic
956727997 3:72172354-72172376 AGCAGAGCAGCTAAAGGGCAAGG - Intergenic
956748072 3:72325149-72325171 AGCAGTGAAGGGACAGGGGGAGG + Intergenic
956970487 3:74517649-74517671 AGCAGTTCAGGAAAAGGGAGAGG - Intronic
959057320 3:101581098-101581120 AACAGAGCAGAGTGAGGGTGGGG - Intronic
959132683 3:102377181-102377203 GGAAGGGCAGGGAAAGGGGGAGG + Intronic
959783008 3:110258892-110258914 ACCAGAGAATGGAAAGAGTGTGG - Intergenic
960172178 3:114474662-114474684 AGCAAAGCAGGAGAAGGGTTGGG - Intronic
960263449 3:115593834-115593856 GGCAGAGAAGGGAAAAGGTCTGG - Intergenic
960670119 3:120147582-120147604 GGAAGAGCAGGAATAGGGTGGGG + Intergenic
960869336 3:122233250-122233272 AGCAGAGAAGGAGAACGGTGGGG - Intronic
960874531 3:122283913-122283935 AGCAGAGCAGGGAGAAGAGGAGG - Exonic
961314655 3:126026288-126026310 AGAGGAGCAGGGAGCGGGTGGGG + Intronic
961332931 3:126153655-126153677 AGCAGGGCTGGGAGAGGGAGAGG + Intronic
961476674 3:127151048-127151070 GGCAGAGCAGGGGCAGGGTGAGG + Intergenic
961505119 3:127365539-127365561 AGCAGGGCTGGGTCAGGGTGGGG - Intergenic
962275913 3:134013416-134013438 AGCAGTGGAAGGGAAGGGTGGGG - Intronic
962600026 3:136984645-136984667 AGCAGAGGAGGGAAGGGATGGGG + Intronic
962754782 3:138459014-138459036 AGCAGAGCTGAGAAAGGCTGAGG + Intronic
962877688 3:139548325-139548347 AGGGGAGATGGGAAAGGGTGAGG + Intergenic
963011028 3:140770611-140770633 AGCAGAGTAGGGCATGGGTTTGG - Intergenic
963076082 3:141347533-141347555 AGCAGAGTAGGTGAAGGGTGAGG - Intronic
963090240 3:141477113-141477135 AGCAGATAGGGGAAAGGCTGAGG + Intergenic
963685967 3:148434401-148434423 AAGAGATCAGGGAAAGGGGGAGG - Intergenic
964135847 3:153344264-153344286 AGCAGAGTAGGGGAAGCTTGGGG - Intergenic
964335109 3:155646440-155646462 GGCAGTGCTGAGAAAGGGTGGGG - Intronic
964348097 3:155775197-155775219 AGCAGTGAAGGGGCAGGGTGTGG + Intronic
964775679 3:160274086-160274108 AGGATAGCAGGGAAAGTTTGAGG + Intronic
965449401 3:168818981-168819003 AGAAGAGAAGGGGAAAGGTGTGG + Intergenic
966869078 3:184278315-184278337 TGATGAGCTGGGAAAGGGTGGGG + Intronic
966885862 3:184377900-184377922 GGCAGAGCAGGGGTAGGGGGTGG - Intronic
966972996 3:185062225-185062247 AGGAGAGAGGGGAAAGGATGGGG - Intergenic
967176686 3:186867008-186867030 AGGAGAGCAGCGCAAGGTTGTGG + Intergenic
968084994 3:195870228-195870250 AAGAGAGCAGGGGAAGCGTGTGG + Intronic
968266585 3:197367694-197367716 AGCGGAGCAGGGCAAGAGAGAGG + Intergenic
968541149 4:1169081-1169103 AGTATTGCAGGGGAAGGGTGGGG - Intronic
968644194 4:1730788-1730810 AGCAGTGCAGGGAAAGGCGATGG + Intronic
968645820 4:1740054-1740076 TGCAGGGCAGGGCCAGGGTGGGG - Intronic
968658162 4:1787462-1787484 AGCTGAGCTTGGGAAGGGTGGGG - Intergenic
969305604 4:6324706-6324728 GGGAGAGCAGAGAAATGGTGTGG - Intronic
969342195 4:6549271-6549293 AGCAGAGAGTGGGAAGGGTGGGG - Intronic
969365926 4:6694265-6694287 ATCTGAGCAGGGAGAGGGTGTGG + Intronic
969389627 4:6881686-6881708 ATGAGAGCAGGTAAGGGGTGGGG - Exonic
969877933 4:10149725-10149747 AGGAGAGCATGGCCAGGGTGGGG + Intergenic
970163222 4:13209903-13209925 ACCTGAGCAGGGAAAGGAGGGGG + Intergenic
971200872 4:24508123-24508145 AGCAGAGCTGGGAATGAGTTGGG - Intergenic
972165409 4:36277680-36277702 AGCAGAGCAGAGAACTGGAGGGG - Intergenic
972381000 4:38520384-38520406 AGTACAGTAGGGAAAGGGTCAGG + Intergenic
972771589 4:42202454-42202476 AGAAGAGCAGAGCAAGGGAGGGG + Intergenic
972771592 4:42202459-42202481 AGCAGAGCAAGGGAGGGGAGGGG + Intergenic
973636250 4:52863679-52863701 AGCAGAGAAGGAGAGGGGTGGGG - Intronic
973757551 4:54090773-54090795 AGTGGTGCAGTGAAAGGGTGAGG + Intronic
974179609 4:58366849-58366871 AGCATTGCAGGCAAAGGGAGTGG + Intergenic
974417470 4:61628306-61628328 GGCAGTGCAGGGTAAGAGTGAGG - Intronic
974473892 4:62355180-62355202 AGGAGAGGAGGGGAAGGGAGAGG - Intergenic
975095379 4:70450838-70450860 AGGAGAGAAAGGGAAGGGTGGGG - Intronic
978264762 4:106810372-106810394 AGAGGAGGAGGGAAAGGGAGAGG - Intergenic
978291769 4:107150510-107150532 AGAAGAGAAGGGAAGGGGAGAGG + Intronic
978323286 4:107522044-107522066 AGCAGAGCAGGGAGAAGAGGAGG + Intergenic
979160576 4:117455540-117455562 AGGAGGACAGGGTAAGGGTGAGG - Intergenic
979392361 4:120141875-120141897 AACAGAGGATGGAAAGGATGCGG + Intergenic
979679833 4:123447348-123447370 GGAAGAGGAGGGAAAGGGAGGGG - Intergenic
979908026 4:126321992-126322014 AGCTGAGTAGGAAAATGGTGAGG - Intergenic
980422224 4:132578131-132578153 ACCAGAGCAGGAAAAGAGTCGGG - Intergenic
980611935 4:135171826-135171848 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
980664799 4:135917564-135917586 AGTAGAACAGAGGAAGGGTGTGG + Intergenic
981086643 4:140690279-140690301 AGCAGAGGAGGCAACAGGTGGGG - Intronic
981253224 4:142628608-142628630 ATCATGGCAGGGAAATGGTGCGG - Intronic
981265251 4:142775518-142775540 AGGAGAGTAGGGGAGGGGTGGGG - Intronic
981280667 4:142954637-142954659 AGGAGTGCAGGCACAGGGTGCGG + Intergenic
981578613 4:146230144-146230166 AGCAGGGAAGGGAAATGGAGAGG + Intergenic
981670907 4:147286074-147286096 AGCAGGGAAGGGGAAGAGTGGGG + Intergenic
981700829 4:147605639-147605661 AGCACAGCAGAGAAGGGGAGAGG - Intergenic
981816737 4:148839658-148839680 AGCAGAGGAGGGAGAGGGTTGGG + Intergenic
982088708 4:151862036-151862058 AGCAGAGAACTCAAAGGGTGAGG + Intergenic
982123457 4:152163647-152163669 AGCAGAGAAGGGAGAGGGTCGGG - Intergenic
982180640 4:152745883-152745905 AGAAAAGCAGAGAAAGGGTTGGG + Intronic
982291711 4:153788867-153788889 AGCGGAGCCGGGGAAGGGCGAGG + Exonic
982319746 4:154065850-154065872 AGAAGAGAAGGGAAAAGGTGAGG - Intergenic
982331461 4:154186216-154186238 AGCAGTGCGGTGACAGGGTGGGG - Intergenic
982355212 4:154459545-154459567 GGCAGAGCAGGGCAAGGGAAGGG - Intronic
982481020 4:155909944-155909966 AGCAGAGAAGAGAAAGGGGGGGG - Intronic
983210918 4:164956909-164956931 GGCAGAGCAGTGATTGGGTGCGG + Intronic
984211994 4:176861239-176861261 AACAGGGCATGGAAAGGGTATGG + Intergenic
984262006 4:177453474-177453496 AGGAGAGCAGAGGAAGGGAGGGG - Intergenic
984393776 4:179169424-179169446 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
984583673 4:181538517-181538539 AGCAGAGTAGGGGTGGGGTGGGG + Intergenic
984648861 4:182247886-182247908 AGCTTTGCAGGGAAAGGGTGAGG - Intronic
984700499 4:182815683-182815705 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
985167309 4:187110601-187110623 ACCAGAGACTGGAAAGGGTGTGG - Intergenic
985202259 4:187495556-187495578 AGCAGATCAGGCAGAGGGTGAGG + Intergenic
985677037 5:1237533-1237555 ACCAAAGCAGGGAAAGGATATGG + Intronic
986268432 5:6210720-6210742 AGAAGAGAATGCAAAGGGTGTGG + Intergenic
986374713 5:7118449-7118471 GGCAGAGTAGGGGAATGGTGGGG - Intergenic
986417494 5:7544087-7544109 AGTGGGGCAGGGAAAGGATGGGG - Intronic
987057073 5:14203803-14203825 AGCAGACCAGGGAAAGGGGTGGG + Intronic
987683903 5:21171814-21171836 AGGAGGGCAGGGAAAGGGAGGGG + Intergenic
987986356 5:25152321-25152343 AGCAGAAGAGGGAAAGTGTGTGG + Intergenic
989194978 5:38707652-38707674 GTCAGAGCAGGGAAAGGGTGGGG + Intergenic
990730697 5:58805850-58805872 AGTATAGGAGGGAAGGGGTGTGG + Intronic
990741970 5:58921556-58921578 AGCAGAGCAGGGTAAAGGAAAGG - Intergenic
990873089 5:60454974-60454996 GACAAGGCAGGGAAAGGGTGGGG + Intronic
991622307 5:68557700-68557722 AACTGAGCAGGGCAAAGGTGAGG - Intergenic
991940358 5:71845885-71845907 CTCAGGGCAGGGAGAGGGTGAGG - Intergenic
991997219 5:72400103-72400125 AGGAGAGAAGGGGAAGGGCGGGG - Intergenic
992035428 5:72769945-72769967 GACAGAACAGAGAAAGGGTGAGG + Intergenic
992103755 5:73432915-73432937 CACAGGACAGGGAAAGGGTGGGG - Intergenic
992525114 5:77602106-77602128 ACCAGAGGATGGGAAGGGTGGGG - Intronic
992681401 5:79156924-79156946 TGCAGAGCAGGGAAAGGGCAGGG + Intronic
993183176 5:84581784-84581806 AGCAAAGCAGGAAAAGGGAGAGG - Intergenic
993545621 5:89209069-89209091 AGCTGTGCAGGGAAAGAGTCAGG - Intergenic
994128754 5:96199754-96199776 AGCAGAGCAGGGATGGGATGGGG + Intergenic
994532700 5:100988788-100988810 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
995205876 5:109480981-109481003 GGCAGAGTAGGGAGAGGGTGGGG - Intergenic
995474464 5:112534053-112534075 ATCAGAGCATGGACAGGGTGAGG - Intergenic
995947528 5:117667110-117667132 ATCAGTGCATGGAAAGGGAGGGG + Intergenic
996014224 5:118514823-118514845 ACCAGAGGATGGGAAGGGTGCGG - Intergenic
996198550 5:120641029-120641051 AGAAGAGCAGAGTATGGGTGGGG + Intronic
996570471 5:124928283-124928305 TGCAGCCCAGGTAAAGGGTGTGG - Intergenic
997021620 5:130008833-130008855 AGCAGAGCAGAGGTAAGGTGAGG + Intronic
997235679 5:132270832-132270854 AGCACAGCAGGGTGGGGGTGGGG + Intronic
997362778 5:133305784-133305806 AGCAGCACAGGGAAAGGGTGAGG - Intronic
997425921 5:133802544-133802566 ACCAGAGCTGGGAAAGGGCCTGG + Intergenic
997455247 5:134012001-134012023 AGCAGAGCAGGGCAGGGGTGGGG + Intergenic
997603645 5:135157172-135157194 CTCAGAGCAGGGAATGGGGGTGG + Intronic
997661850 5:135595180-135595202 AGTGGAGCAGGGTAAGGGAGAGG - Intergenic
998096206 5:139396743-139396765 AGCAGAGAAGGCAGAGGCTGGGG + Intronic
998130044 5:139647265-139647287 AGCAGGGGAGGGAGAGGGGGAGG - Intergenic
998147549 5:139738853-139738875 AGCAGCTCAGGGACAGGTTGGGG - Intergenic
998421795 5:141994246-141994268 AGCAGAGGAGTGATAGGGTCAGG + Intronic
998989792 5:147802951-147802973 AGCAGAGCAAAGAAGGGGAGTGG + Intergenic
999240999 5:150127317-150127339 AGCAGGGCAGGGCAGGGGAGAGG - Intronic
999279600 5:150356616-150356638 AGGATGGCAGGGAAAAGGTGAGG - Intergenic
999869182 5:155731359-155731381 TGGGGAGGAGGGAAAGGGTGGGG + Intergenic
999904444 5:156124098-156124120 AGAAGGTCAGGGAAAGGGGGAGG - Intronic
1000109479 5:158094224-158094246 AGTTGAGAAGGGAAAGGCTGTGG - Intergenic
1000185302 5:158852018-158852040 GGGAGGGGAGGGAAAGGGTGGGG + Intronic
1001237747 5:170044450-170044472 AAGAGACCAGGGAAAGGGCGGGG - Intronic
1001295621 5:170496823-170496845 AGCAGAGCAGGGCTGAGGTGGGG - Intronic
1001506535 5:172284177-172284199 AGCGGAGCGGGGCGAGGGTGAGG + Intergenic
1001717064 5:173824991-173825013 AACAGAGAAGGGATAGTGTGAGG - Intergenic
1002196607 5:177504714-177504736 TGCAGGGGTGGGAAAGGGTGAGG - Intronic
1002441044 5:179264679-179264701 GGCAGAGGAGGGAAAGGGGACGG + Intronic
1002961651 6:1920768-1920790 AGCAGGGCAGGGAAAGAGGAAGG + Intronic
1003503734 6:6723553-6723575 AGTTGAGCAGGGAAGGGATGGGG + Intergenic
1003782126 6:9441341-9441363 AGCAGAGCAGAGAAAGAGGTGGG - Intergenic
1003891073 6:10564278-10564300 AGCAGAGTAGAGAATGTGTGTGG + Intronic
1004411599 6:15386243-15386265 AGAAGAACAGGGAGAGGGAGAGG - Intronic
1004506182 6:16248727-16248749 AGCAGAGCAGGGAAAGGGTGAGG - Intronic
1004860295 6:19797031-19797053 AGGAGAGAAGAAAAAGGGTGTGG + Intergenic
1005062011 6:21785410-21785432 AGGAGAGCAGGGAATGGAAGTGG + Intergenic
1005873646 6:29995413-29995435 AGCAGAGCAGGGCAGGGGTGGGG - Intergenic
1006132075 6:31875731-31875753 GGGACAGCAGGGAAAGGCTGTGG + Intronic
1006162500 6:32046676-32046698 ATCACAGCAGGGAAGGGGCGGGG - Intronic
1006304539 6:33211333-33211355 AGCAGTGTAGGGACAGGGGGAGG + Exonic
1006632845 6:35441678-35441700 AGAGGAGGAGGGAAAGGGGGCGG + Intergenic
1006818533 6:36871218-36871240 AATAAAGCAGGAAAAGGGTGTGG - Intronic
1007184124 6:39953166-39953188 ACCAGAGTAGGAAAAGGATGAGG + Intergenic
1007219888 6:40270118-40270140 AACAAAGCTGGGAAAGGGTACGG + Intergenic
1007313256 6:40963601-40963623 CAGAGTGCAGGGAAAGGGTGGGG - Intergenic
1007442325 6:41873147-41873169 AGCAGAGCTGGGATTAGGTGGGG + Intronic
1007690736 6:43699578-43699600 AGCAGAGTGGGGAAAGAGGGAGG + Intergenic
1008379501 6:50825788-50825810 AGCAGGGGAGGAACAGGGTGGGG - Intronic
1008525207 6:52400703-52400725 ACCAAAACAGGGAAAGGATGGGG - Intronic
1009761695 6:68014771-68014793 AGAAGAGCAGGGAGAAGGAGAGG + Intergenic
1009858293 6:69292555-69292577 AGCAGAGCAGAAAAAGGGGTGGG - Intronic
1010012194 6:71061190-71061212 AGGGGAGCAGGGGAAGGGTTAGG - Intergenic
1010233875 6:73558950-73558972 TACAGAGCTGGGAAAGGGAGGGG + Intergenic
1010298722 6:74232349-74232371 AGGAAAGGAGGGAAAGGGAGAGG - Intergenic
1010365755 6:75049423-75049445 AGGAGAGGAGGGAGAGGGAGGGG + Intergenic
1011859061 6:91732769-91732791 AGCAGAGGCTGGGAAGGGTGTGG - Intergenic
1012087628 6:94851050-94851072 AGGAGTGCAGGGTAAGGGTAAGG + Intergenic
1012537159 6:100312989-100313011 ATCAGAGCAGGGAAAGGCTGGGG - Intergenic
1012948892 6:105496415-105496437 AGCAGATCAGGGCAAAGGAGGGG + Intergenic
1013608590 6:111773553-111773575 CGCAGAGGAGGGAGAGGGAGAGG + Intronic
1013661438 6:112300761-112300783 AGCAGGGCAGGATAAGGGTGGGG + Intergenic
1014062343 6:117086204-117086226 AGAAGAGAAGGAAGAGGGTGAGG + Intergenic
1014215948 6:118752837-118752859 AGCAGAGCAGAGGAATGGGGCGG + Intergenic
1014499059 6:122163751-122163773 ATCAGAGCAGGTAAGGGGTGGGG + Intergenic
1014570887 6:123006141-123006163 TGCAGAGCAGGGAAAGCTGGTGG + Intronic
1014718453 6:124891618-124891640 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1014891383 6:126849928-126849950 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1015059796 6:128949325-128949347 AGGAGAGCTGGGGCAGGGTGGGG - Intronic
1015113483 6:129619584-129619606 AGGGGAGCAGGGAAGGGGAGAGG + Intronic
1015271210 6:131340051-131340073 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1015738534 6:136427799-136427821 AGCAGAGCATAGTAAGAGTGTGG + Intronic
1015810750 6:137159751-137159773 AGCAGACCAGGAAAAGGGAAGGG - Intronic
1015823061 6:137283342-137283364 GGCAGAGAGGGGACAGGGTGGGG - Intergenic
1015872976 6:137795662-137795684 GGCAGTGCAGGGAAAGGGGCAGG - Intergenic
1015880574 6:137867055-137867077 GGCGGGGCAGGGAAAGGGGGCGG + Intergenic
1016447170 6:144146253-144146275 AACAGAGCAGGCACTGGGTGCGG - Intergenic
1016518647 6:144924363-144924385 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1017018813 6:150123732-150123754 GGCAGGGCAGGGAGAGGGAGAGG - Intergenic
1017332752 6:153218497-153218519 GGAAGAGAAGGGAAAGGGAGAGG - Intergenic
1017345860 6:153379905-153379927 AACAGAGCAGCAAAAGGCTGAGG + Intergenic
1017721407 6:157245849-157245871 AGCAGTTCATGGACAGGGTGAGG - Intergenic
1017980721 6:159399086-159399108 CACACAGCAGGGACAGGGTGGGG + Intergenic
1018298641 6:162376813-162376835 AGAAGAACAGGGAGAGGGAGAGG + Intronic
1018539553 6:164863757-164863779 AGCACAGCAGGACAAGTGTGGGG - Intergenic
1018582547 6:165319574-165319596 AACAAAGCAAGGAAAGGATGAGG - Intergenic
1018705448 6:166460657-166460679 AGCAGGGCAGGGCCAGGCTGGGG + Intronic
1018750075 6:166796663-166796685 AACTTAGCAGGGAAAGGGAGAGG - Intronic
1018783715 6:167091988-167092010 AGGAGAGCAGGGCAAGGGCGAGG + Intergenic
1018866103 6:167748086-167748108 AGCTGAGCAGAGAAAGAGTTTGG - Intergenic
1018945610 6:168345619-168345641 AGACGTGCAGGGAAGGGGTGAGG - Intergenic
1018978480 6:168583346-168583368 AGTGGAGCTGGGAAGGGGTGAGG - Intronic
1019097053 6:169590744-169590766 AGCAGAACAGGGCACTGGTGTGG + Intronic
1019455851 7:1127137-1127159 AGCAGAGCCTGGAACAGGTGCGG - Intronic
1019634122 7:2066518-2066540 AGCACAGCAGGGTCGGGGTGAGG + Intronic
1019647725 7:2139993-2140015 AGCAGGGCAGGGACTGGGGGGGG - Intronic
1019774979 7:2906934-2906956 AGCAAGGCAGGGAAGGGGTGGGG - Intronic
1020111233 7:5448830-5448852 AGGAGAGGAGGGGAAGGCTGGGG + Intronic
1021621116 7:22551977-22551999 ACCAGTGCAGGGAGATGGTGGGG + Intronic
1021691725 7:23236714-23236736 AGCAGGACAGGCAAAGAGTGGGG - Intronic
1021979385 7:26039787-26039809 AGCAGAGCAGAGAGAAGGGGAGG + Intergenic
1022156428 7:27665552-27665574 ATCTAAGCAGGGAAAGGGAGGGG - Intergenic
1022226156 7:28365549-28365571 AGGAGAGCAGAGAAAGGGGGTGG - Intronic
1022795905 7:33731190-33731212 AGCAGAGCAGGAAATGGTTGAGG + Intergenic
1023062654 7:36343395-36343417 AGAAGGGGAGGGGAAGGGTGGGG + Intronic
1024043944 7:45574933-45574955 AGCAGAGCAGCGCGAAGGTGAGG - Exonic
1024364384 7:48504461-48504483 AGAAGAGCAGGGAGATGGGGAGG + Intronic
1024563854 7:50665729-50665751 AGCAGAGCCTGGGCAGGGTGAGG + Intronic
1024993465 7:55254235-55254257 AGGACAAGAGGGAAAGGGTGAGG - Intronic
1025853777 7:65261663-65261685 AGGAGAGCAGCGCAAGGTTGTGG + Intergenic
1025872638 7:65449200-65449222 AGAAGAGAAGGGAAGGGGGGAGG - Intergenic
1026228488 7:68463054-68463076 AGGAGAGGAGAGAAAGGGTGAGG - Intergenic
1026432949 7:70366430-70366452 AGCAAAGCAGGTGAAGGCTGTGG + Intronic
1026527209 7:71164561-71164583 TGCAGAGAAGGGAAATAGTGAGG + Intronic
1026542064 7:71288328-71288350 GGCTGAGCAGGAAAAGGGAGAGG + Intronic
1026635151 7:72075657-72075679 AGCTGAGCAGGGCCAGGGTTGGG - Intronic
1026761258 7:73127563-73127585 AGAAGAGAAGGGAAGGGGAGGGG + Intergenic
1026903154 7:74048067-74048089 GGCAGAGCAGGGGGAGGGGGAGG + Intronic
1027085963 7:75265091-75265113 AGAAGAGAAGGGAAGGGGAGGGG - Intergenic
1027350676 7:77308073-77308095 AGAAGAGAAGGGAAAAGGTGAGG - Intronic
1027402208 7:77821426-77821448 AGAAGAGAAGGGAAAAGGTAAGG - Intronic
1027611458 7:80366671-80366693 ACTAGAGCAGGGAGAGAGTGAGG + Intergenic
1027671791 7:81109309-81109331 AGAAGAGCAGGGGAAGGAAGAGG + Intergenic
1028743820 7:94305738-94305760 TGCAGAGAATGGAAAGGGCGGGG + Intergenic
1028993599 7:97076139-97076161 AGCGGGGCAGGGAAGGGGCGGGG - Intergenic
1029101662 7:98136027-98136049 AGCAGAGTAGGGAAAATATGAGG + Intronic
1029278571 7:99422437-99422459 AGAACAGCAGGGAGAGGCTGTGG + Intronic
1029790609 7:102839266-102839288 AGGAGAGCAGGGTGATGGTGGGG - Intronic
1030021956 7:105284200-105284222 ATCTGACCAGGGAAAGGGAGTGG + Intronic
1030112097 7:106035496-106035518 AGCAAAGCAGAGAAAGAATGAGG + Intergenic
1030182002 7:106719805-106719827 AGAAGAGAAGGAAAAGGATGAGG + Intergenic
1030186381 7:106766096-106766118 AGCTGAGCAGGGGACGGGAGGGG - Intergenic
1031728096 7:125263452-125263474 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1031752909 7:125599859-125599881 AGCGGAGCAAAGAAAGCGTGAGG + Intergenic
1032014977 7:128373546-128373568 GGAAGAGCAGGGAAATGGGGTGG - Intergenic
1032268236 7:130383128-130383150 AGCAGAACAGGGGAAGGGCCAGG + Intronic
1032584855 7:133136727-133136749 ATCTGAGCAGGGAAAAGTTGAGG + Intergenic
1032656179 7:133932772-133932794 AACAGAGCAGGGGAAAGGTCAGG - Intronic
1033274340 7:139959904-139959926 AGCAGAGCTGGGGCAGGGTCAGG - Intronic
1033523512 7:142186470-142186492 GGCAGAGCTGGGAGTGGGTGAGG + Intronic
1033870952 7:145752557-145752579 AACAGAGTTGGGGAAGGGTGGGG + Intergenic
1034348844 7:150403778-150403800 AGCAGTGAAGGGATGGGGTGGGG + Intronic
1034447597 7:151121539-151121561 AGCAGGGCAGGGAAAGGCAGGGG - Intronic
1034937513 7:155209546-155209568 AGCAGAGGAAGGAACGGGTGGGG - Intergenic
1035389754 7:158496763-158496785 AGGGGAGCAGGGAAGGGGAGGGG - Intronic
1035633585 8:1127082-1127104 AGCTGTGCTGGGACAGGGTGGGG - Intergenic
1035686429 8:1526869-1526891 AGCAGAGCCTGGAAAGGGGGCGG + Intronic
1036172810 8:6506601-6506623 TGAACAGCAGGGAAAGGGTCAGG - Intronic
1036716808 8:11133117-11133139 AGCATACAAGGGAGAGGGTGTGG + Intronic
1036955813 8:13187131-13187153 AGTAAAGCAGGGAAGAGGTGGGG - Intronic
1037801346 8:22037539-22037561 TGCACACCAGGGAGAGGGTGGGG - Intergenic
1038007294 8:23443073-23443095 GCCAGAGCATGGGAAGGGTGGGG - Intronic
1038387100 8:27158982-27159004 AGCAGACCAGGGATGGAGTGTGG + Intergenic
1038483628 8:27918730-27918752 AGAGGAGCAGGGAAAGGAAGAGG + Intronic
1038701321 8:29852149-29852171 AACAGAACAGGGAGAGAGTGTGG - Intergenic
1039118564 8:34119962-34119984 AGAAGAGAAGGAGAAGGGTGTGG - Intergenic
1039392147 8:37189953-37189975 AAAAGAGAAGGGAAAGGGAGGGG + Intergenic
1039397709 8:37241189-37241211 AGCAGAGGCTGGAAGGGGTGGGG - Intergenic
1039821366 8:41138315-41138337 AGCAGAGGAGGGAATGGGGAAGG + Intergenic
1039942052 8:42099571-42099593 AGCAGAGTAAGGGAAGGGTAAGG - Intergenic
1040524220 8:48204997-48205019 ACCACACCAGGGAAAGAGTGAGG - Intergenic
1041047301 8:53899845-53899867 AGCCCAGCAGGGGAAGAGTGAGG + Intronic
1041276021 8:56157911-56157933 GGGAGAGCAGGGAGAGGGAGGGG + Intergenic
1041562730 8:59238507-59238529 CCCAGAGCAGAGAAAGGGAGAGG - Intergenic
1042112512 8:65395739-65395761 AGCAGAGGAAGGAAAGAGAGTGG + Intergenic
1042310168 8:67371492-67371514 AAAAAAGCAGGGAAAGGGAGTGG - Intergenic
1042341541 8:67684944-67684966 AGCAGGGCAGGGTAAGTGGGTGG - Intronic
1042526939 8:69773436-69773458 AGCAGAGAGGGAAGAGGGTGTGG - Intronic
1042576409 8:70225178-70225200 AGGAAAGTAGGGAGAGGGTGGGG + Intronic
1042744599 8:72094207-72094229 AGTAGAGCAGTGAAAGGAGGAGG - Intronic
1043355064 8:79402215-79402237 AGCAGAGCAGGAAGAGCGAGAGG + Intergenic
1043378147 8:79672958-79672980 AGGAAAGCAAGGAAAGTGTGGGG - Intergenic
1043504180 8:80886335-80886357 AGCAGAGCGGGGGAAGGGCAAGG - Intergenic
1043741256 8:83814660-83814682 AGCACAGCATTGCAAGGGTGGGG + Intergenic
1044258783 8:90094741-90094763 AGAAAAGCAGAGAAAGGGTTGGG + Intronic
1045222825 8:100215172-100215194 ACCAGAGGATGGAAAGGGTAGGG - Intronic
1045354155 8:101370391-101370413 AGAAGAGCAAAGAAAGGGAGGGG - Intergenic
1045411801 8:101927568-101927590 CCCAGAGATGGGAAAGGGTGTGG + Intronic
1046011576 8:108554914-108554936 ACCAGAGCAGGAAAAAGGTAAGG + Intergenic
1046380538 8:113444276-113444298 AGCAGAGGAGGGGAGGGGAGGGG - Intergenic
1047324881 8:123826484-123826506 AGCAGAGCAGGGCCAGGGAAAGG + Intergenic
1047402990 8:124561723-124561745 AGCAGAGAGGGCAAAGGGTCGGG - Intronic
1047488587 8:125355339-125355361 AGTAGAGAAGGGAAAGGGAAAGG + Intronic
1047517143 8:125564898-125564920 AATAAAGCAGGGAAAGGGTTTGG + Intergenic
1048295277 8:133209478-133209500 GGCAGAGGAGGGAAGGGCTGTGG - Intronic
1048377238 8:133833506-133833528 AGCAGGGCAGGGGCAGGGTAAGG + Intergenic
1048523673 8:135180944-135180966 AGCACAGAAGAGCAAGGGTGTGG - Intergenic
1048996289 8:139795546-139795568 AGCTGGGCAGGGAGGGGGTGGGG + Intronic
1049004128 8:139844200-139844222 AGCAGGGCAGGGACAGAGTTGGG - Intronic
1049004596 8:139846752-139846774 AGCACAGCAGGGACTGGATGAGG - Intronic
1049188115 8:141270039-141270061 AGAAGGGCAGGGCAAGGGTCTGG - Intronic
1049542939 8:143216574-143216596 AGCAGAGCCGGGAAGGTGGGTGG + Intergenic
1049545251 8:143227802-143227824 AGCAGCGCAGGGCAGGGGTGGGG - Intergenic
1049575672 8:143388660-143388682 AGCAGAGGAGGGGCAGGTTGGGG + Intergenic
1049586612 8:143435371-143435393 GGCAGAGCAGCGACAGGCTGAGG - Intergenic
1049657212 8:143804191-143804213 GTCAGGACAGGGAAAGGGTGTGG + Intronic
1049861023 8:144899212-144899234 ACCAGAGGATGGGAAGGGTGGGG + Intronic
1050125474 9:2352681-2352703 AGGAGAGGAGGGAAGGGGAGGGG + Intergenic
1051522431 9:18004277-18004299 AGGAGACCAGTGAAAGGCTGAGG + Intergenic
1051849455 9:21490236-21490258 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1052703797 9:31969924-31969946 AGCAGAGTCAGGACAGGGTGTGG - Intergenic
1053122086 9:35555184-35555206 TGTAGAGCTGGGAAAGGCTGTGG - Exonic
1053138313 9:35665378-35665400 GGCAGGGCAGGGCAAGGTTGGGG + Intronic
1053151244 9:35744587-35744609 AGCAGAGCAGAGATGGGGTGGGG + Intronic
1053442956 9:38130851-38130873 ATCAGAGCCGGGCAGGGGTGAGG + Intergenic
1053445246 9:38147660-38147682 GGCAGAGCAGTGGGAGGGTGAGG - Intergenic
1053691259 9:40588519-40588541 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
1053695331 9:40634149-40634171 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1054273542 9:63048966-63048988 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
1054302519 9:63389490-63389512 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
1054306575 9:63433375-63433397 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1054401292 9:64715990-64716012 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
1054405317 9:64757364-64757386 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1054434900 9:65200310-65200332 TGCAGAGCCAGGAAAGGGTCTGG - Intergenic
1054438941 9:65242853-65242875 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1054491465 9:65779089-65779111 ATCTGAGCAGGGGAAGGATGTGG - Intergenic
1054495489 9:65821371-65821393 TGCAGAGCCAGGAAAGGGTCTGG + Intergenic
1055048797 9:71958823-71958845 AGCAGAGCAGGGAAGAGGTTTGG - Intronic
1055426977 9:76206459-76206481 GGGAGAGCAGGGACTGGGTGTGG - Intronic
1055612495 9:78037506-78037528 ACCAGAGCTGGGACTGGGTGAGG - Intergenic
1055805334 9:80086926-80086948 AGCAGAGCAGAGAAAGGAAGGGG - Intergenic
1055982483 9:82018151-82018173 AGAAGAGGAGGAAAAAGGTGAGG - Intergenic
1056008497 9:82300890-82300912 AGAAGAGATGGGAAAAGGTGTGG - Intergenic
1056260604 9:84844194-84844216 ACCAGAGGAGGGAAAGAGGGAGG + Intronic
1056882808 9:90413736-90413758 AGAAAAGCAGAGAAGGGGTGGGG - Intergenic
1057177963 9:93013104-93013126 AGCAGACTAGGGTAGGGGTGAGG - Intronic
1057377819 9:94541003-94541025 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1057442772 9:95094052-95094074 AGAAGAGCAAGAAAGGGGTGGGG - Intergenic
1057874374 9:98742826-98742848 CGCAGAAGAGGGAATGGGTGGGG + Intronic
1057919114 9:99082119-99082141 AGCAGGCGTGGGAAAGGGTGAGG + Intergenic
1058045501 9:100352944-100352966 AGCACAGCAGGGAGGGGGAGGGG - Intergenic
1058562325 9:106243149-106243171 AGCAGAGCAGGTAAAGGACAAGG + Intergenic
1058628605 9:106961974-106961996 AGCACAGCATGGAAACAGTGTGG + Intronic
1058777570 9:108300154-108300176 GGCAGAGCAAGGGAAGGATGAGG - Intergenic
1059320265 9:113463589-113463611 AGCAGAGCTGGGCCGGGGTGGGG - Intronic
1059444103 9:114327609-114327631 GGCAGGGCAGGGAAGGGCTGGGG + Intergenic
1059445310 9:114334388-114334410 GGCAGGGCAGGGAAGGGCTGGGG + Exonic
1059719621 9:116946752-116946774 TGCAGGGCAGGAAAAGGGTGGGG + Intronic
1060359134 9:122938217-122938239 ACTAGAGCAGGGAAAAGGGGAGG - Intergenic
1060515003 9:124259950-124259972 GGCAGAGGAGGGAAATGGGGAGG + Intronic
1060582111 9:124758736-124758758 AGCAGAACAGGGAAACAGTTTGG + Intronic
1060646949 9:125288872-125288894 AACAATGCAGGGAAAGTGTGTGG + Intronic
1060658630 9:125389476-125389498 AGCTGAGAAGGGAAAGGTTGGGG + Intergenic
1060698663 9:125731615-125731637 AGCAGAGGAGAGAAAGAGGGAGG - Intergenic
1060944634 9:127562666-127562688 AGCAGAGCACGGGAAGAGTTGGG + Intronic
1061271648 9:129547129-129547151 GGCAGAGCAGGGAAAGTGGAGGG - Intergenic
1061487080 9:130925376-130925398 AGGAGACCAGGGTCAGGGTGGGG + Intronic
1061661088 9:132130772-132130794 CTCAGAGCAGGGGAAGGATGGGG - Intergenic
1062066967 9:134533849-134533871 AGCAGAGCCGAGAAAGGTGGAGG - Intergenic
1062282191 9:135757079-135757101 AGCAGGGGAGGGGCAGGGTGGGG - Intronic
1062325538 9:136010833-136010855 GGCAGAACAAGGACAGGGTGTGG + Exonic
1202777775 9_KI270717v1_random:7765-7787 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1185990893 X:4892765-4892787 AGAAAAGCAGAGAAAGGGTTGGG - Intergenic
1186360268 X:8833799-8833821 ATCAGATCAGGGAAGGGGAGAGG - Intergenic
1186424081 X:9449636-9449658 AGAAGAGCAGGGAAAATGGGAGG + Intergenic
1187272032 X:17788265-17788287 AACAGAGCAGGGGAATGTTGGGG - Intergenic
1187713142 X:22074298-22074320 AGAAGAGAAGGAAAAGGGTATGG + Intronic
1188325906 X:28800486-28800508 AAAAGAAAAGGGAAAGGGTGAGG + Intronic
1188441083 X:30215787-30215809 TCCAGGGCAGGGGAAGGGTGGGG + Intronic
1188523920 X:31070045-31070067 AGCACAGCAGGTAAATGGGGTGG - Intergenic
1189149418 X:38689072-38689094 AGCAGAGAAGCTAAAGGGTTAGG + Intergenic
1189381417 X:40505191-40505213 AGTAGAGAAAGGAAGGGGTGGGG + Intergenic
1189951222 X:46233339-46233361 ATCAGAGCCTGGGAAGGGTGTGG + Intergenic
1190280249 X:48924463-48924485 AGCAGAGGACGGACAGGATGTGG - Intronic
1190287386 X:48970521-48970543 AGAAGAGCAGAAAAGGGGTGTGG + Exonic
1190711269 X:53072358-53072380 AGGAGAGCAGGGAGAGGGAGAGG - Intronic
1190789023 X:53682754-53682776 AGCAAGGCAGGGAAAAGGGGCGG + Intronic
1190911277 X:54774680-54774702 GGCAGAGCAGGGAGAGGAGGAGG + Intronic
1190919940 X:54841530-54841552 GGCAGAGCAGGGAGAGGAGGAGG - Intergenic
1192638454 X:72842895-72842917 AGCAGAGAGGGGAAGGGGTTGGG - Intronic
1192643260 X:72877913-72877935 AGCAGAGAGGGGAAGGGGTTGGG + Intronic
1194160305 X:90441075-90441097 AGCAGAGACGGGAAAAGTTGAGG + Intergenic
1194186407 X:90777852-90777874 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1194796559 X:98218412-98218434 AGCAGAGCAGGGGAAGTGCAAGG + Intergenic
1194813422 X:98414982-98415004 AGAAGTGCAGGGATGGGGTGTGG + Intergenic
1195151238 X:102072222-102072244 AGAACAGTAGGGAAAGGCTGTGG - Intergenic
1195197870 X:102516839-102516861 AGCGGAGGAGGGGAAGGGCGGGG - Intergenic
1195689253 X:107610343-107610365 AGCAAAGCAGGGAAGCTGTGTGG + Intergenic
1196031030 X:111096150-111096172 AGCAGAGAAGGGCTAGGGAGCGG + Intronic
1196037591 X:111163507-111163529 AGCAGGCCAAGGAAAGAGTGTGG - Intronic
1196311451 X:114171443-114171465 AGAAGACCAAGAAAAGGGTGTGG - Intergenic
1196425211 X:115562136-115562158 AGCTGTGCGGGGAAAGGGCGGGG - Intronic
1196533696 X:116816997-116817019 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1196818618 X:119685374-119685396 GTCAAAGCAGGGAAGGGGTGGGG + Intronic
1197703491 X:129617109-129617131 AGTAGAGGAGGGGAATGGTGCGG - Intergenic
1198242023 X:134796585-134796607 GGCAGAGGGGGGAAAGGGAGAGG + Intronic
1198482204 X:137051730-137051752 AGCACACCAGAGAAAGGTTGGGG + Intergenic
1200117734 X:153776626-153776648 GGCAGAGCAGGGCAGGGCTGGGG + Intronic
1200147196 X:153932440-153932462 AGAAGAGCAGAGATGGGGTGAGG + Intronic
1200250808 X:154552813-154552835 AGCTGAGCAGCAAGAGGGTGAGG - Intronic
1200304273 X:155008546-155008568 AGCTGAGCAGCAAGAGGGTGAGG + Intronic
1200506596 Y:4018023-4018045 AGCAGAGACGGGAAAAGTTGAGG + Intergenic
1200533004 Y:4359928-4359950 AGAAAAGCAGAGAAAGGGTTGGG + Intergenic
1200611300 Y:5329304-5329326 AGAAAAGCAGAGAAAGGGTTGGG + Intronic
1200757037 Y:6999794-6999816 AGGAGAGGAGGGGAAGGGAGGGG - Intronic
1201189938 Y:11437162-11437184 TGCAGAGCCAGGAAAGGGTCAGG - Intergenic
1201193116 Y:11466044-11466066 ATCTGAGCAGGGGAAGGATGTGG + Intergenic
1201894915 Y:18982895-18982917 ACGAGAGGAGGGAAAGGGGGAGG + Intergenic