ID: 1004506183

View in Genome Browser
Species Human (GRCh38)
Location 6:16248732-16248754
Sequence GACAGAGCAGAGCAGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1027
Summary {0: 1, 1: 0, 2: 17, 3: 105, 4: 904}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004506183_1004506190 25 Left 1004506183 6:16248732-16248754 CCCTTTCCCTGCTCTGCTCTGTC 0: 1
1: 0
2: 17
3: 105
4: 904
Right 1004506190 6:16248780-16248802 TGTGTTAGTATAAAAGTGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 329
1004506183_1004506188 23 Left 1004506183 6:16248732-16248754 CCCTTTCCCTGCTCTGCTCTGTC 0: 1
1: 0
2: 17
3: 105
4: 904
Right 1004506188 6:16248778-16248800 TATGTGTTAGTATAAAAGTGAGG No data
1004506183_1004506189 24 Left 1004506183 6:16248732-16248754 CCCTTTCCCTGCTCTGCTCTGTC 0: 1
1: 0
2: 17
3: 105
4: 904
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004506183 Original CRISPR GACAGAGCAGAGCAGGGAAA GGG (reversed) Intronic
900176167 1:1292351-1292373 GACAGAGCAGAGCAAGGCACGGG + Intergenic
900712250 1:4121867-4121889 GACAGAGCTGAGCCGTGAAAAGG - Intergenic
900715306 1:4140272-4140294 GTCAGAGAAGAGCAAGGTAAAGG + Intergenic
900981676 1:6049431-6049453 GACAGATCACAGCAGGAAAGAGG + Intronic
901536011 1:9883405-9883427 GGCAGAGCAGGGCAGGGGAGAGG + Intronic
901633157 1:10657659-10657681 GACAGAGCAGGACAGGGGATCGG + Intronic
901868023 1:12120307-12120329 GCCAGATCAGAGCAGGAAAATGG + Intronic
901946012 1:12704279-12704301 GTCAGGGCAGAGCAGGTAATCGG + Intergenic
901966576 1:12873285-12873307 GAAAAAGCAGAGCAGAAAAATGG - Intronic
902786249 1:18734456-18734478 TTCAGAGCAGAGCAGGGGAGAGG - Intronic
903603379 1:24557750-24557772 CACAGAGCCCAGCAGGGACAAGG - Intronic
903766191 1:25736200-25736222 GACAGAGCTGGGCAGGGACTGGG - Intronic
904163635 1:28538729-28538751 GGCAGAGCAGAGCAGGGTATGGG + Intronic
904426002 1:30423596-30423618 GACTGAGAAGAGAAGGGACATGG - Intergenic
904587110 1:31586682-31586704 GGCAGAGCAGAGGAGGGGGAAGG - Intronic
905857109 1:41321471-41321493 GGCAGAGCAGAGCAGTGGAAGGG - Intergenic
906506584 1:46384101-46384123 GTCAGGGCAGAGCAGGTAATTGG + Intergenic
906545252 1:46615762-46615784 GACAGAGAAGAGGAGGGGAGTGG + Intronic
906843737 1:49167607-49167629 GAAAGAGCATAGCAGGCCAAAGG + Intronic
907425363 1:54375942-54375964 GAAGGAGGAGAGCAGGGAAGAGG + Intronic
907834239 1:58093902-58093924 TACAGAGCAGAGCAAGCAAAGGG - Intronic
908182379 1:61618842-61618864 GACTGAGCAGATGAGGGAGAAGG + Intergenic
909286532 1:73826948-73826970 GAAACAGAAGAGGAGGGAAAAGG + Intergenic
910085359 1:83395373-83395395 AACAGAGCAGAGCAGAGCAGAGG - Intergenic
910664553 1:89710137-89710159 GCCAGAGATCAGCAGGGAAAAGG - Intronic
910839364 1:91546729-91546751 GAGAGGGAAGGGCAGGGAAAGGG - Intergenic
910975296 1:92900206-92900228 GAAAGAGAAAAGAAGGGAAAAGG - Intronic
911074990 1:93864461-93864483 TCCAGAGCAGACCAGAGAAAGGG + Intergenic
911084992 1:93968917-93968939 GAAAAAGCAGAGCAGAGTAAAGG + Intergenic
911425298 1:97703112-97703134 TCCAGAACAGAGCAGGCAAAGGG - Intronic
911650869 1:100386693-100386715 GACAGACCAGAGTAAGGAAGAGG + Intronic
911801492 1:102144753-102144775 GAGAGGGAAGAGCAGGGCAAGGG - Intergenic
911866250 1:103026822-103026844 GAAAGAGGGGAGGAGGGAAAGGG + Intronic
912180306 1:107210974-107210996 GACAGAGCAGAGTATGGAGAAGG - Intronic
912580773 1:110719138-110719160 TACAGAGCAAAGCAGGGGAAGGG - Intergenic
912642998 1:111364981-111365003 GAAAGAGGAGAAAAGGGAAAGGG + Intergenic
912682693 1:111739218-111739240 GACGATGGAGAGCAGGGAAATGG - Exonic
912888811 1:113505617-113505639 GACAGAGCAGGGAAGGGAAAAGG + Intronic
912934995 1:113995258-113995280 GAAGGAGAAGAGAAGGGAAAGGG + Intergenic
912989747 1:114473557-114473579 GTCAGGGCAGAGCAGGTAATCGG + Intronic
913373742 1:118129118-118129140 GTAAGAGCACAGCAGGGAAGTGG + Intronic
913957948 1:143320773-143320795 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
913958464 1:143322594-143322616 GACAGAGCAGGGCAAGGAGATGG + Intergenic
914052257 1:144146131-144146153 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
914052781 1:144147974-144147996 GACAGAGCAGGGCAAGGAGATGG + Intergenic
914126416 1:144818567-144818589 GACAGAGCAGGGCAAGGAGATGG - Intergenic
914126940 1:144820410-144820432 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
914460107 1:147875876-147875898 GACAGGGCAGAGGAGGGAACCGG - Intergenic
915283160 1:154836495-154836517 GGCAGAGCTGAGCAGGGACGTGG + Intronic
915314416 1:155019945-155019967 GAGAGAGCAGAGCAGGCAGCTGG - Intronic
915343255 1:155187543-155187565 GACTGGGCAGAGAAAGGAAATGG + Exonic
915589901 1:156864773-156864795 GACTGAGCCGAGGAGTGAAATGG - Exonic
915891006 1:159773996-159774018 GTAAGAGCAGGGCAGGAAAAAGG + Intergenic
916088714 1:161290291-161290313 GACCGAGCACAGCAGGGACAAGG - Intergenic
916117549 1:161500056-161500078 GAGAAAAAAGAGCAGGGAAAGGG - Intergenic
916588926 1:166171578-166171600 GACAGATCAGGACAGAGAAAAGG - Intergenic
916739041 1:167632142-167632164 TTCAGGGCAGAGGAGGGAAATGG + Intronic
917082517 1:171271266-171271288 CTCAGAGCAGAACAGGAAAAAGG + Intronic
917124722 1:171676944-171676966 GACAGAGAAGAGGAGGAGAAAGG + Intergenic
917589214 1:176459779-176459801 GGCAGAGGAGAGAAGAGAAACGG - Intergenic
918046918 1:180947203-180947225 GACACTGCAGAGCAGGCAACGGG + Exonic
918067865 1:181113577-181113599 GAAGGAGCAGGGCAGGGACAGGG - Intergenic
918084931 1:181237315-181237337 AACAGAACAGAGCAGGGAAAGGG + Intergenic
918125381 1:181579250-181579272 AACAGAGGGGAGAAGGGAAAAGG - Intronic
918276949 1:182961989-182962011 GATAGGGCAGAGCAGGGATGAGG + Intergenic
918344913 1:183598631-183598653 GAGAAAGAAGAGCAGGGAGAGGG + Intergenic
919234776 1:194826855-194826877 GAACTACCAGAGCAGGGAAAGGG + Intergenic
919837109 1:201582584-201582606 CACAGAGAAGAGCTGGGGAATGG + Intergenic
919936116 1:202251881-202251903 GAGAGAGAAGAGGAGGGAGAAGG + Intronic
920013304 1:202886214-202886236 GACAGAGCACAACGGGGAACGGG + Intronic
920249649 1:204615096-204615118 AAGAGATCAGAGCAGGCAAATGG + Intergenic
920833304 1:209484721-209484743 GAGACAGGAGAGCAGGGATAGGG - Intergenic
920838685 1:209535665-209535687 GACATAGCAGAGCAAGGGAAAGG - Intergenic
920985633 1:210885929-210885951 GACAGAGCACCTGAGGGAAATGG + Intronic
921055807 1:211541625-211541647 GGCAAAATAGAGCAGGGAAAGGG - Intergenic
921650719 1:217674739-217674761 CACAGGCCAGAGCAGGGCAAGGG - Intronic
922188947 1:223300125-223300147 GTCAGAGCAGACCAGGGGCAGGG + Intronic
922415153 1:225414781-225414803 AACAGAGCAGGGGAGAGAAAGGG + Intronic
922649270 1:227322727-227322749 GACAGAGTAGAGCAGGCAATGGG + Intergenic
922846324 1:228687909-228687931 GATGGAGCAGAGGAGGGAGAGGG - Intergenic
923051367 1:230393241-230393263 AAGGGAGAAGAGCAGGGAAAAGG + Intronic
923355214 1:233148268-233148290 GTCAAAGCAGAGATGGGAAAAGG + Intronic
923638158 1:235722381-235722403 TATAGAGGAGAGCAGAGAAATGG + Intronic
923906771 1:238393840-238393862 CACAGGGAACAGCAGGGAAATGG + Intergenic
923987942 1:239402519-239402541 GACATGACAGAGCGGGGAAAGGG - Intronic
924586834 1:245367581-245367603 GACACTGAAGAGCAGAGAAAGGG - Intronic
924660563 1:246012707-246012729 GAAACAGCAAAGCAGGGAAAAGG + Intronic
1062768782 10:83963-83985 GCCAGGGGAGAGCAGGGAAGGGG - Intergenic
1062884028 10:1003005-1003027 GAAGGAGAAGAGAAGGGAAAAGG - Intronic
1063193498 10:3719073-3719095 GACAGATGGGAGCAGAGAAAGGG + Intergenic
1063255266 10:4320735-4320757 GGGCGAGCAGAGGAGGGAAATGG - Intergenic
1063579986 10:7297511-7297533 GAGAGAGAAAAGGAGGGAAAGGG + Intronic
1063850160 10:10179696-10179718 TACAGAGCAGAAAAGGGAAGAGG - Intergenic
1063902517 10:10748803-10748825 GACAGAGGAGTCCAGGGAAAAGG + Intergenic
1064371373 10:14754494-14754516 GAGAGAGATGAGCAGGGAGAGGG - Intronic
1064373465 10:14774581-14774603 AGCAGAGCTGAGCACGGAAATGG + Exonic
1064406039 10:15064531-15064553 GGCAGTGGAGAGCAGGGAAATGG + Intronic
1064429544 10:15258882-15258904 GAGCGAGCAGAGCACAGAAATGG - Intronic
1064516594 10:16155861-16155883 GACAGGGGAGATCAGGGACAGGG + Intergenic
1064897926 10:20260353-20260375 GGCAGAGCAGGGCAGGAAATAGG - Intronic
1065508828 10:26457229-26457251 GAAAAAGCAGACCAGAGAAAGGG - Intronic
1065625588 10:27625636-27625658 GACAGAGCACAGCGTGTAAAGGG - Intergenic
1065659030 10:27986145-27986167 GGGAGAGGAGAGCAGCGAAAAGG + Intronic
1065734342 10:28738131-28738153 TACAGACCAGAGCAAGGGAAGGG - Intergenic
1066656928 10:37705125-37705147 GACAGACATGAGCAGGGACATGG + Intergenic
1066759118 10:38737642-38737664 GCCAGTGCAGAGCCAGGAAAGGG - Intergenic
1066760174 10:38741787-38741809 GTCAGGCCAGGGCAGGGAAAGGG - Intergenic
1066961437 10:42230981-42231003 GTCAGGCCAGGGCAGGGAAAGGG + Intergenic
1066961892 10:42232941-42232963 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1066962426 10:42234800-42234822 GGCAGAGCAGGGCAAGGCAATGG + Intergenic
1066962510 10:42235128-42235150 GCCAGTGCAGAGCCAGGAAAGGG + Intergenic
1067041461 10:42955364-42955386 GACAGACATGAGCAGGGACATGG + Intergenic
1067232939 10:44424784-44424806 GAGAGAGCAGGGCAGGGTCAGGG - Intergenic
1067372695 10:45699905-45699927 GACAGATCAGTGCAGGGTAGTGG - Intergenic
1067529337 10:47059143-47059165 GGCTGAGGAGAGCAGGGAACAGG + Intergenic
1067687477 10:48475892-48475914 GCCAGAGCAGAGTGGGCAAAGGG - Intronic
1068589523 10:58839236-58839258 GACAGAGCAGGTCAGGGAGAAGG + Intergenic
1068769405 10:60804282-60804304 TACAGAGCAGAGCAGCATAAGGG - Intergenic
1068962565 10:62880422-62880444 GACATAACAGAGAAAGGAAAGGG + Intronic
1069270725 10:66524104-66524126 GACGGAGTAGAGCAGAAAAAGGG - Intronic
1069344222 10:67448186-67448208 GAGGGAGGAGAGCAGGGAAAGGG + Intronic
1069821317 10:71230423-71230445 GACTGAGCAGAGCAGGCCAGTGG + Intronic
1069947703 10:71999228-71999250 GGCACAGTAGGGCAGGGAAATGG - Intronic
1070565035 10:77597685-77597707 GACAGAGCAGAGCATGTGACAGG - Intronic
1070593856 10:77819174-77819196 GCTAGAGCAGCACAGGGAAAGGG - Intronic
1071292405 10:84197204-84197226 GACAGGGTAGAGAAAGGAAAGGG + Intronic
1071339069 10:84626004-84626026 GGCAGAGAAGTGCAGGGAAAAGG + Intergenic
1071498590 10:86188014-86188036 GACAGGGCAGGGCAGGGCAAAGG - Intronic
1072754713 10:98011552-98011574 GAAAAAGCAGAGCAGGCTAAGGG - Intronic
1072758477 10:98036693-98036715 GAAAGAGAAGAGTAAGGAAATGG + Intergenic
1073026830 10:100493959-100493981 GAGAGAGGAGAGGAGGGGAAGGG + Intronic
1073061852 10:100738047-100738069 GACAGAGCAGTGCAGAAAAAGGG - Intronic
1073332488 10:102679470-102679492 CACAGGACAGAGCAGGGCAATGG + Intronic
1073739999 10:106395591-106395613 GACAGAGGAGAGAATGTAAATGG + Intergenic
1073771980 10:106744754-106744776 GACAGAGGAGAGACAGGAAAAGG + Intronic
1073976650 10:109109328-109109350 GAAAAAGTAGAGCAGGGCAAAGG + Intergenic
1074067893 10:110035300-110035322 GATAGAGCAGAGGGTGGAAAGGG - Intronic
1075299660 10:121310564-121310586 GACAGAGCAGAGAAGAGGCAGGG + Intergenic
1075986852 10:126795585-126795607 TAAAGAGCACAGTAGGGAAAGGG + Intergenic
1076476678 10:130758483-130758505 GACATAGGAGAACAGGGAACAGG + Intergenic
1077581131 11:3418021-3418043 GACAGTGCAGGGCAGGAAGAAGG - Intergenic
1077958768 11:7050311-7050333 GAGAAAGAAGAGCATGGAAATGG + Intronic
1078630156 11:12995309-12995331 GAGATAGCAGAGCCAGGAAATGG - Intergenic
1078758649 11:14234294-14234316 GCCAGAGCAAAGAAGGGAAAAGG - Intronic
1078795392 11:14587153-14587175 AACAGAGAAGAGCAGGGAAAGGG - Intronic
1078986642 11:16605011-16605033 GGCCGGGCAGAGAAGGGAAAGGG - Intronic
1079142707 11:17823405-17823427 CAAAGAGTAGAGCATGGAAAGGG - Intronic
1079233306 11:18668690-18668712 AACCGAGCAGAGCAGGGGGAGGG + Intergenic
1079253984 11:18810562-18810584 GGCAGAGCTAAGCATGGAAATGG + Intergenic
1079393431 11:20041781-20041803 GGCAGAGCATACCAGGGAGAGGG - Intronic
1079509047 11:21188721-21188743 GACACTTCAGAGCAGGTAAATGG - Intronic
1080046864 11:27817963-27817985 GAAAGTGCAGACCAGGGAGAGGG - Intergenic
1080049603 11:27846071-27846093 GGGAGAGCAGTGCAGGGGAAAGG - Intergenic
1080636337 11:34127066-34127088 GACAAAGGAGAGAAAGGAAAGGG + Intronic
1081281475 11:41214040-41214062 GACAGACCAGAATAGGAAAATGG - Intronic
1081637323 11:44729175-44729197 GAGAGAGGAGAGAAAGGAAAGGG + Intronic
1081693586 11:45094556-45094578 GAAAGAGGAGAGGAGGGGAAAGG + Intergenic
1082251227 11:49982606-49982628 GAGATGGCAGAGCAGTGAAAAGG - Intergenic
1082575540 11:54798650-54798672 GAAAAAGCAGAGCAGAAAAACGG + Intergenic
1082711877 11:56562138-56562160 GACAGAGGAGAGAGGGTAAAGGG - Intergenic
1083249423 11:61455969-61455991 GACAGTGCAGAGCAAGGTAAGGG - Intronic
1083411924 11:62499777-62499799 GACAGAGGATAGCTGGTAAAGGG + Intronic
1083642130 11:64151172-64151194 GGCACAGCAGAGCAGAGCAAAGG + Intronic
1083969238 11:66063211-66063233 GACACAGCAGAGCCTGGAAAAGG + Intronic
1084455042 11:69263570-69263592 CACAGCCCAGAGCAGGAAAAGGG - Intergenic
1084855232 11:71980291-71980313 AACAGAACAGAACAGAGAAAAGG - Intronic
1084858014 11:72001133-72001155 GGCACAGCAGAGCAGGGTAGGGG + Intronic
1084981024 11:72828852-72828874 GCCACAGCAGAGCAAGAAAACGG - Intronic
1085411119 11:76291328-76291350 GCCAGAGGGGAGCAGGGGAAGGG - Intergenic
1085849136 11:80099512-80099534 GACAGGGCATAGCAGGGATGTGG - Intergenic
1086410759 11:86541682-86541704 GACAGAGCACCTCAGGGAAGGGG + Intronic
1086958385 11:92957570-92957592 GTCAGGGCTGAGCAGGGAAGTGG + Intergenic
1087094785 11:94307923-94307945 GATAGAGCAGAGCAGTGGAGGGG - Intergenic
1087138065 11:94740305-94740327 AACATAACAGAGCAGGGAATCGG + Intronic
1087310454 11:96535920-96535942 GGCAGTTCAAAGCAGGGAAATGG - Intergenic
1087336411 11:96850310-96850332 GACAGAGGAGAGCAGGGCAAAGG + Intergenic
1087696479 11:101382782-101382804 AACATAGCAGAGAAGCGAAAGGG - Intergenic
1088262392 11:107956410-107956432 GAAAGAGGAAAGGAGGGAAAAGG + Intronic
1088415865 11:109588650-109588672 AAGAGAGCAGAGCAGTGAAAAGG + Intergenic
1088844254 11:113651652-113651674 GACAAAGAAGAGCAGAGAGAGGG - Intergenic
1088869195 11:113876752-113876774 GTCAGACCAGACCAGGGCAAGGG - Intergenic
1089051785 11:115551994-115552016 GAGAAAGTAGAGCAGGAAAATGG + Intergenic
1089095775 11:115918812-115918834 GACTGAGCAGAGTAGGGAACTGG + Intergenic
1089177146 11:116557216-116557238 GAAGGAGCAGAGCAGGAAACAGG + Intergenic
1090077427 11:123588056-123588078 AACTGAGCAAAGGAGGGAAAGGG - Intronic
1090407051 11:126482691-126482713 AGCAGGGCAAAGCAGGGAAAAGG - Intronic
1090619261 11:128547129-128547151 GACTGACCAGAGCAGGGAGAAGG + Intronic
1091518067 12:1206488-1206510 GACAGAGGAGAGCAGGGCAGGGG - Intronic
1091671649 12:2456509-2456531 GCTGGAGCAGGGCAGGGAAAGGG - Intronic
1091729045 12:2866178-2866200 GCCAGACCAGAGCAAGGAGAAGG - Intronic
1091897398 12:4116594-4116616 GGGAGAGGAGACCAGGGAAATGG + Intergenic
1092894225 12:12997680-12997702 AAGACAGCAGAGCAGGGAATGGG + Intronic
1092986205 12:13848502-13848524 GACAGAAAAGAACATGGAAAAGG + Intronic
1093402344 12:18761455-18761477 GACAGAGCACCTGAGGGAAAGGG + Intergenic
1093706532 12:22280804-22280826 AACTGAGAAGAGCAGGAAAATGG - Intronic
1095399551 12:41798985-41799007 GACAAACCAGAGTAGGGAAACGG - Intergenic
1096200302 12:49676881-49676903 TAAAGAGAAGAGCAGGGAAGTGG - Intronic
1096244362 12:49975888-49975910 GACAGAGCAGAGGAAGGCAGGGG + Exonic
1096449621 12:51727435-51727457 GATAGAGAAGGGGAGGGAAAGGG + Intronic
1096466253 12:51848842-51848864 GAGAGGGAGGAGCAGGGAAAGGG - Intergenic
1097757155 12:63419260-63419282 GTCAGAGTGGAGCAGGGAATTGG - Intergenic
1097792132 12:63826261-63826283 GCCAGAGGAGAGTAGGGAACTGG + Intergenic
1098383616 12:69895692-69895714 GACAGGGCAGGGCAGGAAAGTGG - Intronic
1098523984 12:71465393-71465415 GAAACAGAAGAGCAGGAAAATGG - Intronic
1098729770 12:74019512-74019534 GACTGAGGAGAGTAGGGAAGAGG + Intergenic
1099675200 12:85751703-85751725 GAAAGAGCACAGTAGGGAACAGG + Intergenic
1100436845 12:94578908-94578930 GTCAGGGCAGAATAGGGAAAAGG - Intronic
1100639833 12:96471746-96471768 CACAGAGCAGAGAAGGGGTAGGG + Intergenic
1100795287 12:98175809-98175831 GGGAAAGCAGAGCAGGGAGATGG - Intergenic
1100903152 12:99266500-99266522 GACAAACCAGGGCATGGAAATGG - Intronic
1100961228 12:99964847-99964869 GACAGAGCCTAAGAGGGAAAAGG + Intronic
1101217910 12:102603483-102603505 GAGAGAGCAGAGCAGGGTGCAGG - Intergenic
1101580429 12:106037507-106037529 GAAAGGGGAGAGCAGGGGAAGGG - Intergenic
1102542363 12:113630983-113631005 CAGAAAGCAGAGAAGGGAAAAGG - Intergenic
1102949837 12:117024111-117024133 GGAAGAGCAGAGAAGGGAAATGG - Intronic
1103158260 12:118706213-118706235 GCCAGGGCAGAGCAGGGGAGGGG - Intergenic
1103438834 12:120947927-120947949 GACAGAGCAAAGCACAGAAAAGG - Intergenic
1103507083 12:121448997-121449019 GACAGAGCAGGCCAGGCCAAAGG + Intronic
1103564072 12:121806659-121806681 GGAAGAGCAGAGCCGGGAAGAGG + Intronic
1103834469 12:123807916-123807938 GAGAGAGAAGGGGAGGGAAAAGG + Intronic
1104024782 12:125017883-125017905 GACAGGGCAGAGCTGGGATTTGG - Intronic
1104232524 12:126898843-126898865 GCAAGAGGAGAGAAGGGAAATGG + Intergenic
1104264995 12:127223629-127223651 GGCTGAGCAGAGCAGGGCAGTGG + Intergenic
1104486169 12:129152771-129152793 TTCAGAGCGGAGCAGGGGAAGGG - Intronic
1104498989 12:129266608-129266630 GAGAGAGGAGAGGAGAGAAAGGG - Intronic
1104635992 12:130438135-130438157 TCCAGAGCAGAGCAGGGCAGGGG + Intronic
1104805571 12:131587158-131587180 GCCAGAACAGAGCAGACAAAAGG + Intergenic
1105205232 13:18217737-18217759 GAGAGGGCAGAGCAGGGAGATGG - Intergenic
1106309041 13:28536868-28536890 GACAGAGGTCAGAAGGGAAAGGG + Intergenic
1106335035 13:28776488-28776510 GACAGAGCACCTCAGGGAAGGGG - Intergenic
1106356882 13:28991712-28991734 GCCAGCCCAGAGCAGGAAAAAGG - Intronic
1106912583 13:34478950-34478972 GAGAAAACAAAGCAGGGAAAAGG + Intergenic
1107612647 13:42131818-42131840 AACTGAGAAGAGCAGGGAGATGG - Intronic
1108059643 13:46519613-46519635 AACAGAGCAGGGCAGGAACAGGG + Intergenic
1109079014 13:57874537-57874559 CACAGAGCAAAGCAGCGAAGGGG - Intergenic
1110174901 13:72544535-72544557 GACAGGGAAGAGAAGGTAAAAGG - Intergenic
1110316790 13:74117569-74117591 CACAGAACAGAGTAAGGAAATGG + Intronic
1110369817 13:74727458-74727480 GGCAGAACAGAGCAGGGGAGGGG + Intergenic
1110369819 13:74727463-74727485 AACAGAGCAGGGGAGGGGAAGGG + Intergenic
1110597305 13:77333648-77333670 TACAGAGCAGAGCAGGAGAATGG - Intergenic
1110708690 13:78625998-78626020 GAAAGAGCAGACCTGTGAAATGG + Intronic
1111908829 13:94287436-94287458 GACATTGCAGAGCAAGAAAAAGG + Intronic
1112156661 13:96824674-96824696 CACACAGCAGAGCAGGGCAGAGG + Intronic
1113527552 13:110992380-110992402 CTCAGAGCAGAGCAGGGATGGGG - Intergenic
1113814812 13:113162791-113162813 GACAGAGTGGAGCAGGGACGGGG - Intronic
1114324416 14:21574479-21574501 GACTGTGGAGAGCAGGGAACTGG + Intergenic
1114513214 14:23279524-23279546 GTCAGGGCAGAGCAGGTAATCGG + Intronic
1114536616 14:23427036-23427058 GAAAGAGGAGAGAAGGGAGATGG + Intronic
1114564927 14:23623650-23623672 GACAGGACAGAGGAGGAAAAAGG - Intergenic
1114565728 14:23631565-23631587 AAGAGAGAAGAGAAGGGAAAAGG - Intronic
1114620358 14:24092857-24092879 GAGGAAGCAGAGCAGGGAGATGG - Intronic
1114674442 14:24431000-24431022 GGCCGAGGAGAGCAGGGAAGAGG + Intronic
1114970884 14:28027003-28027025 GAGAGAGAAGAGGAGGGAAAAGG + Intergenic
1115486200 14:33913647-33913669 GACAGACCAAAAGAGGGAAAGGG + Intergenic
1116743909 14:48793002-48793024 GACAGAGCACCTCGGGGAAAGGG + Intergenic
1116763019 14:49038280-49038302 GACAGAGCCTAGCAGGGAGTGGG + Intergenic
1116879794 14:50154082-50154104 GAGAGGGAAGAGGAGGGAAATGG + Intronic
1117024982 14:51609913-51609935 GACTGAGCAGAGCAGAGGAATGG - Intronic
1117389029 14:55245566-55245588 GCCAGAGCTGGGAAGGGAAATGG - Intergenic
1117422488 14:55560509-55560531 GACAGAGGAAAGCAGGGCCATGG + Intronic
1117517893 14:56520697-56520719 GGCAGGGCAGAGCAGAGGAATGG + Intronic
1117717794 14:58598668-58598690 GACAGACCAGATCAGAGGAAAGG + Intergenic
1117756442 14:58979278-58979300 TAGAGAGCAGAGCAGGGGATAGG - Intergenic
1118016095 14:61662756-61662778 CACAGAGCAAAGAAGGGAGAGGG - Intergenic
1118054463 14:62065080-62065102 GGTAGAGCAGAGCAGTGAAAAGG - Intronic
1118512236 14:66488174-66488196 GACAGATCATGGCAGGGAAGGGG + Intergenic
1118596104 14:67436733-67436755 GAGAGAGGAGAGGAGAGAAATGG + Intergenic
1118615647 14:67572872-67572894 GGCAGCACAGAGCAGGGAGAGGG - Intronic
1118809643 14:69263554-69263576 CAGAGAGCTGAGCTGGGAAAGGG + Intronic
1119165214 14:72486809-72486831 GAGACAGGAGAGCAAGGAAAGGG + Intronic
1119505701 14:75171215-75171237 AACAAAGCAGAGGATGGAAAAGG + Intronic
1119760686 14:77148764-77148786 GAGAAAGAAGAGGAGGGAAATGG + Intronic
1119997703 14:79271535-79271557 GAAAGGGCAGGCCAGGGAAAGGG - Intronic
1120206992 14:81597659-81597681 GACAGAGCCCAGCATGGAACAGG - Intergenic
1120634444 14:86934179-86934201 CCAAGCGCAGAGCAGGGAAAAGG + Intergenic
1120880780 14:89413889-89413911 GGCAGGGCAGGGCAGGGCAAGGG + Intronic
1121387794 14:93544870-93544892 TCCAGAGCAGAGCAGAGAAGAGG + Intronic
1121588707 14:95082683-95082705 AACAGATCAGAGAGGGGAAAAGG + Intergenic
1121776446 14:96593820-96593842 GGCAGAGCAGAGCAGGGGTGAGG + Intergenic
1121823635 14:96992475-96992497 GAAATATTAGAGCAGGGAAAGGG + Intergenic
1122138983 14:99650846-99650868 GCCAGAGAAGAGCAGGGAAAGGG + Intronic
1122275967 14:100590962-100590984 GACAGAGCAGGGCAGGCAGTGGG - Intergenic
1122553304 14:102561977-102561999 GGCTGGGCAGAGCAGGTAAATGG - Intergenic
1122830763 14:104394516-104394538 GAGAGGGCTGGGCAGGGAAAGGG - Intergenic
1123194834 14:106606340-106606362 GACAGCGCAGATGAGGGACAGGG + Intergenic
1202930434 14_KI270725v1_random:29301-29323 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1123421916 15:20142109-20142131 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1123422438 15:20143975-20143997 GCCAGTGCAGAGCCAGGAAAGGG + Intergenic
1123434966 15:20247974-20247996 GAGAGAGGAGAGCAGGGGAGGGG + Intergenic
1123442567 15:20302367-20302389 GCCAGTGCAGAGCCAGGAAAGGG - Intergenic
1123442640 15:20302695-20302717 GGCAGAGCAGGGCAAGGCAATGG - Intergenic
1123443165 15:20304526-20304548 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1123531144 15:21148649-21148671 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1123531666 15:21150515-21150537 GCCAGTGCAGAGCCAGGAAAGGG + Intergenic
1123888387 15:24749505-24749527 GACAGAGCAGAGCAGAGCAGAGG + Intergenic
1124003779 15:25780295-25780317 GCCAGAGCAGGGCTGGGAGAAGG + Intronic
1124126015 15:26938680-26938702 GAGGGAGCAGAGCCGAGAAATGG - Intronic
1124626011 15:31307956-31307978 CAGAGATCAGAGCAGGGAAGGGG + Intergenic
1124897140 15:33787989-33788011 GGAAGAGCAGAGCAGGAATATGG + Intronic
1125041735 15:35195759-35195781 GTCAGAGCAGAGCAGGGTCCTGG - Intergenic
1125179174 15:36862016-36862038 CAAAGAACAGAGCAGAGAAACGG - Intergenic
1125315322 15:38425394-38425416 AGCAGAGCAGGGCAGGGAGAGGG + Intergenic
1126087556 15:45023719-45023741 GACCGTGCAGAGCAGAGAAAGGG + Intronic
1126167526 15:45666734-45666756 GAGAGAGGAGAGGAGGGAAGGGG - Intronic
1126344204 15:47675817-47675839 TACAGGGCACATCAGGGAAAGGG - Intronic
1126413259 15:48393763-48393785 GACAGAGCACAGCAGGAGGAGGG - Intergenic
1126546174 15:49877018-49877040 GGAAGAAGAGAGCAGGGAAAAGG + Intronic
1126578096 15:50217376-50217398 AACAGAGGAGAGCAGGGACGAGG + Intronic
1127241139 15:57115946-57115968 GACAGAAGAGAGAAGGAAAAAGG - Intronic
1127447129 15:59074959-59074981 AAGAGAGGAGAGCAGGGTAATGG + Intronic
1127543665 15:59968618-59968640 GTCACAGCTGAGCAGGGAACAGG - Intergenic
1128055035 15:64693033-64693055 GACAGATTATAGCAGGTAAAAGG + Intronic
1128233896 15:66054112-66054134 AACTGAGCAGAGCTGGGAACTGG - Intronic
1128272554 15:66323784-66323806 GACAGAAGAGAGGAGGGAAAGGG - Intronic
1128338188 15:66802082-66802104 GACAGAGAGCAGCAGGGCAAGGG - Intergenic
1128568744 15:68718333-68718355 CACAGAGCACAGCAGGGGCAGGG - Intronic
1128947925 15:71842985-71843007 CTCAGAGCAGAGAGGGGAAAAGG - Intronic
1129004391 15:72360002-72360024 GACTGAGAACAGAAGGGAAATGG - Intronic
1129240860 15:74251360-74251382 GTCAGAGCACAGCAGGGACCAGG + Intronic
1129247716 15:74289924-74289946 GGGAGAGCAGAGCAAGGGAAGGG - Intronic
1129640349 15:77370453-77370475 GAAAGAGCAGAGAAGAAAAAGGG + Intronic
1130211170 15:81923917-81923939 GGCAGAGAGGAGCAGGGAATGGG + Intergenic
1130443647 15:83978780-83978802 GCCAAAGCAGAGTTGGGAAAGGG + Intronic
1130997300 15:88911146-88911168 GTCAGGGCAGAGGAGTGAAAAGG + Intronic
1131025221 15:89135866-89135888 GACAGAACAGAACAGGAAGAAGG + Intronic
1131254452 15:90852823-90852845 GACGCAGCAGGGCAGGCAAAAGG + Intergenic
1131533294 15:93213001-93213023 CACAGAGCTGGGCAGTGAAAAGG - Intergenic
1131796408 15:96021721-96021743 GACAGGGCAGGGCAGGGAGGTGG + Intergenic
1131833468 15:96368680-96368702 GATAGAGCAGAGCAGACAACGGG - Intergenic
1132338601 15:101064354-101064376 GTCAGGGCAGAGCAGGGAGCTGG - Intronic
1132457638 16:32987-33009 GCCAGGGGAGAGCAGGGAAGGGG - Intergenic
1132496415 16:265479-265501 GACAGAGCACAGGAGGGAAAAGG - Exonic
1132913361 16:2327511-2327533 GAGAGAGCTGTGCAGGGAAGGGG + Intronic
1133407468 16:5536686-5536708 TATATAGCAGAGAAGGGAAATGG + Intergenic
1133455049 16:5934823-5934845 GAAAGAGCAGGGCAGGGGACCGG + Intergenic
1133684732 16:8155280-8155302 GACAGTGAGGAGCAGAGAAATGG + Intergenic
1133819523 16:9224142-9224164 GAAAGAGGAGAAAAGGGAAAGGG - Intergenic
1133876717 16:9741680-9741702 GAAAGAGCTGAGTAGAGAAAAGG - Intergenic
1134057285 16:11178497-11178519 GTCCTCGCAGAGCAGGGAAATGG - Exonic
1134156106 16:11844600-11844622 GGTAGAGCAGAGCAGGGTACTGG - Intronic
1134357131 16:13492849-13492871 GAAAGAGCATTGCAGGGTAAAGG + Intergenic
1135004476 16:18806740-18806762 GACAGAGGAATGGAGGGAAAGGG + Exonic
1135392502 16:22105413-22105435 GACAGAGCAGAACAGGAACAGGG - Intronic
1135651179 16:24208067-24208089 TGCAGATAAGAGCAGGGAAATGG + Intronic
1135826735 16:25735339-25735361 CACAGAGCAGAGCAAAGAATTGG - Intronic
1136080728 16:27851032-27851054 GACAGAGCAGGGGAGCGAGAGGG + Intronic
1136229149 16:28876815-28876837 GAGACAGCAGAGCAAAGAAAAGG - Intergenic
1136508604 16:30722313-30722335 GACAGGGAAGAGGAGGAAAAAGG - Intronic
1136722627 16:32337489-32337511 GTCAGGCCAGGGCAGGGAAAGGG + Intergenic
1136723591 16:32341217-32341239 GGCAGAGCAGGGCAAGGCAATGG + Intergenic
1136751381 16:32638361-32638383 GAAAGAGCTGGGCAGGGAAGGGG + Intergenic
1136773882 16:32860990-32861012 GCCAGAGCAGGGCTGGGACAAGG - Intergenic
1136836468 16:33507426-33507448 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1136841923 16:33547262-33547284 GGCAGAGCAGGGCAAGGCAATGG + Intergenic
1136842008 16:33547590-33547612 GCCAGTGCAGAGCCAGGAAAGGG + Intergenic
1136842019 16:33547623-33547645 GACAAGGCAGAGCAGGGCCAGGG + Intergenic
1136896727 16:34000529-34000551 GCCAGAGCAGGGCTGGGACAAGG + Intergenic
1137295880 16:47092966-47092988 GACAAAGAAGAGTGGGGAAACGG - Intronic
1137554676 16:49463111-49463133 GACAGAGAAGAGAAGGAGAAAGG - Intergenic
1137584839 16:49658225-49658247 GACAGGGCAGTGCAGGGACGAGG + Intronic
1138350721 16:56344986-56345008 GACAGAGGACAGCAGGGGGATGG + Exonic
1138534325 16:57651944-57651966 GAGAGAGCAGAGACTGGAAAGGG + Intronic
1139098854 16:63740775-63740797 GACTGAACAGGACAGGGAAAAGG + Intergenic
1139325738 16:66151475-66151497 GACAGGGCAGGGAAGGGAAGGGG + Intergenic
1139365396 16:66429391-66429413 CCCAGAGCAGAGCAGGGCATAGG + Intronic
1139684536 16:68592582-68592604 GAAAAAGTAGAGCAGGGTAAGGG - Intergenic
1140013319 16:71158118-71158140 CACTGAGCAGCGCAGGGGAATGG + Intronic
1140045174 16:71436026-71436048 GAGAGAGAAGAGAAGGGAATCGG - Intergenic
1140075675 16:71696686-71696708 GACTGAGGAGTGCAGGGAAGAGG - Intronic
1140498645 16:75412641-75412663 GACGCTGCAGAGCAGGAAAAAGG - Exonic
1141030528 16:80583924-80583946 GACAGAGCAGAGACTGTAAAGGG + Intergenic
1141113271 16:81287746-81287768 GACAGAGCCCAGCAGGGACCAGG + Intronic
1141391931 16:83672065-83672087 CAGTGGGCAGAGCAGGGAAATGG + Intronic
1141443683 16:84044990-84045012 GTCAGCGCTGAGCTGGGAAAAGG + Intergenic
1141664631 16:85459572-85459594 GACCAGGCAGAGCATGGAAATGG - Intergenic
1141822662 16:86457747-86457769 GTCAGAGCAGGGCAGGCAGAGGG - Intergenic
1142005570 16:87688098-87688120 CCCCGAGCAGAGCAGGGAATGGG - Intronic
1142308012 16:89296316-89296338 GAGAGAGCAGGGCAGGGAGACGG - Intronic
1203002840 16_KI270728v1_random:176548-176570 GGCAGAGCAGGGCAAGGCAATGG - Intergenic
1203003804 16_KI270728v1_random:180275-180297 GTCAGGCCAGGGCAGGGAAAGGG - Intergenic
1203053515 16_KI270728v1_random:897616-897638 GAAAGAGCTGGGCAGGGAAGGGG + Intergenic
1203076302 16_KI270728v1_random:1123101-1123123 GCCAGAGCAGGGCTGGGACAAGG - Intergenic
1203134446 16_KI270728v1_random:1712954-1712976 GGCAGAGCAGGGCAAGGCAATGG - Intergenic
1203135412 16_KI270728v1_random:1716682-1716704 GTCAGGCCAGGGCAGGGAAAGGG - Intergenic
1203152088 16_KI270728v1_random:1847559-1847581 GGCAGAGCAGGGCAAGGCAATGG + Intergenic
1203152173 16_KI270728v1_random:1847887-1847909 GCCAGTGCAGAGCCAGGAAAGGG + Intergenic
1203152184 16_KI270728v1_random:1847920-1847942 GACAAGGCAGAGCAGGGCCAGGG + Intergenic
1142490567 17:275961-275983 GAAAGTCCAGAGCTGGGAAATGG + Intronic
1142693715 17:1621885-1621907 GAGAGAACAGAGCCGGGAAAAGG + Intronic
1143270069 17:5668818-5668840 GAAAGAGAAGAGGAGGGAGAAGG - Intergenic
1143377630 17:6476801-6476823 GTCAGAGCAGGGCAGGGACAGGG + Intronic
1143519927 17:7439317-7439339 GACACTGGAGAGGAGGGAAAGGG + Exonic
1143905857 17:10208618-10208640 GATAGAAAAGAGAAGGGAAAGGG + Intergenic
1143934328 17:10466574-10466596 AATAGTGCAGAGCAGGGAAGGGG - Exonic
1143938812 17:10516471-10516493 AACAGTGCAGAGCAGGGAAGGGG - Exonic
1144117117 17:12107243-12107265 TACAGAACAGAGCAGGATAAGGG + Intronic
1144244303 17:13347680-13347702 GTCAGGGCAGAGCAGGGAATTGG + Intergenic
1144780779 17:17807393-17807415 GACAGCGCAGTGCAGGGCAGAGG - Intronic
1144954702 17:19013203-19013225 GATGGAGAACAGCAGGGAAAAGG + Intronic
1145120666 17:20256591-20256613 TACAGAGCAGACCAGGGACCAGG - Intronic
1145932868 17:28698456-28698478 GACAGAGCAGAACAGGAGACAGG - Intronic
1146266727 17:31457853-31457875 GACAGAGCGGGGAGGGGAAAAGG - Intronic
1146742885 17:35301684-35301706 GACAGAGCACATGGGGGAAAGGG + Intergenic
1146754251 17:35412994-35413016 GACAGAGCATAGCAGAAAACAGG + Intronic
1146932953 17:36791117-36791139 GGCAGAGGAGAGCAGGGAGTGGG - Intergenic
1147200967 17:38800724-38800746 GAAAGAATAGAGAAGGGAAAAGG + Exonic
1147668442 17:42163381-42163403 GCCAGAGCAGAGCAGACAGAGGG + Intronic
1147961778 17:44171986-44172008 GACAGGGCAGGGCAGGGAGTGGG - Intronic
1148503024 17:48106439-48106461 AACAGAGCACAACAGAGAAAGGG + Intronic
1148647791 17:49229343-49229365 CACAGGCCAGAGCAGGGAGAAGG + Intronic
1148679592 17:49466077-49466099 AGCAGAACAGAGCTGGGAAATGG - Intronic
1148771843 17:50071962-50071984 TACACAGGAGAGGAGGGAAATGG - Intronic
1148870897 17:50658363-50658385 CTCAAAGCAGAGTAGGGAAATGG - Intronic
1148874957 17:50681577-50681599 GACAGAGGAGAGCAGAGAAATGG - Intronic
1149082935 17:52679628-52679650 GAAGGAGAAGAGAAGGGAAATGG + Intergenic
1149341735 17:55693710-55693732 GAGAGAGCAGAGCATGGTTAGGG - Intergenic
1149588782 17:57811886-57811908 GGAGGAGCAGAGCAGGGAAATGG + Intergenic
1150218325 17:63482405-63482427 GACAGAACAGGGCAGGGCCAGGG - Intergenic
1150221262 17:63497082-63497104 GGCAGGGCAGGGCAGGGCAAGGG - Intronic
1150223427 17:63509800-63509822 GCCAGGGCAGAGGAGGGAGAAGG + Intronic
1150729479 17:67679429-67679451 CACACAGCAGAGGAGGCAAATGG - Intronic
1151126758 17:71853676-71853698 AAAAGAGAAGAGCAGGGAGAAGG + Intergenic
1151354631 17:73551068-73551090 GACAGAGCAGAGGCAGGACAAGG + Intronic
1151373211 17:73663645-73663667 TACAGAGCAAAGCAGGGCAAAGG - Intergenic
1151393591 17:73804279-73804301 GTCAGCACAGAGCAGGGGAAAGG + Intergenic
1152132970 17:78488362-78488384 GGCAGAGGAGAGAATGGAAATGG - Intronic
1152223205 17:79080622-79080644 CCCAGAGCAGAGCGCGGAAAAGG - Intronic
1152328410 17:79656111-79656133 CACAGAGCAGAGCTGTGACAAGG - Intergenic
1152375218 17:79915402-79915424 GACAGAGCAGAGCTGGGGAGAGG + Intergenic
1152502858 17:80724749-80724771 GACACTGCAGAGGAGGGAACGGG - Intronic
1152555702 17:81052178-81052200 GGCAGACCAGGGCAGGGCAAAGG - Intronic
1152961666 18:83796-83818 GCCAGGGGAGAGCAGGGAAGGGG - Intergenic
1153826198 18:8877147-8877169 GTCAGAGCAGAGCAGGTAGCAGG + Intergenic
1154066317 18:11110539-11110561 GACACAGCAGAGCGGGGGAGTGG + Intronic
1154069900 18:11144730-11144752 GAAAGAGCAGAGCAGAAAAGGGG - Intronic
1154166112 18:12015581-12015603 GAGAGCCCAGAGCAGGGGAAGGG + Intronic
1154175914 18:12087213-12087235 GCCAGGGCAGAGCCAGGAAAGGG - Intergenic
1155237935 18:23840207-23840229 GACAAAGCCCAGGAGGGAAAGGG - Intronic
1155256368 18:24001470-24001492 GACAGAGGAGAGAAAGGAGATGG - Intronic
1155424222 18:25689464-25689486 AAGAGAGGAAAGCAGGGAAAAGG + Intergenic
1155464463 18:26120131-26120153 GACAGAACAGAGCCGGGACTGGG + Intergenic
1155468157 18:26162310-26162332 GGGAGGGCAGAGGAGGGAAAGGG - Intronic
1155778653 18:29801557-29801579 GAGAGAGAAGGGCAGGGAGAGGG + Intergenic
1155963568 18:32016170-32016192 GAGAGAGAGGAGAAGGGAAAAGG + Intergenic
1156370178 18:36466022-36466044 GAGAGGGCAGAGAGGGGAAAAGG - Intronic
1156473961 18:37394255-37394277 GGCAGCGCAGAGCAGGGAGAGGG + Intronic
1156545378 18:37958748-37958770 ATCAGAGCAGAGCAGCCAAAGGG - Intergenic
1156611712 18:38732643-38732665 GACAGACCAAAGTAAGGAAAGGG + Intergenic
1157600821 18:48892229-48892251 GGCCCAGCAGAGCAGGGACAGGG + Intergenic
1158471809 18:57743686-57743708 GAAAGAGCAGAGCTGGGGAAAGG + Intronic
1158541701 18:58362150-58362172 GACAGAGCAGGCAAGGGAACGGG + Intronic
1158650068 18:59276189-59276211 GACAGGGCAGAGGAGGACAAGGG + Intronic
1159053242 18:63441250-63441272 GAGAGAGAAGGGCAAGGAAACGG - Intergenic
1159116149 18:64115069-64115091 GAAAGAACACACCAGGGAAAGGG + Intergenic
1159309455 18:66688106-66688128 GACAGGACAGAGAAGGAAAAAGG - Intergenic
1159726777 18:71970634-71970656 GAAAGAGCACAGCATGGAAAAGG + Intergenic
1159833132 18:73303089-73303111 GACAGAGTAGAGCAAAGAGAAGG - Intergenic
1160005509 18:75066039-75066061 GACAGAGCTCAGCAGTGAGAAGG - Intergenic
1160032241 18:75272109-75272131 GACAGAGCAGAGAGGGGAGGGGG + Intronic
1160254235 18:77233922-77233944 GGCAGAGCAGGGAAGGGAAATGG - Intergenic
1160368528 18:78350230-78350252 CTCAGAACAGTGCAGGGAAAGGG + Intergenic
1160559833 18:79749328-79749350 CACTGAGCAGAGCAGGGGCAGGG - Intronic
1161654203 19:5503736-5503758 AACAGACAAGAGGAGGGAAAAGG - Intergenic
1162367548 19:10258530-10258552 CACAGGGCAGAGCAGGGGCAGGG + Intronic
1162607279 19:11719366-11719388 GGCTGAGGAGAGCAAGGAAAAGG + Intergenic
1162675401 19:12294691-12294713 GACACCGCACAGCCGGGAAATGG - Exonic
1163554771 19:17985595-17985617 AAAAGAGCAGAGCAGGGGAGGGG - Intronic
1163929530 19:20375745-20375767 GTCAGAGCAGAGCAGGTAGCAGG - Intergenic
1164143680 19:22496197-22496219 GGCACAGCAGAGGAGGGAAAGGG + Intronic
1164634963 19:29785431-29785453 AAGAGAACACAGCAGGGAAAGGG + Intergenic
1165258852 19:34596635-34596657 GACCCAGCAGGGCAGGGACAGGG + Intronic
1165281262 19:34799719-34799741 GACAGGGAAGAGAAAGGAAAAGG - Intergenic
1165879938 19:39035228-39035250 ATTAGAGCAGAGAAGGGAAATGG + Intergenic
1165883657 19:39061577-39061599 GAGATTGCAGAGCAGAGAAACGG + Intergenic
1165904951 19:39187985-39188007 GATAGAGAATAGCAGGGAAGGGG + Intergenic
1166513295 19:43425720-43425742 GAAAGAGAAGAGAAGAGAAAAGG + Intergenic
1166662515 19:44656666-44656688 GACAAAGCAGAGAAGGGAATGGG + Intronic
1166683905 19:44783785-44783807 AACAGAGGAAAGCAGAGAAAGGG - Intronic
1167093772 19:47362547-47362569 GCCAGCGCAGAGCAGCGGAAGGG + Exonic
1167103604 19:47418614-47418636 GACGGAGGAGAGCAGAAAAAAGG + Intronic
1167211401 19:48136131-48136153 GAGAGAGCAGGCCAGGGAAGGGG + Intronic
1167211779 19:48138029-48138051 GACAGAGCAGAGAAGGCCAAGGG + Intronic
1167744558 19:51342899-51342921 GACTGGGCAGAGGAGGGAGACGG - Intergenic
1202691654 1_KI270712v1_random:98555-98577 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1202692177 1_KI270712v1_random:100398-100420 GACAGAGCAGGGCAAGGAGATGG + Intergenic
925285978 2:2715912-2715934 GAGAGAGCATCGCAGGGAGAAGG - Intergenic
925970260 2:9101625-9101647 GAATGAGCAGAGCAGGGTAGAGG - Intergenic
926038842 2:9656568-9656590 GGCTGAGCACAGCAGGGAAAGGG - Intergenic
926477499 2:13343534-13343556 GACAGAGCAGAGGAAGAAACAGG + Intergenic
926646003 2:15290126-15290148 GAGAGAGAAGAGAAGAGAAAAGG + Intronic
927045629 2:19275385-19275407 GAGAGAGCAGAGCTGGGGAAAGG - Intergenic
927204181 2:20596719-20596741 GACAGAGTACAGCACAGAAAGGG - Intronic
927427689 2:22999076-22999098 GACAGTGCAGATCCAGGAAAAGG + Intergenic
927579205 2:24226232-24226254 CCCAGAGCAGAACAGGGAAAAGG - Intronic
927843566 2:26460223-26460245 GAGAGCGCAGAGGAGGGACAGGG + Intronic
927908563 2:26880261-26880283 GAAGGAGCAGAGCTGAGAAAGGG - Intronic
928324296 2:30307523-30307545 GACAGGCCAGAGTAGGGAAGGGG - Intronic
928744547 2:34396245-34396267 GAAAGAGCATTGCAGGCAAAAGG + Intergenic
929507233 2:42537616-42537638 GACAGGGAAGTGCTGGGAAATGG + Intronic
930531367 2:52592438-52592460 GACAGAGAGGAGGAGGGAGAGGG + Intergenic
930729962 2:54719457-54719479 AAAAGAGTAGAGCAGGAAAATGG + Intergenic
931127306 2:59292419-59292441 TATAGAGCAGAGCAGAGAAAAGG - Intergenic
931853108 2:66273786-66273808 AACAGAGAACAGCAGGGAAGGGG + Intergenic
932051525 2:68403332-68403354 GACAGAGCAGCTGAGGGAAGGGG - Intergenic
932441934 2:71743085-71743107 GACAAAGCAGAGAAGGGAGCCGG + Intergenic
932602457 2:73137486-73137508 GACAGAACACAGCAATGAAAAGG - Intronic
932606160 2:73167004-73167026 TACAGGACAGAGCAGGGCAACGG + Intergenic
932833257 2:75010845-75010867 GAGTGAGCAGAGGAGGGAACTGG + Intergenic
933384867 2:81597359-81597381 TACCGAGCAGAGCAGGGAAAGGG - Intergenic
933782411 2:85811572-85811594 CTAAAAGCAGAGCAGGGAAAAGG - Intergenic
933926268 2:87093447-87093469 TACAGGACAGAGCAGGGCAACGG - Intergenic
933954221 2:87353574-87353596 GACAGAGCAGGGCAAGGAGATGG - Intergenic
933954734 2:87355395-87355417 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
934058538 2:88272789-88272811 GAGAGACAAGAGCAGAGAAAGGG - Intergenic
934238416 2:90249794-90249816 GACAGAGCAGGGCAAGGAGATGG - Intergenic
934238930 2:90251621-90251643 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
934274264 2:91565089-91565111 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
934274775 2:91566916-91566938 GACAGAGCAGGGCAAGGAGATGG + Intergenic
934322451 2:91981991-91982013 GCCAGTGCAGAGCCAGGAAAGGG - Intergenic
934323051 2:91984172-91984194 GCCAGAGCAGGGCTGGGACAAGG - Intergenic
934460763 2:94212826-94212848 GCCAGTGCAGAGCCAGGAAAGGG - Intergenic
934461364 2:94214958-94214980 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
935129436 2:100250392-100250414 CACACAGCAGAACAGTGAAAAGG + Intergenic
935225156 2:101046654-101046676 GAGAAAGAAGAGCAGGAAAAGGG + Intronic
935289922 2:101601451-101601473 GAGAGAGCAGAGGTGGGCAAGGG - Intergenic
935829371 2:106984482-106984504 CAAAGAGCAGAGCAGAAAAATGG + Intergenic
936147320 2:109988648-109988670 GGCGGGGCAGATCAGGGAAATGG - Intergenic
936173580 2:110198543-110198565 GGGAGAGCAGAGAGGGGAAAAGG - Intronic
936197372 2:110382836-110382858 GGCGGGGCAGATCAGGGAAATGG + Intergenic
937014194 2:118588676-118588698 CACAGACCAGGGCAGGAAAATGG + Intergenic
937052259 2:118902045-118902067 GAAGGAGCAGATCAGGGAGAAGG - Intergenic
937714318 2:125014249-125014271 GACAGAGAAGAGCAAGGAGTGGG + Intergenic
937869262 2:126776272-126776294 GCCAGTGCAGAGCTGGGAAGAGG + Intergenic
938240767 2:129740994-129741016 GGCAGAGCTGGGCAGGGAATTGG + Intergenic
938599670 2:132824280-132824302 GGCAGAGCAGAGCAGAAAGATGG - Intronic
938949197 2:136241598-136241620 CACAGAGCAGAACATGCAAAAGG - Intergenic
938957684 2:136314525-136314547 GAGAAAGAAGAGAAGGGAAAGGG - Intergenic
939356925 2:141114547-141114569 GACAGAGGAGAGAAGAGAAGGGG - Intronic
939436070 2:142179845-142179867 AACACAGCAGACCAGGGCAAGGG + Intergenic
939567138 2:143798515-143798537 TTCAGAGCAGAGAAGGGAAAAGG + Intergenic
939567338 2:143800635-143800657 TACAGAGCAGAGCCGGTGAAGGG - Intergenic
940030784 2:149259152-149259174 AACAGAACAGAGTGGGGAAAGGG + Intergenic
940149746 2:150586419-150586441 GACAGAGAAGAGAAGAGAAGCGG + Intergenic
940382858 2:153035934-153035956 CACAGAGCAGAGGAGGCATAAGG - Intergenic
940405008 2:153291505-153291527 CACTGACCAGAGCAAGGAAAGGG - Intergenic
940633309 2:156265357-156265379 TACTGAGCAGGCCAGGGAAATGG - Intergenic
941116849 2:161481524-161481546 GAAGGAGAAGAGAAGGGAAAAGG + Intronic
942050277 2:172133661-172133683 GAAACAGAAGAGCAAGGAAATGG - Intergenic
942248897 2:174031417-174031439 AACAAAACAGAGGAGGGAAAGGG + Intergenic
943349474 2:186780428-186780450 GAAGGAGAAGAGGAGGGAAAAGG + Intergenic
943388492 2:187231968-187231990 ATAAGAGAAGAGCAGGGAAAAGG + Intergenic
943723838 2:191232830-191232852 TAGACAGCAGAGCAGGGGAAAGG - Intergenic
944185311 2:196941564-196941586 GAGAGAGCAGGACAGGAAAAGGG + Intergenic
944681021 2:202076845-202076867 TGCAGAGCAGAGCAGGGGAAGGG - Intronic
945254246 2:207790746-207790768 GACAGAGTGGAGCAGGGAGAGGG + Intergenic
945408485 2:209480922-209480944 GATGAAGCAGAGCAGGGAAATGG - Intronic
945474591 2:210266019-210266041 GAAAGAGCAGAACAAGGAACTGG - Intergenic
945657262 2:212640320-212640342 GACAGAGAATAACAGGGAAAAGG - Intergenic
945676159 2:212857952-212857974 GTCAGGAGAGAGCAGGGAAAAGG - Intergenic
945903812 2:215568516-215568538 TACAGAGAAGAGCAGGGACAAGG - Intergenic
946161989 2:217841067-217841089 GACAGAGGAGAGAAGGAAGAAGG + Intronic
946181018 2:217948955-217948977 GTCAGGGCAGAGGATGGAAAGGG + Intronic
946204400 2:218093115-218093137 GAAAGAGCATCCCAGGGAAAAGG + Intergenic
946546482 2:220749570-220749592 GACAGAACAGAACAGGGCAGGGG + Intergenic
946971722 2:225100843-225100865 GACAGAGCAAGGCAGAAAAAGGG - Intergenic
947289190 2:228553013-228553035 CACAGATGAGAGCAGGGGAATGG + Intergenic
947482647 2:230515324-230515346 CTCAGAGCAGAACAGGAAAAAGG - Intronic
947857082 2:233331357-233331379 GAAAGGGCTGAGCAGGGGAAAGG + Intronic
948107482 2:235427279-235427301 GACCCAGCAGAGCAAGCAAAGGG + Intergenic
948584246 2:239009115-239009137 GACACAGCAGAGCGGGAAAGAGG - Intergenic
948684129 2:239659456-239659478 CACAGAGGAGAGCAGAGGAAGGG - Intergenic
1169578446 20:6992007-6992029 CACAGGGCAGAGAAGAGAAAAGG + Intergenic
1169613122 20:7406472-7406494 GAGAGAGAAGAGAAGAGAAAGGG - Intergenic
1169709606 20:8546913-8546935 GAAACAGCAGAGCAGAGATAAGG - Intronic
1170358211 20:15516039-15516061 GAGAAAGCAAAGCAGGCAAACGG - Intronic
1170783190 20:19445483-19445505 GGCAGTGCAGAACAGGGAATTGG + Intronic
1171160492 20:22917815-22917837 CAAAGAGCAGAGTATGGAAAGGG - Intergenic
1171344838 20:24458359-24458381 GAAAGAACAGAGCAGGGAGAAGG - Intergenic
1171368310 20:24642401-24642423 GACAGAGTACAGCATGGGAAGGG - Intronic
1171978867 20:31612866-31612888 GGCAGAGAAGAGCTGGGAAGCGG + Intergenic
1172096118 20:32461284-32461306 GACAGAGTGGAGCAGGAAGAGGG - Intronic
1172623857 20:36336434-36336456 GGCATAACAGAGCAGGGAGAAGG - Intronic
1172718696 20:36983108-36983130 AGCAGAGGAGAGAAGGGAAAAGG - Intergenic
1173095938 20:40028303-40028325 GACAGAGCACTACAGGAAAATGG + Intergenic
1173315777 20:41941823-41941845 AAAAGAGCAGAGCTGGGAAAGGG - Intergenic
1173688599 20:44941591-44941613 CACAGAGCAGAGTAGACAAAGGG - Intronic
1173764340 20:45593650-45593672 GACAGAATAGAGCAAAGAAAGGG - Intergenic
1173856926 20:46256266-46256288 GAGAGAGCAAAGCAGAGTAAGGG + Intronic
1173927223 20:46789782-46789804 CACAGAGCAGAGCCAGGAAAAGG - Intergenic
1174181748 20:48679498-48679520 GACGGGGCAGGGCAGGGTAATGG + Intronic
1174758232 20:53181067-53181089 GACAGCGAAGAGCTGGGGAAAGG - Intronic
1174946452 20:54991540-54991562 TACAAAGGAGAGAAGGGAAATGG - Intergenic
1175309919 20:58004734-58004756 GAAAGAAAAGAGAAGGGAAAGGG - Intergenic
1175426810 20:58872700-58872722 GCCAGAGGAGAACAGGGACAAGG + Intronic
1175674426 20:60934531-60934553 GACAGAGCTGAGCATGGATGTGG - Intergenic
1175746560 20:61460958-61460980 GACAGGGCAGCCCAGGGAGAGGG - Intronic
1175766139 20:61594186-61594208 GACTGACCTGAGCAGGGGAAAGG + Intronic
1176592447 21:8657897-8657919 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1177315883 21:19460163-19460185 GAAAGAGCTGATAAGGGAAATGG + Intergenic
1177711807 21:24785426-24785448 TACAGAGTAGAGCAGCAAAAGGG + Intergenic
1177901960 21:26927545-26927567 GTCAGAGCAGAGCATGAGAAAGG + Intronic
1178035514 21:28578305-28578327 ATCAGAGCAGAGCAGGAGAAGGG - Intergenic
1178796392 21:35748387-35748409 GTTAGAGGAGAGGAGGGAAAGGG + Intronic
1178898087 21:36577070-36577092 GACAGAAAAGAACAGGGAAGTGG + Intergenic
1179044154 21:37830033-37830055 GACACAGGAGAGCAGGAAAGTGG - Intronic
1179044546 21:37832681-37832703 TACAGAGCTGAGCAGGTTAAGGG - Intronic
1179150616 21:38805773-38805795 GAGAGAGAAGAGGAGGGGAAGGG - Intronic
1179180437 21:39040249-39040271 GCCAGAGGAGGGCACGGAAATGG + Intergenic
1179403443 21:41105945-41105967 GACAGTGCAGGGCAGGGAACTGG + Intergenic
1179597046 21:42449937-42449959 GACAGAGCTGGGCTGGAAAAGGG + Intergenic
1180019263 21:45110916-45110938 CACAGAGCAGAGAATGGGAAAGG - Intronic
1180115852 21:45704477-45704499 GCCAGGGGAGAGCAGGAAAATGG - Intronic
1180275306 22:10635044-10635066 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1180550246 22:16531999-16532021 GTCAGGCCAGGGCAGGGAAAGGG - Intergenic
1180665829 22:17511332-17511354 GAGAGAGCAGGGGTGGGAAAAGG - Intronic
1180724750 22:17938463-17938485 AACACAGCAGCGTAGGGAAAAGG - Intronic
1180829004 22:18888244-18888266 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
1180890114 22:19281662-19281684 GACAGAGCAGTGCACTGAAGTGG + Intronic
1181006153 22:20014664-20014686 GACAGGGTAGAGCTGGGATAGGG - Intronic
1181038550 22:20181436-20181458 GGCAGGGCAGGGCAGGGAGAGGG + Intergenic
1181354880 22:22291793-22291815 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1181355488 22:22293941-22293963 GCCAGTGCAGAGCCAGGAAAGGG + Intergenic
1181525686 22:23484397-23484419 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
1181890668 22:26060426-26060448 TGCAGAACAGAGCAGGGAAAAGG - Intergenic
1181903555 22:26174710-26174732 GAGGGAGCAGGGCAGGGAATAGG + Intronic
1182144758 22:27990604-27990626 GGCAGAGCAGAGAAGGGGACGGG + Intronic
1182158716 22:28100590-28100612 GACAGAGGGGAGCAAGGATAAGG - Intronic
1182737857 22:32543805-32543827 GCCAGAGCAAAGAAGGAAAAAGG - Intronic
1182946783 22:34331632-34331654 GACTGAGCAGAGGAGGAAATGGG - Intergenic
1183355231 22:37355279-37355301 GGAAGAGCAGAACAGGCAAACGG - Intergenic
1183553469 22:38506874-38506896 GACAGAGCAGCGAAAGGCAACGG - Intronic
1184263888 22:43336278-43336300 GACAGAGGAAAGCAGAGACAAGG - Intronic
1184635583 22:45826201-45826223 GACAGATTTGAGCAGGGAGAAGG + Intronic
1184857195 22:47152786-47152808 GGCAGAGCAGAGGAGGGACGGGG + Intronic
1185219656 22:49622955-49622977 CATAGAGCAGAGCAGGGAACGGG + Intronic
1203279095 22_KI270734v1_random:114232-114254 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
949573065 3:5311930-5311952 TACAGAACAGAGCAGGGAAGCGG + Intergenic
949662781 3:6300030-6300052 GACAGACCACAGCAGGAAAGAGG + Intergenic
949741416 3:7238811-7238833 GGGAGAGGAGAGGAGGGAAAAGG - Intronic
949992878 3:9593476-9593498 CAAAGAACAGAGCAGGGTAAAGG - Intergenic
950164576 3:10784426-10784448 GAGAAACCACAGCAGGGAAAGGG + Intergenic
950262560 3:11553522-11553544 GACTGAGCAGTGCAGGGCAGGGG - Intronic
950719136 3:14870195-14870217 GGCAGAGGAGAGCAGTGCAAGGG + Intronic
950921683 3:16701064-16701086 TAAAAAGAAGAGCAGGGAAAGGG + Intergenic
950963754 3:17131727-17131749 GACAGAACAGAGTTGGGAAGTGG + Intergenic
951035520 3:17927838-17927860 GGCAGAGTAGAGCAAGGAGATGG + Intronic
951044671 3:18024802-18024824 TACAGGGCAGAGCAGGACAAAGG - Intronic
951149583 3:19272778-19272800 GAAAAAGGAGAGCAGGGTAAAGG - Intronic
951681039 3:25294881-25294903 TAAAGACCAGAGCAGGGTAAAGG - Intronic
952644814 3:35642361-35642383 GACAGAGCAGTGCATGGTTATGG + Intronic
952977609 3:38709401-38709423 GCCAGAGCTGGGCAGGGAACAGG + Intronic
953304034 3:41809604-41809626 GACACTGCAGAGCAGGGGAGAGG - Intronic
953995113 3:47513529-47513551 GACAGGGCGGAGCAGGTAAGAGG - Exonic
954294002 3:49664174-49664196 GGCAGAGAAGAGCAGGAAAGGGG - Intronic
954404230 3:50336656-50336678 GACAGGCCAGAACAGGGAAGAGG + Intronic
954412250 3:50375911-50375933 GACAGAGCAGAGGAGTGTAGGGG - Intronic
954697465 3:52435405-52435427 CACAGAGAAGGGCAGGGAACAGG + Exonic
954763566 3:52895304-52895326 GACAGAGCAGGCCAGGGCAATGG - Intronic
955058512 3:55476380-55476402 GGCAGAGCACATCAGGGGAATGG + Intronic
955531743 3:59880258-59880280 GAGAGAGAAGAGCAGGCACAAGG - Intronic
955687819 3:61563079-61563101 AGCAGAGCAGCGGAGGGAAAGGG - Intronic
955768098 3:62365917-62365939 GAGAGGGAAGTGCAGGGAAAAGG + Intergenic
955898222 3:63723958-63723980 GGCTGAGTACAGCAGGGAAAGGG - Intergenic
955957945 3:64309801-64309823 GTTAGAGCAGAGAAGGGAAGGGG - Intronic
956034808 3:65079450-65079472 GGCAGAGCAGGGTGGGGAAATGG - Intergenic
956084168 3:65591949-65591971 GAAAAAGCAGAGCAGAGTAAGGG - Intronic
956272203 3:67459915-67459937 AACAGTGAGGAGCAGGGAAAAGG + Intronic
956366603 3:68510114-68510136 GAAAGAGCACTGCAGGGAGAGGG - Intronic
956727998 3:72172359-72172381 CACAGAGCAGAGCAGCTAAAGGG - Intergenic
957011184 3:75008174-75008196 GACAGAGCACATGAGGGAAGGGG - Intergenic
957027156 3:75194968-75194990 GACAGAGTAGAGAAGGGACTTGG + Intergenic
957053998 3:75430654-75430676 GACAGTGCAGGGCAGGAAGAAGG - Intergenic
957683427 3:83469709-83469731 GACAGAGGAGAGGAGAGGAAAGG + Intergenic
957979635 3:87492208-87492230 AACTGAGCAGAGTACGGAAAAGG + Intergenic
959146971 3:102558591-102558613 GAATGAGCAGAGCAGGTGAATGG - Intergenic
959565947 3:107833426-107833448 AACAGAACAGAACAGGAAAATGG + Intergenic
960122200 3:113958352-113958374 GACAGAGCCGAGCTAGGAGAGGG - Exonic
960179220 3:114555038-114555060 GACAGAGAAGTGCAGACAAAGGG + Intronic
960196285 3:114772409-114772431 GAGAGAGCCCAGCTGGGAAAAGG - Intronic
960263450 3:115593839-115593861 GTCATGGCAGAGAAGGGAAAAGG - Intergenic
960703312 3:120458360-120458382 GAAACAGCAGAGCTGGGAAAGGG + Intergenic
960869339 3:122233255-122233277 GACATAGCAGAGAAGGAGAACGG - Intronic
961226280 3:125250820-125250842 GACAGAGAGGAGCAGGAGAAAGG - Intronic
961493899 3:127276621-127276643 GAGAGGACAGAGGAGGGAAAAGG - Intergenic
961505122 3:127365544-127365566 GACAGAGCAGGGCTGGGTCAGGG - Intergenic
961666960 3:128498529-128498551 GACAGAGAAGAGCAGGGGACAGG - Intergenic
961701157 3:128745688-128745710 GACACAGAAGAGCAGGGAAGGGG + Intronic
961714708 3:128850308-128850330 GACAGAGAAGAGCAGGGCAGGGG + Intergenic
961887668 3:130107031-130107053 GACAGTGCAGGGCAGGAAGAAGG - Intronic
962084839 3:132179907-132179929 GAAAGAGCAGAGAAATGAAAGGG - Intronic
962370434 3:134816931-134816953 GACCCAGCAGAGCAAGGAAAGGG + Intronic
962768612 3:138592123-138592145 GAGAGAGAAGAGAAGGGAAGAGG - Intronic
962865886 3:139447855-139447877 GAGAGAGGAAAGCAGGGAAGAGG - Intergenic
962891321 3:139675671-139675693 GACAGGGCAGAGGCGGGAGAGGG - Intronic
962930097 3:140028057-140028079 GTCAGAGCAGGTCAGGGAAAAGG + Intronic
962933990 3:140062610-140062632 GCCAGGGCAGGGCAAGGAAAAGG - Intronic
962939982 3:140117008-140117030 GGAACAGCAGAGCAGGGGAAAGG - Intronic
963068414 3:141281952-141281974 GAGAGAGCCGGGCAGTGAAAGGG + Intronic
963085105 3:141429182-141429204 CAAAAAGCAGAGCAGGGCAAGGG + Intronic
963445059 3:145395297-145395319 GGCAGTGCAGAGAAGGGAAGGGG + Intergenic
963699525 3:148607123-148607145 TACAGAGCAGAGCAAGGGCAAGG + Intergenic
963807545 3:149739943-149739965 GAGAGAGCCTAGCAGGGAATAGG - Exonic
964398635 3:156274317-156274339 TACAGAGCAGGGCAGGAACAGGG - Intronic
964424025 3:156533366-156533388 GACAGGGAAGAGCAGTGGAAAGG + Intronic
964627065 3:158769942-158769964 GAAAGAGCAAACCAGGAAAAAGG - Intronic
965360720 3:167735218-167735240 GACAGAGCAGAGGAAGGAAGGGG + Intergenic
965389439 3:168086898-168086920 GACAGCACAGAGCAGTGAAGGGG + Intronic
965627559 3:170696794-170696816 GAAAGAGCTGGGCAGAGAAAGGG + Intronic
966621567 3:181969701-181969723 GACAGAGAAGAGTAGATAAAGGG + Intergenic
967037566 3:185659282-185659304 GAGAGAGAGGAGCAGGGAACAGG + Intronic
967181449 3:186909141-186909163 GACAGAGCACCTGAGGGAAAGGG - Intergenic
967833580 3:193942741-193942763 GTGAGAGCAGAGCATGGAGATGG + Intergenic
967839419 3:193992818-193992840 GAGAGAGGAGAGAGGGGAAAGGG + Intergenic
968627644 4:1634359-1634381 CACAGAGGAAAGCAGGGAAGGGG + Intronic
969431815 4:7159519-7159541 AACTGAGCAGTGCAGGGAGAGGG - Intergenic
969477191 4:7428367-7428389 GACAGAGCCCAGCATGGAACAGG - Intronic
969530395 4:7727158-7727180 GACAGAACACACCAGGGACAAGG + Intronic
970266873 4:14297977-14297999 GAGTGAGAAGAGAAGGGAAAGGG + Intergenic
970650316 4:18170404-18170426 CACAAAGCAGAGCAGGTAGAAGG + Intergenic
970827186 4:20290101-20290123 AACAGAGTAAAGCAGGGATATGG - Intronic
970946959 4:21705589-21705611 GAAACAACAGAGCAGGCAAAGGG + Intronic
971392342 4:26197805-26197827 GAGAGAGGAGAGGAGGGGAAGGG + Intronic
972213728 4:36870749-36870771 TAAAGAGCAGAGCAAGGGAATGG + Intergenic
972232197 4:37087123-37087145 GAAAGAGCATGTCAGGGAAAGGG + Intergenic
973249728 4:48048343-48048365 ATCTGAGTAGAGCAGGGAAAGGG - Intergenic
973335704 4:48954364-48954386 GAGAGAGCAGAGAAGGGGAGGGG - Intergenic
974002201 4:56522864-56522886 GACAGAGAAGAGAATGGAGAGGG - Intronic
975418530 4:74135012-74135034 GAGAGAGCAGAGCAGGAGCAAGG + Intronic
975752393 4:77537480-77537502 TACAGAGCAAAGCAGAGAATAGG + Intronic
976330411 4:83825015-83825037 GACAGAGCAAAATATGGAAAAGG - Intergenic
978417586 4:108493120-108493142 GACAAAGCAGAGCAGTGAGCCGG + Intergenic
979059147 4:116033345-116033367 GACAGAGAAAAGGAGAGAAAAGG - Intergenic
979218397 4:118193343-118193365 AACAGGGCAGAGTAGGGAGACGG + Intronic
979545935 4:121939937-121939959 GACAGAGAAGAGCAGGGGAAAGG + Intronic
979679836 4:123447353-123447375 GAGAGGGAAGAGGAGGGAAAGGG - Intergenic
979747484 4:124235469-124235491 GACAGAGCAGAAGAGAGAATTGG + Intergenic
979918265 4:126467171-126467193 GAAAGAGGAGAGAAGAGAAAAGG + Intergenic
979957122 4:126968025-126968047 GAGAGAGGAGAGAAGGCAAAAGG - Intergenic
980300281 4:130982337-130982359 TATAAAGCAGAACAGGGAAATGG - Intergenic
980665811 4:135932846-135932868 GACATAGGAGAGAAGGTAAAAGG - Intergenic
981162525 4:141515543-141515565 GTCAGAGGAGAGCAGGGGAAGGG + Intergenic
981310663 4:143294869-143294891 CACAGTGCAGAGCAGGGCATCGG - Intergenic
981578612 4:146230139-146230161 CTCAGAGCAGGGAAGGGAAATGG + Intergenic
981807611 4:148734950-148734972 GACAGAGAAGAGAAGAGACAAGG - Intergenic
982319747 4:154065855-154065877 GACGGAGAAGAGAAGGGAAAAGG - Intergenic
982355212 4:154459545-154459567 GGCAGAGCAGGGCAAGGGAAGGG - Intronic
982355214 4:154459550-154459572 GGCAAGGCAGAGCAGGGCAAGGG - Intronic
982539416 4:156649387-156649409 AACATTGCAGAACAGGGAAAAGG + Intergenic
982977241 4:162079347-162079369 GATAGAGTAGAGAAGGGAAGAGG + Intronic
984002194 4:174262993-174263015 CAGAGAGCAGAGCAGGAGAATGG - Exonic
985385351 4:189440698-189440720 GACAGAGGAAAGCAGGGAAGAGG - Intergenic
986971860 5:13346204-13346226 GACAGAGGAGGGCAGGGAGTGGG + Intergenic
987140153 5:14937677-14937699 GCCAGTGCAGAGGAGGGCAATGG + Intergenic
987301351 5:16600453-16600475 GACAGAAGAGAGCAGGGCAGAGG + Intronic
987315572 5:16720105-16720127 GTCAGGGCAGAGCAGGGACTGGG - Intronic
987683900 5:21171809-21171831 GGGAGAGGAGGGCAGGGAAAGGG + Intergenic
988528685 5:32008681-32008703 GACACAGCAGTGAATGGAAATGG + Intronic
989008703 5:36844908-36844930 GAAAGAGCAGATCAGGAGAAAGG - Intergenic
989152833 5:38317321-38317343 GAGGGAGTAGGGCAGGGAAAGGG + Intronic
989188048 5:38643659-38643681 AACAGAGCAAAGCCAGGAAAAGG - Intergenic
989692169 5:44157867-44157889 GAGAGGACAGAGGAGGGAAAAGG - Intergenic
990112274 5:52341961-52341983 CACAGAGCAGAGCAGCAGAAAGG - Intergenic
990316343 5:54586361-54586383 GACAGAGCAGAGCTGGCCATGGG + Intergenic
990558285 5:56957985-56958007 GCCAGAGCAGAGCAGGAAAAGGG + Intronic
990862588 5:60343579-60343601 TACAGAGCAGAGAAGGAGAAAGG - Intronic
990877747 5:60505403-60505425 GACAGAGCTGGGTAGAGAAAAGG - Intronic
991107601 5:62861962-62861984 GCCAGAGCAGAGCAGATATAGGG - Intergenic
991495287 5:67220167-67220189 GAAAGAGCAAAGCACAGAAATGG + Intergenic
992576292 5:78117056-78117078 GCCAGAGCAGATCAGGCAAGAGG - Intronic
992732420 5:79686073-79686095 GAGAAAACAGAGCAGGAAAATGG - Exonic
993054810 5:82969431-82969453 GTCAGGGCAGAGCAGGTAATTGG + Intergenic
993183177 5:84581789-84581811 TAGAGAGCAAAGCAGGAAAAGGG - Intergenic
993202859 5:84840230-84840252 GGCAGAAGAGAGAAGGGAAAGGG - Intergenic
993434507 5:87875028-87875050 TTCAGAACAGAGCAAGGAAATGG - Intergenic
994099351 5:95877163-95877185 CCCAGAGCAGAGCAGGGCAATGG + Intergenic
994107711 5:95964860-95964882 GACAGTTCAGTGCAGGAAAAAGG + Intergenic
994273296 5:97807469-97807491 GAGAGAACAGAGGAGGAAAAAGG + Intergenic
994600247 5:101893531-101893553 ATCAGAGCAGAGCAGGAGAAAGG + Intergenic
996146175 5:119979833-119979855 GACACATGAGAGCAGGGCAAAGG + Intergenic
996262534 5:121490942-121490964 GACAAAGTAGAGCAGATAAAGGG - Intergenic
996304857 5:122035453-122035475 GACAGAGCACAGAAGGAAGATGG - Intronic
996387528 5:122925069-122925091 GAGAGGGAAGAGGAGGGAAAAGG - Intronic
996561044 5:124829792-124829814 GTCAGAGCAGAGGTGTGAAATGG - Intergenic
996749965 5:126878411-126878433 GACAGAGAAGAGCAAGGGAGAGG + Intronic
996762966 5:127004319-127004341 AACAGAGCAGCACACGGAAATGG - Intronic
997264460 5:132487014-132487036 GAAAGACCAGAGCAGGAACAAGG - Exonic
997362779 5:133305789-133305811 GGGAGAGCAGCACAGGGAAAGGG - Intronic
997408907 5:133675245-133675267 GAAAGAGCTGGGCATGGAAATGG + Intergenic
997426413 5:133805706-133805728 AACTGAGCAGAGCAGGGCACAGG - Intergenic
997613193 5:135229442-135229464 TACAGAGCCAAGCAGGGGAAGGG - Intronic
997848304 5:137308316-137308338 TACAGAGCAGAGCAGAGGAGAGG - Intronic
998046746 5:138993191-138993213 GACATAGAAGAGGAGGTAAAGGG - Intronic
998092544 5:139379793-139379815 GACATAGCAGAGCAGCCACACGG + Exonic
998415912 5:141945896-141945918 GACAAAGGAGGGAAGGGAAATGG + Intronic
999665029 5:153904081-153904103 CACAGAGCACAGCAGAGATAAGG + Intergenic
999724966 5:154429571-154429593 GAAAGAGGAGAACAGGGAGAGGG + Intergenic
999796420 5:154993698-154993720 GAGAGAGTAGAGGAGGGGAAAGG - Intergenic
1000024299 5:157345613-157345635 CCCAGAGCAGAGGAGGGAGAAGG - Exonic
1000263359 5:159611399-159611421 GAAAGTGCAGGGAAGGGAAAGGG - Intergenic
1000460901 5:161517025-161517047 CACAGAGCAGAACAGGGCATAGG - Intronic
1000501844 5:162061805-162061827 GAAAGAGAAGAGAAGAGAAAAGG + Intergenic
1001052872 5:168426786-168426808 GGCAGACCGGAGCAGGGCAAGGG - Intronic
1001329227 5:170750626-170750648 CTCAGAACAGAGCAGGGAAGAGG - Intergenic
1001993143 5:176133807-176133829 GAAAGAGCTGGGCAGGGAAGGGG + Intergenic
1002097203 5:176838608-176838630 GACAGAGCAGAACAGCGAGCAGG - Intronic
1002462778 5:179383981-179384003 CACAGAGCAGAGAAGGGGCAGGG - Intergenic
1002537304 5:179883894-179883916 GACCGACCACAGCAGGGGAAAGG - Intronic
1002721664 5:181265165-181265187 GACAGCGCAGGGCAAGGAGAAGG - Intergenic
1003847157 6:10185325-10185347 GACAGAGAGGAGGAGGGAAAAGG - Intronic
1003855967 6:10275503-10275525 TGCAGAGGAGGGCAGGGAAAAGG + Intergenic
1004506183 6:16248732-16248754 GACAGAGCAGAGCAGGGAAAGGG - Intronic
1005589755 6:27311658-27311680 GAGAGTGCAGAAAAGGGAAAGGG - Exonic
1006256303 6:32835368-32835390 GACAGAGCAGGTGAGGAAAAAGG + Intronic
1006993043 6:38231960-38231982 GAAATAGGAGAGAAGGGAAAAGG + Intronic
1007089037 6:39170438-39170460 AACAGAGCAGAGCAGGGAAGTGG + Intergenic
1007189715 6:40003207-40003229 GAGAGGGCATAGCAGAGAAATGG - Intergenic
1007376228 6:41458532-41458554 GGCAGAGGAGAGCAGTGACATGG - Intergenic
1007411357 6:41663802-41663824 GGCAGAGCAGATCAGACAAAGGG + Intergenic
1007923145 6:45628848-45628870 TATAGAGAAGAGCCGGGAAATGG + Intronic
1008475082 6:51927734-51927756 GAAAGAGCAGAGCAGAGAAAGGG + Intronic
1008670726 6:53765969-53765991 GAGAGAGGAGACCAGTGAAAAGG - Intergenic
1010192718 6:73210058-73210080 GTCAGAGCAGAGCATGGCCATGG - Exonic
1010196257 6:73242508-73242530 GTCGGAGCAGAGCATGGACATGG - Exonic
1010291540 6:74143306-74143328 TACAGAGGAGAGAAGTGAAATGG - Intergenic
1010298723 6:74232354-74232376 GAGAGAGGAAAGGAGGGAAAGGG - Intergenic
1010799884 6:80162904-80162926 GAGAGAGAAGAGAAGAGAAAGGG - Intronic
1011217641 6:85021850-85021872 GAGAGAGCAGAGAGGAGAAATGG - Intergenic
1011509166 6:88080978-88081000 TACAGAGCAGAATAAGGAAAAGG - Intergenic
1011746517 6:90412534-90412556 GAGAGAGCAGAGGTGGGAAATGG + Intergenic
1011772025 6:90683840-90683862 CACAGAGCAATGCATGGAAATGG + Intergenic
1012158853 6:95857150-95857172 GACAGATAAGAGCAGAGGAAAGG - Intergenic
1012227879 6:96725430-96725452 GGCAGAGAAGAGTAGGGCAAAGG - Intergenic
1012734963 6:102927559-102927581 GAAAGAGCAGAGCTGGACAAAGG + Intergenic
1013564256 6:111341712-111341734 GACGGAGCACAGGAGAGAAAGGG + Intronic
1013719103 6:113001140-113001162 GAGAGAGAAAAACAGGGAAAGGG - Intergenic
1014432474 6:121387570-121387592 CACAGAGCAGAGCAGAGGATTGG - Intergenic
1015152443 6:130054807-130054829 GAAAGAGTAGAGAAGGGAACTGG + Intronic
1015796048 6:137012424-137012446 GACAGAACAGATTTGGGAAATGG + Intronic
1015802118 6:137070668-137070690 GACAGAGCACCTGAGGGAAAGGG + Intergenic
1015810752 6:137159756-137159778 GGAAGAGCAGACCAGGAAAAGGG - Intronic
1016638507 6:146322499-146322521 GACAGAGCACCTCAGGGAAGGGG - Intronic
1016996594 6:149965623-149965645 GTCAGAGCAGAGCAGGGCTGTGG - Intronic
1017250072 6:152270948-152270970 GAGAGAACAGAGCAGTGAAGAGG + Intronic
1017545934 6:155450695-155450717 GACAGAGCATTTCAGGCAAAGGG + Intronic
1017821233 6:158050398-158050420 GAATGACCAGAGCAGGGAATGGG - Intronic
1017899702 6:158708662-158708684 CACAGAGCAGAGTTGGGGAAGGG - Intronic
1018770865 6:166970655-166970677 GGCTGAGCTGAGCAGTGAAAAGG + Intergenic
1018787871 6:167122118-167122140 GATAGAGCAGAGCTGGGCAGCGG + Intergenic
1018842006 6:167524197-167524219 GAGAGAGAAGAGCAGGGATGGGG + Intergenic
1019106573 6:169672581-169672603 GACAGTGAATAGCAGTGAAATGG - Intronic
1020243606 7:6413878-6413900 GAGACAGAAGAGCAGGGAAAAGG + Intronic
1020608556 7:10367341-10367363 GACAGAGCACATGGGGGAAAGGG - Intergenic
1020721906 7:11755717-11755739 CTCAGAGCAGACCAGGGGAAGGG + Intronic
1021982588 7:26068991-26069013 TACAGAGCAGAGCAGGAAAAGGG + Intergenic
1022389352 7:29929606-29929628 CACAGAGCAGGGCAGGGAACTGG + Intronic
1022633717 7:32111010-32111032 GACATACCACAGCAGGGAAGAGG + Intronic
1022864646 7:34405208-34405230 AAGAGAGCACAGGAGGGAAATGG + Intergenic
1023114734 7:36851483-36851505 GACAGAGGAAAGGAAGGAAAGGG + Intergenic
1023148493 7:37176828-37176850 GACAAAGTAAAGAAGGGAAAAGG + Intronic
1023292511 7:38683125-38683147 GAGTGAGCAGAGGAGAGAAAAGG - Intergenic
1023809665 7:43902099-43902121 GACAGAACAGAGAAGGGAGGAGG + Intronic
1023851171 7:44151322-44151344 GACAGAGCACAGCCGGGCCAGGG - Intronic
1023887461 7:44369623-44369645 GAAGGAGAAGAGAAGGGAAAAGG + Intergenic
1024208194 7:47181748-47181770 GACAGGGCTGAGCAGGGAGCTGG - Intergenic
1024254499 7:47530431-47530453 GACGGAGAAGGGCAGGGAAGGGG + Intronic
1024664859 7:51536366-51536388 GACAGAGCACATCCGGGAAGGGG - Intergenic
1025886550 7:65599948-65599970 CCCAGATTAGAGCAGGGAAATGG - Intergenic
1026164816 7:67900454-67900476 GACAGAGTAGAACAGAGAAGAGG - Intergenic
1026324372 7:69296064-69296086 GGCAGAGCAGGCCAGGGAATGGG + Intergenic
1027729978 7:81859026-81859048 GTCAGGGCAGAGCAGGCAATTGG + Intergenic
1028793334 7:94877919-94877941 GTCAGGGCAGAGCAGGTAATCGG - Intergenic
1028805992 7:95026688-95026710 GACAGAGCACCTCAGGGAAGGGG - Intronic
1028922491 7:96322859-96322881 GACAGTGGTGATCAGGGAAAAGG + Intergenic
1029419957 7:100467277-100467299 GACAAAGCAGGGAAGGGACAGGG + Intronic
1029453752 7:100656635-100656657 CAGAGAGGAGAGCAGGGAAGAGG + Intergenic
1029574011 7:101391080-101391102 AACAGAGCAGCGGAAGGAAAGGG + Intronic
1029623030 7:101701786-101701808 GACGGTGCAGAGCAAGGAGAAGG + Intergenic
1030077064 7:105745978-105746000 GACAGGGAAAAGCAGGGGAAGGG - Intronic
1031105038 7:117530314-117530336 CACAAAGCAGAGCTGGGAATGGG - Intronic
1031581506 7:123480610-123480632 GAGGGAGCAGAGGAAGGAAAAGG - Intronic
1031722604 7:125194652-125194674 GAGAGAGTAGTGCTGGGAAAAGG - Intergenic
1032107997 7:129050996-129051018 GCCAGACTGGAGCAGGGAAATGG + Intronic
1032225814 7:130031002-130031024 CACAGAGCTGAGCTGGGGAAGGG - Intronic
1032251439 7:130261322-130261344 GACAGCACAGAGAAGGAAAAAGG - Intergenic
1032422484 7:131793796-131793818 GTCAGAGGAGAGCAGAGAAGGGG - Intergenic
1032443248 7:131958642-131958664 GTCAGAGCAGGGAAGGGCAAAGG + Intergenic
1032497089 7:132370754-132370776 GCTTGAGCAGGGCAGGGAAAGGG - Intronic
1032656180 7:133932777-133932799 TAAAGAACAGAGCAGGGGAAAGG - Intronic
1032679638 7:134168532-134168554 TACAGGGCAGAGAAGGGAGATGG + Intronic
1032686134 7:134235524-134235546 GAAAAAGCAGAGCAGGGAAAAGG - Intronic
1033355632 7:140597079-140597101 GAGAGAGAAAAGGAGGGAAAAGG + Intronic
1033679544 7:143580530-143580552 GACAGAGCAGCTGGGGGAAAGGG - Intergenic
1033692292 7:143748913-143748935 GACAGAGCAGCTGGGGGAAAGGG + Intergenic
1034353490 7:150432678-150432700 TACTCAGCAGAGAAGGGAAAGGG + Intergenic
1034459463 7:151190590-151190612 GAAAGAGAAGAGTAGGGAGAAGG - Intergenic
1034983570 7:155493985-155494007 GGCAGAGCAGACCATGGAACCGG - Intronic
1035252682 7:157607498-157607520 GAGGGAGCAGGGCAGGGAACAGG + Intronic
1035325578 7:158063820-158063842 GACACAGCAGGTCAGGGAATGGG + Intronic
1035395278 7:158530873-158530895 CACTCAGCAGAGCAGGGGAATGG + Intronic
1035726841 8:1830086-1830108 GACAGAACGGAGCGGGGAAGTGG - Intronic
1035746601 8:1965856-1965878 GACAGAGCTGAGACAGGAAAGGG - Intergenic
1035770677 8:2144475-2144497 GGCAGAGGACAGCAGGGAACAGG - Intronic
1035930511 8:3775364-3775386 GACACAGCATAGCAGGTAACAGG + Intronic
1036500304 8:9308095-9308117 GACAGGGCAGGGCAGGGTACAGG - Intergenic
1037899840 8:22681515-22681537 GACAGAGCCGAGCAGAGGAATGG + Intergenic
1037928467 8:22863616-22863638 AACAGATCAGAGCAGTGAGAAGG - Intronic
1037989648 8:23311731-23311753 GACAGAGCTGAGCAAGGCAGAGG + Intronic
1038452926 8:27651419-27651441 GACAGACCAGAGCAGGAACATGG + Intronic
1038526224 8:28275967-28275989 GATAGGGCAGAACAGGAAAAAGG - Intergenic
1038699629 8:29837368-29837390 GACAGCCCAGTGCAGGGAGACGG + Intergenic
1038727824 8:30096673-30096695 AACAGGGAAGAACAGGGAAACGG - Intronic
1038886711 8:31670601-31670623 GACAGAGATGATCAGAGAAAGGG + Intronic
1040651725 8:49456769-49456791 GCCAGAGCAGAGCAGGGCCAGGG + Intergenic
1040666256 8:49637408-49637430 GATAAAGTGGAGCAGGGAAACGG - Intergenic
1041945220 8:63433397-63433419 GAGAGAGCAGAGCAGGCACTAGG + Intergenic
1042320169 8:67467528-67467550 GACAGAGAAGCAGAGGGAAAGGG - Intronic
1042778674 8:72465889-72465911 TACAGAAGAGAGCAGGGGAAGGG - Intergenic
1042790923 8:72605234-72605256 GACACAGCACAGCTGGGACATGG + Intronic
1044278170 8:90326180-90326202 GACAGAGAAGAGAAGGCGAATGG - Intergenic
1044555980 8:93562555-93562577 GACAAAGAAGAGCCGGGGAAGGG - Intergenic
1044729808 8:95220721-95220743 GAAAGGGCTGAGAAGGGAAATGG - Intergenic
1046007892 8:108508049-108508071 GAGAGAGAAGAGCAGGTTAAGGG + Intergenic
1046018445 8:108634593-108634615 GCCAGAGTAAAGGAGGGAAATGG - Intronic
1046278770 8:111997069-111997091 GAAAGAGCAGACTAGGGCAAGGG - Intergenic
1046827088 8:118703288-118703310 CACAGAGCAGAGAAGAGAACAGG - Intergenic
1047233003 8:123013304-123013326 GAGACAGCAGAGCAGGGACATGG + Exonic
1047321188 8:123785272-123785294 GACAGGAAAGAGCAGGAAAAGGG + Intronic
1047488586 8:125355334-125355356 AAAAGAGTAGAGAAGGGAAAGGG + Intronic
1047514526 8:125542126-125542148 GAGAGATCAGAGCAGGTACAAGG + Intergenic
1047515637 8:125552465-125552487 GAGAGAGTTGAGCAGGGAACGGG + Intergenic
1047537514 8:125733198-125733220 GACAGAACAAAGAAAGGAAAAGG - Intergenic
1047545424 8:125811743-125811765 ATCAGAGCAGAGGAAGGAAAGGG + Intergenic
1047700972 8:127449011-127449033 AACAGAGCAGACCTGGGAAAGGG - Intergenic
1048132539 8:131713742-131713764 GAAAGAGAAAAGAAGGGAAAAGG + Intergenic
1048226337 8:132590077-132590099 TACAGAGCAGAGCAAAGACAGGG - Intronic
1048302245 8:133260271-133260293 GAGACAGCAGAGCAGGGTAGGGG - Intronic
1048569992 8:135644390-135644412 GGGACAGGAGAGCAGGGAAATGG - Intronic
1048718275 8:137293057-137293079 GATAAGGTAGAGCAGGGAAAAGG + Intergenic
1049262619 8:141647754-141647776 ACCAGAACAGAGCAGGGAAGAGG - Intergenic
1049492488 8:142912733-142912755 GACGGTGCAGAGCAGGGATCAGG + Intronic
1049865121 8:144930216-144930238 GACAAAGAAGGGCAGGGAATTGG + Intergenic
1050638762 9:7642457-7642479 GTTAGAGCAGAGAAGAGAAAAGG - Intergenic
1050925043 9:11254457-11254479 GAAAGAGCAGACTAGGGAACTGG + Intergenic
1051093024 9:13432459-13432481 GGCAGAGAAAATCAGGGAAAAGG + Intergenic
1051540475 9:18210984-18211006 GACAGAGGAGAGAAGCGACAAGG + Intergenic
1051681333 9:19611012-19611034 GAGAATGCAGAGCAGGGAGAGGG + Intronic
1052055800 9:23906090-23906112 GACAGAGAAGAGAAGGGGAGAGG + Intergenic
1052169500 9:25376223-25376245 AAAAGAGGAGTGCAGGGAAATGG + Intergenic
1053102359 9:35381525-35381547 GACAGAGCAGAGAAAGGGAATGG - Intronic
1053337629 9:37290015-37290037 GAAAAAGTAGAGCAGGGTAATGG - Intronic
1053624606 9:39855919-39855941 GATAAAGCAGAGGAGGGAACCGG + Intergenic
1053691261 9:40588524-40588546 GCCAGTGCAGAGCCAGGAAAGGG - Intergenic
1053691838 9:40590595-40590617 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1053880264 9:42587309-42587331 GATAAAGCAGAGGAGGGAACCGG - Intergenic
1054219290 9:62394779-62394801 GATAAAGCAGAGGAGGGAACCGG - Intergenic
1054231424 9:62514394-62514416 GATAAAGCAGAGGAGGGAACCGG + Intergenic
1054272966 9:63046896-63046918 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1054302521 9:63389495-63389517 GCCAGTGCAGAGCCAGGAAAGGG - Intergenic
1054303094 9:63391561-63391583 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1054401873 9:64718071-64718093 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1054435479 9:65202386-65202408 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1054494914 9:65819301-65819323 GCCAGAGCAGGGCTGGGACAGGG + Intergenic
1055048798 9:71958828-71958850 GGTAAAGCAGAGCAGGGAAGAGG - Intronic
1055498919 9:76884072-76884094 GAGAGAGGAGAGAAGGGAGAGGG - Intronic
1055889198 9:81104941-81104963 GAGAGAGCAGAGCACGAGAAAGG + Intergenic
1056307616 9:85305452-85305474 TACAGAGCAGAGCAGAGGACAGG + Intergenic
1057706366 9:97397946-97397968 GACAGAGAAGGACAAGGAAAGGG - Intergenic
1057788357 9:98105295-98105317 TACAGAGCAGAGCCGGGGATGGG - Intronic
1058961620 9:109997677-109997699 GAGAGAGCAGAAGAGGGAGAGGG + Intronic
1059177933 9:112184292-112184314 GAGATAGCAGAGATGGGAAAAGG - Intergenic
1059291705 9:113231088-113231110 GTCAAGGCTGAGCAGGGAAAAGG - Intronic
1059384640 9:113954701-113954723 TACAGAGCACAGCAGGGAAAAGG - Intronic
1059404961 9:114093828-114093850 GACAGAGGGCAGCTGGGAAAAGG - Intronic
1059551295 9:115232003-115232025 GGCAGAAAAGAGGAGGGAAAGGG - Intronic
1059766127 9:117385700-117385722 GACAGAGGGAAGCAGGGAAAAGG + Intronic
1060179112 9:121520140-121520162 CTCAGAGCAGAACAGGAAAAGGG + Intergenic
1060208496 9:121696609-121696631 GGCAGAGCAGAGCAGAGGACTGG + Intronic
1060409203 9:123389023-123389045 TACAGAGCAGAGAAGGGAGACGG - Intronic
1060828382 9:126699257-126699279 GACAGAGCTGAGCTGAGAACAGG + Exonic
1060986171 9:127820142-127820164 GAGGGAGCAGGGCAGGGGAATGG - Intronic
1061861535 9:133470968-133470990 GCAAAAGCAGGGCAGGGAAAAGG - Intergenic
1062018361 9:134303795-134303817 GACGGAGGTGAGCAGGGACAGGG - Intergenic
1062042112 9:134408911-134408933 GACAGGGCAGAGCAGGGCTGGGG - Intronic
1062048774 9:134436690-134436712 GGCAGAGAAGGGCAGGGACAGGG - Exonic
1062113485 9:134795537-134795559 GCCCCAGCAGAGCAGGGACAGGG + Intronic
1062359013 9:136178645-136178667 GACAGAGCTGAGCTGGCCAAAGG + Intergenic
1062528413 9:136988066-136988088 GGCAGAACAGGGGAGGGAAAGGG - Intergenic
1062736485 9:138140324-138140346 GCCAGGGGAGAGCAGGGAAGGGG + Intergenic
1203622500 Un_KI270749v1:136730-136752 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1185601022 X:1339375-1339397 GACTGAGGGCAGCAGGGAAAAGG - Intronic
1186739500 X:12502391-12502413 GAGAGAGCAGAGCAGGGGAAGGG + Intronic
1186805861 X:13139519-13139541 GACAGAGCAGAGCAGATGAGGGG + Intergenic
1187449331 X:19382864-19382886 CACAGAGCAGAGCTGAGAGAGGG - Intronic
1188540824 X:31248649-31248671 TAAACAGCAGAGCAGAGAAAAGG - Intronic
1190190678 X:48274501-48274523 GACAGGGCAGAGGAGGGGAGGGG + Intronic
1190420343 X:50223871-50223893 GACAGAGCACCTGAGGGAAATGG - Intronic
1190726878 X:53195647-53195669 GACTGAGCAGGGCAGGGGCATGG - Intronic
1190739597 X:53280467-53280489 GCCAGAGCAGAGGAGGGTGAGGG + Intronic
1190789020 X:53682749-53682771 CTCAGAGCAAGGCAGGGAAAAGG + Intronic
1191890340 X:65932788-65932810 GTCAGGGCAGAGCAGGTAATTGG + Intergenic
1191890348 X:65932844-65932866 GTCAGGGCAGAGCAGGTAATTGG + Intergenic
1191932171 X:66386059-66386081 GACATTTCAGGGCAGGGAAATGG + Intergenic
1192208101 X:69109362-69109384 GACAGAGAAGAGGAGGCAGAAGG + Intergenic
1192214135 X:69146228-69146250 GATAGAGCAGGGCAGGTAATGGG - Intergenic
1192878638 X:75258658-75258680 GACAGAGCACCTCAGGGAAGGGG + Intergenic
1193334691 X:80274261-80274283 GACAGAGCACCTCAGGGAAGGGG + Intergenic
1193468721 X:81875307-81875329 GCCAGAGCAGAGCAGAGAAAGGG - Intergenic
1193656278 X:84201755-84201777 GACAGTGCAAAGGAGGGAGAAGG - Intergenic
1194833405 X:98653587-98653609 GACAGAAAACAGCAGGGTAAAGG - Intergenic
1195298698 X:103505962-103505984 GACAGTGCAGTGAAGGGAGAAGG - Intronic
1195469083 X:105212496-105212518 GACAGAGCACCTCAGGGAAAGGG + Intronic
1196960174 X:120992656-120992678 GACAGAGCACATGAGGGAAGGGG - Intergenic
1197308240 X:124870433-124870455 GACAAGGTAGAGCAGGGTAAAGG + Intronic
1198704387 X:139432794-139432816 AACAGTGGAGAGGAGGGAAAAGG - Intergenic
1198991999 X:142525226-142525248 TGCAGAGCTGAGCAGGGAAAGGG + Intergenic
1199566678 X:149222951-149222973 GACAGAGGAAAGCAGAGAGAAGG + Intergenic
1199601738 X:149545172-149545194 GGCAGGGCACAGCAGGGGAAAGG + Intronic
1199648637 X:149934311-149934333 GGCAGGGCACAGCAGGGGAAAGG - Intronic
1200398723 X:156006413-156006435 GCCAGGGGAGAGCAGGGAAGGGG + Intronic
1200428210 Y:3045875-3045897 GTCTGAGCAGGGCAGGAAAAAGG - Intergenic
1201190482 Y:11439161-11439183 GCCAGAGCAGGGCTGGGACAGGG - Intergenic
1201900357 Y:19041951-19041973 GTCAGGGCAGAGCAGGTAATCGG + Intergenic
1202275120 Y:23109950-23109972 GACAGAGCTGAACAGAGAATGGG + Intergenic
1202290908 Y:23310739-23310761 GACAGAGCTGAACAGAGAATGGG - Intergenic
1202428111 Y:24743672-24743694 GACAGAGCTGAACAGAGAATGGG + Intergenic
1202442680 Y:24926419-24926441 GACAGAGCTGAACAGAGAATGGG - Intergenic
1202583118 Y:26402720-26402742 GCCAGAGCAGGGCTGGGACAGGG + Intergenic