ID: 1004506184

View in Genome Browser
Species Human (GRCh38)
Location 6:16248733-16248755
Sequence TGACAGAGCAGAGCAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 967
Summary {0: 1, 1: 0, 2: 13, 3: 146, 4: 807}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004506184_1004506188 22 Left 1004506184 6:16248733-16248755 CCTTTCCCTGCTCTGCTCTGTCA 0: 1
1: 0
2: 13
3: 146
4: 807
Right 1004506188 6:16248778-16248800 TATGTGTTAGTATAAAAGTGAGG No data
1004506184_1004506189 23 Left 1004506184 6:16248733-16248755 CCTTTCCCTGCTCTGCTCTGTCA 0: 1
1: 0
2: 13
3: 146
4: 807
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506184_1004506190 24 Left 1004506184 6:16248733-16248755 CCTTTCCCTGCTCTGCTCTGTCA 0: 1
1: 0
2: 13
3: 146
4: 807
Right 1004506190 6:16248780-16248802 TGTGTTAGTATAAAAGTGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004506184 Original CRISPR TGACAGAGCAGAGCAGGGAA AGG (reversed) Intronic
900018178 1:169058-169080 TGTAAGAGCAGAGCAGGTGATGG + Intergenic
900048437 1:527654-527676 TGTAAGAGCAGAGCAGGTGATGG + Intergenic
900070663 1:769506-769528 TGTAAGAGCAGAGCAGGTGATGG + Intergenic
900176166 1:1292350-1292372 AGACAGAGCAGAGCAAGGCACGG + Intergenic
900556823 1:3284823-3284845 GGCCAGGGCAGAGCAGAGAAGGG + Intronic
900853361 1:5161610-5161632 TGCAAGGGCAGGGCAGGGAAGGG - Intergenic
900916731 1:5644746-5644768 TGACTGAGCAGACATGGGAACGG - Intergenic
901142159 1:7042271-7042293 TGCCAGGGCAGCCCAGGGAAGGG - Intronic
901476672 1:9494933-9494955 TGAGCGAGAAGACCAGGGAAGGG - Intergenic
902159845 1:14520965-14520987 TGAGAGGCCAGAGCAGGGAGAGG + Intergenic
902208823 1:14890146-14890168 TCGCAGAGCAGGGAAGGGAAAGG - Intronic
902552322 1:17226467-17226489 TGATTGACCAGAGGAGGGAACGG - Intronic
902848241 1:19129558-19129580 TGAGAGAGTAGAGCAGTGACTGG - Intronic
902894345 1:19468574-19468596 GGGCAGGGCAGAGCAGGGCAGGG + Intronic
902988263 1:20168939-20168961 TGAGAGATCAGTGCAGAGAAAGG - Intronic
903187204 1:21635382-21635404 TGACTGAGCAGAGGAATGAAGGG - Intronic
903416950 1:23190042-23190064 GGACAGAGCAGAGGAAGGTAGGG - Intergenic
903766192 1:25736201-25736223 GGACAGAGCTGGGCAGGGACTGG - Intronic
903849892 1:26299765-26299787 TGACAGGGGAAAGCAGGGAGAGG + Intronic
904163634 1:28538728-28538750 GGGCAGAGCAGAGCAGGGTATGG + Intronic
904268001 1:29328914-29328936 CCACAGAGCAGAGCAGTTAAAGG - Intergenic
904326053 1:29727743-29727765 TGAGGGAGGAGAGGAGGGAAGGG + Intergenic
904365715 1:30009936-30009958 AGCCAGAGCAGGGCAGAGAATGG - Intergenic
904429234 1:30451314-30451336 CCACAGAGCAGAGCAGTTAAAGG + Intergenic
905750032 1:40454193-40454215 TGAGACAGCAGAGCTGGGGAAGG - Exonic
905752946 1:40481753-40481775 TGAGACAGCAGAGCTGGGGAAGG - Exonic
905857110 1:41321472-41321494 AGGCAGAGCAGAGCAGTGGAAGG - Intergenic
905930045 1:41780434-41780456 AGCCAGAGCAGGGCAGGGCAAGG + Intronic
906652306 1:47521424-47521446 TGCCAGAGCTGAAGAGGGAAGGG + Intergenic
907222792 1:52919778-52919800 TGACAGTGCAGAGGAGGCATGGG - Intronic
907834240 1:58093903-58093925 GTACAGAGCAGAGCAAGCAAAGG - Intronic
908001714 1:59687084-59687106 ACACACAGCAGAGCAGGGGAAGG - Intronic
908471410 1:64447530-64447552 AGTCAGAGCAGAGCAGGGGAGGG + Intergenic
908639909 1:66211067-66211089 TGACAGAGCACAGCAGGGCAGGG + Intronic
909029622 1:70524070-70524092 GGACAGAGCAGGGCAGAGAAAGG - Intergenic
909486391 1:76179006-76179028 CCACTGAGCCGAGCAGGGAATGG - Intronic
909995178 1:82270219-82270241 AAGCAGAGCAGAGGAGGGAAGGG - Intergenic
910225940 1:84936142-84936164 TCACAGAGAAGGGGAGGGAAGGG + Intronic
911018243 1:93358234-93358256 TCACAAAGCAGAGCATAGAAAGG - Intronic
911058186 1:93725043-93725065 AGACAAAGCAGAGCAGGGTGAGG - Intronic
911231326 1:95364670-95364692 AGGCAGAGAAGAGCAGGGAATGG - Intergenic
911425299 1:97703113-97703135 TTCCAGAACAGAGCAGGCAAAGG - Intronic
911612205 1:99969915-99969937 TGCCAGAGCCGAGCCGGGAACGG + Intronic
912580774 1:110719139-110719161 ATACAGAGCAAAGCAGGGGAAGG - Intergenic
913061901 1:115216375-115216397 TGAGAGAGCAGGACAGGGGAGGG + Intergenic
913373142 1:118122866-118122888 TGTGAGAGCAGAGAATGGAATGG + Intronic
913958463 1:143322588-143322610 GGACAGGACAGAGCAGGGCAAGG + Intergenic
914052780 1:144147968-144147990 GGACAGGACAGAGCAGGGCAAGG + Intergenic
914126417 1:144818573-144818595 GGACAGGACAGAGCAGGGCAAGG - Intergenic
915118233 1:153613278-153613300 TGACAGGGTAGAGAAAGGAAGGG + Intergenic
915583980 1:156833687-156833709 TCACAGAGCAGAGTATAGAAGGG - Intronic
915637857 1:157198997-157199019 TGACAGGGGATGGCAGGGAAGGG + Intergenic
915670575 1:157485750-157485772 TGACAGGGGATGGCAGGGAAGGG - Intergenic
916956647 1:169843964-169843986 TGACAGAGAAGAACAGATAAAGG - Intronic
917416440 1:174815143-174815165 TGGCAGATCAGAGTGGGGAACGG - Intronic
917611302 1:176691664-176691686 TGAGACAGCAGGGCTGGGAATGG - Intronic
917628228 1:176867289-176867311 TGTCAGAAGAGAGAAGGGAAGGG + Intronic
918046917 1:180947202-180947224 GGACACTGCAGAGCAGGCAACGG + Exonic
918084930 1:181237314-181237336 GAACAGAACAGAGCAGGGAAAGG + Intergenic
918188017 1:182144614-182144636 TGACAGCTCAGCACAGGGAAGGG - Intergenic
918278964 1:182984199-182984221 TGACAGAGGATAGCGGGGAGTGG + Intergenic
919234775 1:194826854-194826876 TGAACTACCAGAGCAGGGAAAGG + Intergenic
919779917 1:201215166-201215188 GGACAGGGCAGGGCAGGGCAGGG - Intronic
919818939 1:201460503-201460525 CGAGAGGGCAGAGAAGGGAATGG - Intergenic
920013303 1:202886213-202886235 TGACAGAGCACAACGGGGAACGG + Intronic
920123844 1:203677949-203677971 GGACAGAGTAGGGCAGGGCAGGG + Intronic
921354913 1:214276801-214276823 TAACAGTGCAGAGCTGGGCATGG - Intergenic
921443050 1:215211463-215211485 TGAAAATGCAGAGCTGGGAAGGG - Intronic
921793807 1:219319650-219319672 TCACAGAGCAGAGCACAGAATGG + Intergenic
921832169 1:219740306-219740328 AGACAGAGAAGAAAAGGGAAAGG + Intronic
921961472 1:221039403-221039425 TGAAAGAACAGAGGAGGGGAGGG + Intergenic
922106024 1:222514921-222514943 TAAAAGAGCAGAGCAGGTGATGG + Intergenic
922118906 1:222643436-222643458 TGAGAAAGAAGAGCAGTGAAGGG - Intronic
922649269 1:227322726-227322748 AGACAGAGTAGAGCAGGCAATGG + Intergenic
923076541 1:230614314-230614336 TGACAGAGTAGAGCTGGGCTGGG - Intergenic
923093818 1:230759322-230759344 GGGCAGAGAAGAGCAGGCAAGGG + Intronic
923400017 1:233607837-233607859 TGACAGGACAGAGCAGTGGATGG + Intergenic
923556751 1:235007106-235007128 TGACTGAGCAGATGTGGGAAGGG - Intergenic
923987943 1:239402520-239402542 TGACATGACAGAGCGGGGAAAGG - Intronic
924153171 1:241149744-241149766 TGACAGTGGAGAGGAGGGAGTGG + Intronic
924348204 1:243092488-243092510 TGTAAGAGCAGAGCAGGTGATGG + Intergenic
1062768783 10:83964-83986 TGCCAGGGGAGAGCAGGGAAGGG - Intergenic
1063352727 10:5371688-5371710 TGACAGTGCAGAGCAGGGCCAGG - Intronic
1063857535 10:10271875-10271897 TGATAGAGCACAGCAGGACAAGG + Intergenic
1064155962 10:12903479-12903501 AAACTGAGAAGAGCAGGGAAAGG + Intronic
1064414348 10:15135849-15135871 AAACACAGCAGAGAAGGGAAGGG + Intronic
1064717413 10:18190979-18191001 TGACAGAGCAGAGAATGCATGGG + Intronic
1064884513 10:20095494-20095516 TGACAGGGGAGAGAAGGGAAAGG + Intronic
1065508829 10:26457230-26457252 TGAAAAAGCAGACCAGAGAAAGG - Intronic
1065623300 10:27605849-27605871 TGAGTGTGCAGGGCAGGGAAGGG + Intergenic
1065860943 10:29871977-29871999 TGCCAGATCTGTGCAGGGAAGGG - Intergenic
1065885367 10:30072123-30072145 GGGCAGGGCAGGGCAGGGAAGGG + Intronic
1066039075 10:31526868-31526890 TGACAGCACAGAGCAGGAAGAGG + Exonic
1066056570 10:31686608-31686630 TGAGAGAGCAAAGCATGGCAAGG + Intergenic
1066586646 10:36943650-36943672 TGACAGAGCAGAGAGGGAACAGG + Intergenic
1066736747 10:38486851-38486873 TGGAAGAGAAGAGAAGGGAATGG + Intergenic
1066759199 10:38737976-38737998 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1066962425 10:42234794-42234816 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1067195367 10:44113527-44113549 TGCCAGAGAAGAGGATGGAATGG + Intergenic
1067314661 10:45150531-45150553 TGTAAGAGCAGAGCAGGTGATGG - Intergenic
1068945314 10:62723682-62723704 TAACAGAGCCTAGCAGGGGAAGG + Intergenic
1068962564 10:62880421-62880443 TGACATAACAGAGAAAGGAAAGG + Intronic
1069344221 10:67448185-67448207 TGAGGGAGGAGAGCAGGGAAAGG + Intronic
1069354960 10:67574518-67574540 TGACAGAAAACAGAAGGGAAAGG - Intronic
1069917340 10:71795750-71795772 GGATGGAGCAGAGCAGGGCAGGG - Exonic
1070300371 10:75199273-75199295 GGACAGGGCAGGGCAGGGCAGGG + Intergenic
1070650761 10:78234076-78234098 TGACACAGGAGAGGAGGGAAGGG - Intergenic
1071501704 10:86208636-86208658 TGACAGGGAAGTGCAGTGAAGGG - Intronic
1071561596 10:86650172-86650194 ACAGAGAGCAGAGCAGGGCAAGG - Intergenic
1071818535 10:89256181-89256203 AGACAGAGCAGAGCAGAGGTAGG + Intronic
1072460036 10:95610366-95610388 TGACAGATCAGGGCAGGGTCTGG + Intronic
1072613993 10:97037562-97037584 TCCCAGAGGGGAGCAGGGAAAGG + Intronic
1072614093 10:97038076-97038098 GGAAAGAGCAGAGCAGGGAGGGG - Intronic
1073037474 10:100574370-100574392 TGACAGAGAAGAGATGTGAAAGG + Intergenic
1073052550 10:100677455-100677477 AGAGAGAGCAGAGTAGGGGAGGG - Intergenic
1073061853 10:100738048-100738070 GGACAGAGCAGTGCAGAAAAAGG - Intronic
1073861288 10:107744571-107744593 TGACACTGCAGGGCAGGGGATGG - Intergenic
1074067894 10:110035301-110035323 TGATAGAGCAGAGGGTGGAAAGG - Intronic
1074152962 10:110774575-110774597 AGACAGAGAAGAGCTGGGACTGG - Intronic
1074435262 10:113428664-113428686 AGACAGAGCAGAGCAGGGCCTGG + Intergenic
1075076759 10:119357182-119357204 TGACAGAGCAGGGCTGGGTAAGG + Intronic
1075445669 10:122511024-122511046 GGACATATCAGAGCAGGGACAGG - Intronic
1075467151 10:122660314-122660336 GGACAGAGCTGGGCAGGGAGAGG - Intergenic
1075733676 10:124651379-124651401 GGACAGAGCAGAGCAGGCTCAGG - Intronic
1075967392 10:126624742-126624764 TGAGTGTACAGAGCAGGGAAAGG + Intronic
1075967618 10:126626244-126626266 GGACAGAGCAGTGGAGGCAATGG - Intronic
1076544686 10:131237288-131237310 GGACAGAGCAGGGGAGGGAGGGG - Intronic
1076672208 10:132129475-132129497 TTGGAGAGCAGAGGAGGGAATGG - Intronic
1076683635 10:132187239-132187261 CGAAGGAGCCGAGCAGGGAAGGG - Intronic
1076754632 10:132562887-132562909 TGAGATACCAGAGCAGGGGAAGG - Intronic
1076974781 11:164254-164276 TGTAAGAGCAGAGCAGGTGATGG + Intergenic
1076990153 11:268460-268482 GGACAGAGCAGAGCGGAGAGAGG - Intergenic
1077147359 11:1052188-1052210 GGGCAGAGCAGAGCAGGGCAGGG - Intergenic
1077280471 11:1742734-1742756 TGGGAGAGCAGGGCAGGGAGGGG + Intronic
1077452665 11:2659024-2659046 TGACATAGCAGTGAAAGGAAAGG - Intronic
1077635590 11:3839852-3839874 TGCCAGAGCTGGGAAGGGAAGGG + Intronic
1077711661 11:4543357-4543379 TGACCGGGCAAAGCAGGGCATGG + Intergenic
1077959354 11:7057489-7057511 TGACAGAGTTAAGGAGGGAAGGG - Intronic
1078081810 11:8209540-8209562 GGACAGAGGAGAACAGGGCATGG - Intergenic
1078456347 11:11478718-11478740 GGCCAGAGAAGAGCAAGGAATGG - Intronic
1078795393 11:14587154-14587176 CAACAGAGAAGAGCAGGGAAAGG - Intronic
1079002664 11:16770902-16770924 TAACAGAGCTGAGCAGAGATAGG + Intergenic
1079103522 11:17556433-17556455 TGACAGTGGACAGCAAGGAAAGG - Intronic
1079142708 11:17823406-17823428 TCAAAGAGTAGAGCATGGAAAGG - Intronic
1080017160 11:27519675-27519697 ATACAGGGCAGAGCAGAGAATGG - Intergenic
1080083107 11:28244986-28245008 ATACAAAGCAGAGCAGGAAAAGG + Intronic
1080451100 11:32379544-32379566 TGAGAGAGAAGTGGAGGGAAGGG + Intergenic
1080683462 11:34496480-34496502 TGAAAGAGAAGAGCAGGAGAGGG - Intronic
1080709938 11:34737389-34737411 TGAAGGAGCAGAGCTGGGATTGG - Intergenic
1081672767 11:44950807-44950829 GGACAGGGCAGGGCAGGGCAGGG + Intronic
1083101103 11:60306984-60307006 AGAGAGAGGAAAGCAGGGAATGG + Intronic
1083157501 11:60833599-60833621 GGACAAAGCAGAGTAGGGAGAGG + Intergenic
1083249424 11:61455970-61455992 TGACAGTGCAGAGCAAGGTAAGG - Intronic
1083302958 11:61748341-61748363 TGAGAGGGCAGTGCTGGGAAGGG + Intergenic
1083372495 11:62193145-62193167 GGACAGAGCAGAGCAGCAAGAGG - Intronic
1083849274 11:65355593-65355615 TGCCAGGGCAGAGCTGGGGAGGG - Intronic
1083990713 11:66244279-66244301 GGGAAGAACAGAGCAGGGAAAGG - Exonic
1084029786 11:66474507-66474529 TGCCAGAGAAGAGCAGTGCATGG - Intronic
1084115712 11:67041858-67041880 GGCCAGAGCAGAGGGGGGAAGGG + Intronic
1084366961 11:68708015-68708037 GGGCAGAGCAGGGCAGGGGAGGG - Exonic
1084475659 11:69387198-69387220 TGACCGAGCAGAGGGAGGAAGGG - Intergenic
1084545290 11:69812359-69812381 TGAAAGCCCAGAGCAGGGAAGGG + Intronic
1084556938 11:69881037-69881059 TCACTGGACAGAGCAGGGAAGGG - Intergenic
1084743381 11:71153216-71153238 TGCCAGATCAGAGGAGGGGAAGG + Intronic
1084858013 11:72001132-72001154 GGGCACAGCAGAGCAGGGTAGGG + Intronic
1084952575 11:72674788-72674810 TGACAGAGGAGAGAGGGGAGAGG + Intergenic
1084991151 11:72926327-72926349 AGACAGAGCAGAGCAGAGGATGG + Intronic
1085546732 11:77326009-77326031 TGACAGAGCAGGGCAGGGCAGGG - Intronic
1085905481 11:80756241-80756263 TGTCAGAGAAGATCAGGAAAAGG + Intergenic
1086410758 11:86541681-86541703 GGACAGAGCACCTCAGGGAAGGG + Intronic
1087020448 11:93597354-93597376 TGGCAGAGCAGCCCAGAGAAAGG + Intergenic
1087081397 11:94174275-94174297 AGACAGAGCAGAGGCTGGAAGGG - Intronic
1087094786 11:94307924-94307946 AGATAGAGCAGAGCAGTGGAGGG - Intergenic
1087167146 11:95016373-95016395 TGACAGAGCAGAATAGGGAGGGG + Intergenic
1087696480 11:101382783-101382805 TAACATAGCAGAGAAGCGAAAGG - Intergenic
1088182214 11:107126000-107126022 TCACAGAGAAGGGCTGGGAATGG - Intergenic
1088844255 11:113651653-113651675 TGACAAAGAAGAGCAGAGAGAGG - Intergenic
1088899982 11:114108560-114108582 TTAGAGAGTTGAGCAGGGAAGGG - Intronic
1089374787 11:117986554-117986576 GGAGAGGGCAGGGCAGGGAAGGG - Intronic
1089376726 11:117999893-117999915 TGGCAGAGCTGAGAAGGGCAGGG + Exonic
1089850969 11:121496163-121496185 TGACAGAGGAGAGTAGGAATTGG + Intronic
1089921887 11:122216833-122216855 TGACAGAACAGAGAAAGGCAAGG + Intergenic
1090077428 11:123588057-123588079 TAACTGAGCAAAGGAGGGAAAGG - Intronic
1090259485 11:125308364-125308386 GGACTGAGCAGAGGTGGGAAAGG - Intronic
1090336905 11:125975021-125975043 TGGCAGTGCACAGGAGGGAAGGG - Intronic
1090395316 11:126414708-126414730 TGTTAGACCAGAGCAGGGCATGG + Intronic
1090749034 11:129729922-129729944 TGGCAAAGCAGAGCAGGGCCTGG + Intergenic
1091160416 11:133414717-133414739 TGGCAGGGAAGAGCTGGGAACGG - Intronic
1091192489 11:133707045-133707067 GGAAAGAGAAGAGAAGGGAAGGG + Intergenic
1091324910 11:134678854-134678876 TGACAGAGCCCAGCATGGAGTGG - Intergenic
1091518068 12:1206489-1206511 AGACAGAGGAGAGCAGGGCAGGG - Intronic
1091921878 12:4311084-4311106 TCACAGAGCTGAGCAATGAATGG - Intergenic
1092065236 12:5584582-5584604 TGTAAGAGCACAGCAGGGGAAGG + Intronic
1092740394 12:11623152-11623174 TCTCAGAGCAGAGCACGGAAGGG - Intergenic
1092894224 12:12997679-12997701 GAAGACAGCAGAGCAGGGAATGG + Intronic
1095930355 12:47619469-47619491 AGACAGAGAAGAAGAGGGAAAGG + Intergenic
1096149719 12:49301266-49301288 TGGCAGAGCAGGCCAGGGGAAGG - Intergenic
1096244361 12:49975887-49975909 GGACAGAGCAGAGGAAGGCAGGG + Exonic
1096464303 12:51839774-51839796 TGGCTGAGCAGCGGAGGGAATGG - Intergenic
1096582072 12:52592122-52592144 TCAGAGAGCAGAGGAAGGAATGG - Intronic
1096583368 12:52602647-52602669 TGGGGGAGCAGAGGAGGGAAGGG - Intergenic
1096686383 12:53290998-53291020 TGAGTGAGGAAAGCAGGGAAGGG + Intronic
1096872327 12:54601135-54601157 TGACAGAGCCAAACAGGGTAGGG + Intergenic
1097680700 12:62646492-62646514 TGCCAGGGCAGAACAGGGAGTGG + Exonic
1099294632 12:80814709-80814731 GGAGAGGGCAGAGCAGGGACTGG - Intronic
1099628950 12:85115307-85115329 TAACAGAGCAGTGCATGGATTGG - Intronic
1100032963 12:90215464-90215486 TGAGAGAGCAGGGTAGGGTACGG - Intergenic
1100912800 12:99384600-99384622 AGGCAGGGCAGGGCAGGGAAAGG - Intronic
1101492484 12:105222398-105222420 AGACAGTGCAGAGCGGGGCATGG + Intronic
1101707598 12:107235085-107235107 ATACAGAGCAGAGCAAGGGAAGG - Intergenic
1101858367 12:108462951-108462973 GGAGAGAGCAGAGGAGGGGAAGG + Intergenic
1102518260 12:113464324-113464346 GGACAGAGCAGAGCGCGAAATGG + Intronic
1103158261 12:118706214-118706236 TGCCAGGGCAGAGCAGGGGAGGG - Intergenic
1103664495 12:122552234-122552256 TGACAGACCAGGGAGGGGAAGGG + Intronic
1103701939 12:122852706-122852728 TGTCTGTGCAGAGCAGAGAACGG + Intronic
1104480413 12:129103070-129103092 TCACAAAACAGAGCATGGAAGGG - Intronic
1104571439 12:129929614-129929636 AGGCAGAGCAGAGCATGGAGGGG - Intergenic
1104626415 12:130359456-130359478 AGCAAGAGCAGGGCAGGGAATGG - Intronic
1104635991 12:130438134-130438156 ATCCAGAGCAGAGCAGGGCAGGG + Intronic
1104725959 12:131075861-131075883 TCACAGAACAGAGCAGGCATCGG + Intronic
1104940690 12:132393280-132393302 TGGGAGAGCAGAGCAGGGCTGGG - Intergenic
1105000395 12:132687000-132687022 AGAAAGAGCCGAGCAGGGAAAGG + Intronic
1105673835 13:22648689-22648711 ACAGAGAGCAGAGCAGGGAGTGG - Intergenic
1106235525 13:27857418-27857440 GGCCAGAGAAGAGCTGGGAAAGG - Intergenic
1106309040 13:28536867-28536889 TGACAGAGGTCAGAAGGGAAAGG + Intergenic
1106309794 13:28544149-28544171 TGGGAGAGCAGAGGATGGAAAGG + Intergenic
1106335036 13:28776489-28776511 GGACAGAGCACCTCAGGGAAGGG - Intergenic
1108240301 13:48457381-48457403 AGCCAGAGCAGAGCAGAGGATGG - Intronic
1108321857 13:49297704-49297726 GGACAGAGCAGATCACTGAAGGG + Intergenic
1108516505 13:51208157-51208179 AAATAAAGCAGAGCAGGGAAGGG + Intergenic
1108698339 13:52922702-52922724 GGACAGAGCAGAGCAGCACAAGG - Intergenic
1108783897 13:53871328-53871350 AGACAGAGCAGAGAAGTGTAGGG - Intergenic
1109079015 13:57874538-57874560 ACACAGAGCAAAGCAGCGAAGGG - Intergenic
1109276741 13:60311908-60311930 GCACAGAGCAGAGAAGGGAGAGG + Intergenic
1110332514 13:74288837-74288859 TGACAGAACAGAGGCAGGAAGGG - Intergenic
1110369816 13:74727457-74727479 GGGCAGAACAGAGCAGGGGAGGG + Intergenic
1111437167 13:88225701-88225723 GGAGAGAGGAGAGGAGGGAAGGG - Intergenic
1111525711 13:89466449-89466471 TGAAAGAGCAGAGGAAGCAAAGG - Intergenic
1112407955 13:99137443-99137465 TGAGAGCGAAGAGCTGGGAAAGG - Intergenic
1113527553 13:110992381-110992403 CCTCAGAGCAGAGCAGGGATGGG - Intergenic
1113681935 13:112250561-112250583 ACACAGAGCAGAGCAAGGCATGG + Intergenic
1113814813 13:113162792-113162814 GGACAGAGTGGAGCAGGGACGGG - Intronic
1113901708 13:113801503-113801525 TCCCAGAGCAGTGCAGGGATGGG + Intronic
1114186047 14:20403376-20403398 TCTCAGAGAAGAGCAGAGAAAGG - Exonic
1114539474 14:23443983-23444005 TGAAAGGGCAGAGCAGAGAGGGG + Intergenic
1114997043 14:28366320-28366342 TGTCATAGCAGAGCAGAGAAAGG - Intergenic
1115486199 14:33913646-33913668 TGACAGACCAAAAGAGGGAAAGG + Intergenic
1115790081 14:36868748-36868770 TTACAGAGCAGAGTAGGACAAGG - Intronic
1115801085 14:36994522-36994544 TGAGAGAGAACAGCAGGGAAGGG - Intronic
1116470472 14:45280802-45280824 AGAAAAAGGAGAGCAGGGAATGG - Intergenic
1116763018 14:49038279-49038301 TGACAGAGCCTAGCAGGGAGTGG + Intergenic
1117885484 14:60357050-60357072 TTAAAGAGCACAGCAGGGATAGG + Intergenic
1118325186 14:64775511-64775533 TGCTAGAGCAGAGCAGGTGATGG + Intronic
1118512235 14:66488173-66488195 AGACAGATCATGGCAGGGAAGGG + Intergenic
1118809642 14:69263553-69263575 TCAGAGAGCTGAGCTGGGAAAGG + Intronic
1118916805 14:70114605-70114627 TGCCAGAGGAGGGCAGGGATGGG - Intronic
1119198108 14:72732401-72732423 TGACAGACAAGAGCTGGGATAGG - Intronic
1119213525 14:72850538-72850560 TGACTGAACAGAGCAGGGGCGGG - Intronic
1120066976 14:80053858-80053880 AGACAGAGAAGAGATGGGAAAGG - Intergenic
1120645117 14:87064794-87064816 AAACAGAGCAGAGCTGGGTAAGG + Intergenic
1120717550 14:87855931-87855953 AGAAAGGGCAGGGCAGGGAAGGG + Intronic
1121013938 14:90536977-90536999 TGACGGAGCAGAGGAAGGAAAGG + Exonic
1121328797 14:93036788-93036810 CCCCAGAGCAGAGCAGAGAAGGG + Intronic
1121464894 14:94109360-94109382 GGGCAGAGAAGGGCAGGGAAGGG + Intronic
1121577238 14:94998263-94998285 GGAGAGGGCAGAGCAGGGAGAGG - Intergenic
1121685489 14:95832230-95832252 TGCCGGAGCAGGTCAGGGAATGG + Intergenic
1121823571 14:96991772-96991794 AGGCAGAGAATAGCAGGGAATGG - Intergenic
1121882715 14:97515006-97515028 AGACAGAGGAGAGCAGAGCAGGG - Intergenic
1121922239 14:97892847-97892869 TGACCTTGCAGAGAAGGGAAGGG + Intergenic
1122138982 14:99650845-99650867 TGCCAGAGAAGAGCAGGGAAAGG + Intronic
1122275968 14:100590963-100590985 AGACAGAGCAGGGCAGGCAGTGG - Intergenic
1122319834 14:100847775-100847797 TGACAGAAGAGAGAAAGGAACGG + Intergenic
1122605942 14:102947867-102947889 TGGCAGGGCAGGGCAGGGCAGGG - Intronic
1122649276 14:103216753-103216775 TGTCAGAGAACAGCAGGGCAGGG + Intergenic
1122785967 14:104163409-104163431 TCACACAGCAGATCAGGGACAGG - Intronic
1202929947 14_KI270725v1_random:27602-27624 GGGCAGGGCAGAGCAGGGCAAGG - Intergenic
1123422359 15:20143641-20143663 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1123434965 15:20247973-20247995 GGAGAGAGGAGAGCAGGGGAGGG + Intergenic
1123442641 15:20302701-20302723 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1123531587 15:21150181-21150203 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1124529413 15:30491322-30491344 TGACAGATCAAGGCAGGGAGGGG + Intergenic
1124626010 15:31307955-31307977 CCAGAGATCAGAGCAGGGAAGGG + Intergenic
1125078477 15:35649240-35649262 TGACAGCTCAGTGCAGGGGAGGG + Intergenic
1125109970 15:36021170-36021192 AAACACAGCAGAGTAGGGAAGGG - Intergenic
1125144215 15:36447544-36447566 TCACAGAGCACAACAGGCAAAGG - Intergenic
1125410618 15:39402097-39402119 ATACAGAACAGAGCAGGGAAAGG + Intergenic
1125487597 15:40123199-40123221 TCACAGGGCAGGGCAGGGCAGGG + Intergenic
1125521622 15:40351039-40351061 TGAGAGTGCAGAGCAGGGGCAGG - Exonic
1125590335 15:40850717-40850739 TGCCAGAGCAGCCAAGGGAATGG - Intronic
1126087555 15:45023718-45023740 AGACCGTGCAGAGCAGAGAAAGG + Intronic
1126167527 15:45666735-45666757 GGAGAGAGGAGAGGAGGGAAGGG - Intronic
1127044159 15:55008539-55008561 GGGGAGAGCAGAGGAGGGAAGGG - Intergenic
1127381507 15:58434481-58434503 GGTCAGGGCAGAGCAGGGAGAGG + Intronic
1127752137 15:62056549-62056571 CGACTTAGCAGACCAGGGAAGGG + Intronic
1127853483 15:62935545-62935567 GGCCAGAGCAGGGCAGAGAAAGG - Intergenic
1128228995 15:66021940-66021962 GGACAGGGCAGTCCAGGGAAGGG + Intronic
1128272555 15:66323785-66323807 AGACAGAAGAGAGGAGGGAAAGG - Intronic
1128338189 15:66802083-66802105 TGACAGAGAGCAGCAGGGCAAGG - Intergenic
1128568745 15:68718334-68718356 TCACAGAGCACAGCAGGGGCAGG - Intronic
1128664055 15:69525446-69525468 TTACAGAGCAGATCCTGGAACGG + Intergenic
1128749712 15:70140250-70140272 TGCCAGAGCAGAGGAGGGGCTGG + Intergenic
1128978176 15:72168154-72168176 GGGCAGAGCAGAGCAGGGAAAGG - Intronic
1129103855 15:73291625-73291647 TGACTGAGCAGTGCCAGGAAGGG + Intronic
1129905846 15:79186646-79186668 CAACAGAGCAGAGCAGGGTGTGG - Intergenic
1129992351 15:79976076-79976098 TGACAGAGCAGCTCAGAGGATGG - Intergenic
1130211169 15:81923916-81923938 GGGCAGAGAGGAGCAGGGAATGG + Intergenic
1130274781 15:82470672-82470694 TTCCATAGCAGAGCAGGGCAGGG + Intergenic
1130274784 15:82470677-82470699 TAGCAGAGCAGGGCAGGGCAGGG + Intergenic
1130589425 15:85202639-85202661 TTCCATAGCAGAGCAGGGCAGGG + Intergenic
1130589428 15:85202644-85202666 TAGCAGAGCAGGGCAGGGCAGGG + Intergenic
1131032964 15:89201808-89201830 AGACAGCGCAGAGCAGGGGGCGG + Exonic
1131217556 15:90551665-90551687 TGATAAAGACGAGCAGGGAAGGG - Intronic
1131833469 15:96368681-96368703 GGATAGAGCAGAGCAGACAACGG - Intergenic
1132005420 15:98222223-98222245 CAACAGAGCAGAACAGGGCATGG - Intergenic
1132457639 16:32988-33010 TGCCAGGGGAGAGCAGGGAAGGG - Intergenic
1132658232 16:1050089-1050111 GGACAGGGCAGGGCAGGGCAGGG + Intergenic
1132860834 16:2070982-2071004 TGAGAGGGCAGGGCAGGGATGGG + Intronic
1132913360 16:2327510-2327532 GGAGAGAGCTGTGCAGGGAAGGG + Intronic
1133101990 16:3485439-3485461 GGAAAGAGAAGAGCAGGGCAGGG - Intronic
1133731594 16:8582908-8582930 GGGCAGGGAAGAGCAGGGAAGGG + Intronic
1133815257 16:9192480-9192502 TGTCAGAGCAGAACAGGTACAGG - Intergenic
1133863172 16:9616227-9616249 TCACAGAGCAGAGTGGAGAAGGG - Intergenic
1134827181 16:17294198-17294220 TGACAAAGCAGAGTGGGGAAGGG + Intronic
1135392503 16:22105414-22105436 TGACAGAGCAGAACAGGAACAGG - Intronic
1135430028 16:22374826-22374848 TCACAGCGCAGATCAGGGGACGG - Intronic
1135504677 16:23026170-23026192 TCACAGAGCACAGCAAGGGATGG + Intergenic
1135730856 16:24894092-24894114 TGAGAGAGCTGAGCCTGGAAAGG + Intronic
1135741187 16:24976542-24976564 AGAAAGAGAAGAGAAGGGAAAGG + Intronic
1136723590 16:32341211-32341233 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1136751380 16:32638360-32638382 AGAAAGAGCTGGGCAGGGAAGGG + Intergenic
1136773351 16:32859124-32859146 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1136841922 16:33547256-33547278 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1136862394 16:33711708-33711730 GGACAGGGCAGAGCAGGGAAAGG - Intergenic
1136897263 16:34002395-34002417 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1137669475 16:50271083-50271105 TTCCAGGGGAGAGCAGGGAACGG - Intronic
1138339182 16:56277426-56277448 GGAATGAGCACAGCAGGGAATGG + Intronic
1138413898 16:56860294-56860316 TGACAGGGGAGAGGAGGGAAAGG - Intergenic
1138534324 16:57651943-57651965 TGAGAGAGCAGAGACTGGAAAGG + Intronic
1139325737 16:66151474-66151496 GGACAGGGCAGGGAAGGGAAGGG + Intergenic
1139450831 16:67027288-67027310 TGGGAGTGCAGAGCAGGGCAGGG - Intergenic
1139661075 16:68421256-68421278 TGCGAGGGCAGAGCTGGGAATGG - Intronic
1140339423 16:74142113-74142135 ATACAGAGAAGAGTAGGGAAGGG + Intergenic
1140488855 16:75317337-75317359 TGCTAGAGCAGAGGCGGGAAGGG - Intronic
1140887695 16:79259199-79259221 GGACTGAGCAGAGCCAGGAAGGG - Intergenic
1141063737 16:80897735-80897757 GGACACAGCAGAGCAGGCCAGGG + Intergenic
1141833665 16:86524057-86524079 TAACAGAGAAGAGCAGTGATGGG - Intergenic
1141855451 16:86678051-86678073 TGTTAGAGCAGCTCAGGGAAAGG - Intergenic
1142005572 16:87688099-87688121 CCCCCGAGCAGAGCAGGGAATGG - Intronic
1142079655 16:88142295-88142317 TGACCTAGCAAAGCAGGGCAGGG - Intergenic
1142334910 16:89481971-89481993 TCATAGATCAGAGGAGGGAAAGG - Intronic
1142445482 16:90133403-90133425 TGTAAGAGCAGAGCAGGTGATGG - Intergenic
1203002841 16_KI270728v1_random:176554-176576 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1203053514 16_KI270728v1_random:897615-897637 AGAAAGAGCTGGGCAGGGAAGGG + Intergenic
1203075770 16_KI270728v1_random:1121234-1121256 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1203123887 16_KI270728v1_random:1559891-1559913 GGACAGGGCAGAGCAGGGAAAGG - Intergenic
1203134447 16_KI270728v1_random:1712960-1712982 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1203152087 16_KI270728v1_random:1847553-1847575 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1142462030 17:102067-102089 TGTAAGAGCAGAGCAGGTGATGG + Intergenic
1142601467 17:1054895-1054917 TGCCAGTGAAGAGCAGGGAGTGG + Intronic
1142668771 17:1477756-1477778 AGACAGGGCAGAGCTGTGAATGG - Intronic
1142800830 17:2344445-2344467 TGAAAGAACAGATAAGGGAAGGG + Intronic
1143290370 17:5823451-5823473 TGACAGGGAAGTGCTGGGAAGGG - Intronic
1143377629 17:6476800-6476822 AGTCAGAGCAGGGCAGGGACAGG + Intronic
1143442364 17:6985206-6985228 TGGCAGAGCAGAGCTCAGAAAGG + Intronic
1143934329 17:10466575-10466597 CAATAGTGCAGAGCAGGGAAGGG - Exonic
1143938813 17:10516472-10516494 CAACAGTGCAGAGCAGGGAAGGG - Exonic
1144057896 17:11558335-11558357 TGGCAGAGCAGAGCGGGGGCCGG + Exonic
1144117116 17:12107242-12107264 TTACAGAACAGAGCAGGATAAGG + Intronic
1144762621 17:17715894-17715916 TGACATAGGAGGGCACGGAACGG - Intronic
1144847288 17:18226501-18226523 GGGCAGGGCAGAGCAGGGCAAGG - Intronic
1146459465 17:33033878-33033900 AGCCAGAGCAGAACAGAGAATGG + Intronic
1146587089 17:34091569-34091591 TGACAGGTCATTGCAGGGAAGGG + Intronic
1146932954 17:36791118-36791140 GGGCAGAGGAGAGCAGGGAGTGG - Intergenic
1147652684 17:42071388-42071410 GGACAGAGCAGACCAGGGAGGGG - Intergenic
1147961779 17:44171987-44172009 AGACAGGGCAGGGCAGGGAGTGG - Intronic
1148231375 17:45937279-45937301 TGACAGGGGAGAGAAGGGAGGGG + Intronic
1148803332 17:50247740-50247762 AGATAGAGCAGAAGAGGGAATGG - Intergenic
1148982050 17:51585620-51585642 TCACAAAGCAGAGCAAAGAACGG - Intergenic
1149457062 17:56796831-56796853 TGTCAGAGTGGAGCAGGGATGGG - Intronic
1149797340 17:59532956-59532978 TTACAGATCAGAGAGGGGAAAGG - Intergenic
1149982771 17:61324390-61324412 TGTCAGGGCAGGGCAGGGAGAGG + Intronic
1150133602 17:62682178-62682200 GGGCAGAGCAGGGCAGGGCATGG - Intronic
1150725021 17:67644718-67644740 TGAAAGAACAGAGCAGGGCCAGG - Intronic
1150750323 17:67855816-67855838 TGTCAGAGCAGGGCATGGAAAGG + Intronic
1150792909 17:68213465-68213487 TGTCAGAGCAGGGAATGGAAAGG + Intergenic
1150959886 17:69901538-69901560 TGACAGAGCAGAATAAGGAGGGG + Intergenic
1151188583 17:72381604-72381626 TGAGAGAGAATAGGAGGGAAAGG + Intergenic
1151272947 17:73011096-73011118 TGACAGCCCAGGGAAGGGAAGGG + Intronic
1152215246 17:79028107-79028129 AGACAGAGTAGAGCAGGAGACGG + Intronic
1152225568 17:79091114-79091136 AGACAGAGCTGAGCAGGGCAGGG + Intronic
1152290256 17:79436284-79436306 TAACAGACCAGGGCAGGGGAAGG + Intronic
1152502859 17:80724750-80724772 TGACACTGCAGAGGAGGGAACGG - Intronic
1152699176 17:81810782-81810804 GGGCAGAGCAGGGCAGGGCAGGG - Intronic
1152699178 17:81810787-81810809 GGGCAGGGCAGAGCAGGGCAGGG - Intronic
1152961667 18:83797-83819 TGCCAGGGGAGAGCAGGGAAGGG - Intergenic
1153092885 18:1368780-1368802 TTAGAGAGCAAAGCAGGAAAAGG - Intergenic
1153257407 18:3185614-3185636 TCACAGAGAAGGGCAGGCAAAGG + Intronic
1153797691 18:8640139-8640161 TCACAGAGCAGAACACAGAAGGG - Intergenic
1154069901 18:11144731-11144753 GGAAAGAGCAGAGCAGAAAAGGG - Intronic
1154176006 18:12087577-12087599 GGACAGGGCAGAACAGGGCAAGG - Intergenic
1155464462 18:26120130-26120152 AGACAGAACAGAGCCGGGACTGG + Intergenic
1155506857 18:26541888-26541910 TGAAAGAGAAGAGTAGGCAAAGG + Intronic
1156312709 18:35939429-35939451 TCACAGAGCAGAGCAGGGCAGGG + Intergenic
1156473960 18:37394254-37394276 GGGCAGCGCAGAGCAGGGAGAGG + Intronic
1156611711 18:38732642-38732664 TGACAGACCAAAGTAAGGAAAGG + Intergenic
1156666230 18:39411163-39411185 TGACAGGGTAGAGGAGGGAAAGG - Intergenic
1157221178 18:45829361-45829383 TCAGAGAGCAGAGGAGGGAGAGG - Intronic
1158504016 18:58030043-58030065 TGAGAGTGCAGAGAAGGGGAGGG + Intergenic
1158541700 18:58362149-58362171 AGACAGAGCAGGCAAGGGAACGG + Intronic
1158632442 18:59127337-59127359 TCACAAAGCAGGGCAAGGAAGGG + Intergenic
1159026195 18:63184005-63184027 TGACAGAGCAGAAGAGAAAAAGG + Intronic
1159116148 18:64115068-64115090 TGAAAGAACACACCAGGGAAAGG + Intergenic
1159205082 18:65239245-65239267 TGGTAGAGCAAAGCAGGGCAGGG + Intergenic
1159304609 18:66624697-66624719 TGGCAGAGCAGAAAATGGAAAGG - Intergenic
1159474166 18:68897272-68897294 TGAAAGAGAAAAGCAGGGACTGG + Exonic
1159804191 18:72935821-72935843 TGAAAGTGCTGAGCAGGGATAGG + Intergenic
1160032240 18:75272108-75272130 CGACAGAGCAGAGAGGGGAGGGG + Intronic
1160038197 18:75320558-75320580 TGACTGGGCAGGGCGGGGAAGGG + Intergenic
1160201036 18:76795663-76795685 TGAAAGAAAAGAGAAGGGAAGGG + Intronic
1160345477 18:78128602-78128624 TCAGACAGCAGAGCAAGGAAGGG + Intergenic
1160454072 18:78985112-78985134 TGGCAGGGCAAAGCAGGCAAAGG - Intronic
1160651733 19:234435-234457 TGTAAGAGCAGAGCAGGTGATGG + Intergenic
1161600451 19:5179287-5179309 TTACAGGACAGGGCAGGGAAGGG + Intronic
1161649864 19:5477897-5477919 GGACAGGGCAAAGTAGGGAAGGG - Intergenic
1162060027 19:8089473-8089495 GGAAGGAGCAGAGCAGGGCAGGG - Intronic
1162224353 19:9207723-9207745 TGAAAGAGCTGAGTAGAGAAAGG - Intergenic
1162647101 19:12057758-12057780 TGAAAGTGAAAAGCAGGGAATGG + Intergenic
1163176349 19:15566478-15566500 GGTCAGAGGAGACCAGGGAATGG - Intergenic
1163272120 19:16260664-16260686 TGGCAGAGCAGGGCAGGGTGGGG - Intergenic
1163484099 19:17576362-17576384 TTACAGAGCAGGGAAAGGAAGGG + Intronic
1163554772 19:17985596-17985618 GAAAAGAGCAGAGCAGGGGAGGG - Intronic
1164143679 19:22496196-22496218 CGGCACAGCAGAGGAGGGAAAGG + Intronic
1164524217 19:29001488-29001510 TGGCAGAGGAGGGCAGGGAGGGG - Intergenic
1164598897 19:29548104-29548126 AGAGAGGGCACAGCAGGGAATGG + Intronic
1164601165 19:29564611-29564633 TGTCAGAGCACAGGAGGGAACGG - Intergenic
1164753555 19:30673141-30673163 TGACAGTGCAGATGAGGAAACGG - Intronic
1165175825 19:33929142-33929164 TCACTGAGCAGAGCAGGCACAGG - Intergenic
1165726319 19:38115421-38115443 GCACAGAGCAGGGCAGAGAACGG + Intronic
1165904950 19:39187984-39188006 TGATAGAGAATAGCAGGGAAGGG + Intergenic
1166276228 19:41756230-41756252 GGAAGGAACAGAGCAGGGAAAGG + Intronic
1166423316 19:42654804-42654826 GGAGGGAGCAGAGCAGGGAAAGG + Intronic
1166432510 19:42739465-42739487 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166435630 19:42764673-42764695 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166445497 19:42854706-42854728 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166448489 19:42878674-42878696 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166452894 19:42916870-42916892 AGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166455384 19:42936167-42936189 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166465171 19:43025450-43025472 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166471304 19:43081632-43081654 TTAGGGAGCAGAGCAGGGAAAGG - Intronic
1166482452 19:43185532-43185554 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166484927 19:43204617-43204639 GGAGGGAGGAGAGCAGGGAAAGG - Intronic
1166492057 19:43268535-43268557 GGAGGGAGCAGAGCAGGGAAAGG - Intronic
1166662514 19:44656665-44656687 AGACAAAGCAGAGAAGGGAATGG + Intronic
1166688627 19:44810102-44810124 AGATTGAGCAGAGAAGGGAAGGG + Intronic
1166816483 19:45549360-45549382 TGTCAGGGCAGGGCAGGGCAGGG + Intronic
1167211400 19:48136130-48136152 GGAGAGAGCAGGCCAGGGAAGGG + Intronic
1167211778 19:48138028-48138050 GGACAGAGCAGAGAAGGCCAAGG + Intronic
1167555588 19:50193191-50193213 TGTCTGAGCAGAGGAGGGACAGG + Intronic
1168098535 19:54128837-54128859 TCACAGAGCAGTGCTGGGACCGG + Intronic
1202692176 1_KI270712v1_random:100392-100414 GGACAGGACAGAGCAGGGCAAGG + Intergenic
925228946 2:2213365-2213387 GGACAGAGCACTGCAGAGAAGGG + Intronic
925358370 2:3259573-3259595 TCACAGAGTAGAGAAGGCAATGG + Intronic
925830957 2:7895192-7895214 GGACAGAGCAGCGCCTGGAAAGG - Intergenic
926038843 2:9656569-9656591 AGGCTGAGCACAGCAGGGAAAGG - Intergenic
926572097 2:14541139-14541161 TGTTATAGCAGAGCACGGAATGG + Intergenic
926704209 2:15825391-15825413 TGACCCAGCAGAGGAAGGAAGGG - Intergenic
926958821 2:18332229-18332251 AGCCAGAGCAGAGCAGAGGATGG - Intronic
927266882 2:21162087-21162109 AGCCAGAGCAGAGCAGAGGATGG - Intergenic
927893467 2:26766717-26766739 TGAAAGGGCAGAGCAGGGCCTGG - Intronic
928086515 2:28349678-28349700 GGACACAGCAGAGGAGGGACAGG + Intergenic
928238749 2:29568616-29568638 TTACAGAGCAGGGGAGGGAAGGG - Intronic
928324297 2:30307524-30307546 TGACAGGCCAGAGTAGGGAAGGG - Intronic
928392187 2:30918595-30918617 TGACAAAGCACAGGAAGGAAGGG + Intronic
930176012 2:48302549-48302571 TGACAGAGCAGCTGGGGGAAGGG - Intergenic
930402401 2:50906956-50906978 TGAGAGAGGAGGGCAGGAAAAGG - Intronic
930531366 2:52592437-52592459 TGACAGAGAGGAGGAGGGAGAGG + Intergenic
930951381 2:57147105-57147127 GGACAGAGCACTGCAGGGGAGGG + Intergenic
931289653 2:60861498-60861520 GCACAGAGCAGGGCAGAGAAGGG - Intergenic
931853107 2:66273785-66273807 AAACAGAGAACAGCAGGGAAGGG + Intergenic
932051526 2:68403333-68403355 GGACAGAGCAGCTGAGGGAAGGG - Intergenic
933275990 2:80284942-80284964 TGAGATAGCAGAGCAGAAAATGG - Intronic
933384868 2:81597360-81597382 CTACCGAGCAGAGCAGGGAAAGG - Intergenic
933954222 2:87353580-87353602 GGACAGGACAGAGCAGGGCAAGG - Intergenic
934238417 2:90249800-90249822 GGACAGGACAGAGCAGGGCAAGG - Intergenic
934274774 2:91566910-91566932 GGACAGGACAGAGCAGGGCAAGG + Intergenic
934322531 2:91982325-91982347 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
934460839 2:94213142-94213164 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
934748405 2:96775238-96775260 TGAGGGAGCAGGGCAGGGACTGG - Intronic
934913568 2:98279852-98279874 GTACAGAGCAGGGCAAGGAAGGG + Intronic
935071246 2:99695626-99695648 TAACACAGCAAAGTAGGGAAGGG - Intronic
935289923 2:101601452-101601474 TGAGAGAGCAGAGGTGGGCAAGG - Intergenic
935804020 2:106728940-106728962 TGACACAGCACAACTGGGAAAGG + Intergenic
936787011 2:116105620-116105642 TAACAGAGCATAGAAGAGAATGG - Intergenic
937064445 2:119006582-119006604 GGACAAAGCAGGGCAGGGCAGGG - Intergenic
937094981 2:119229447-119229469 GGCCACAGCAGAGCAAGGAAAGG + Intronic
937714317 2:125014248-125014270 GGACAGAGAAGAGCAAGGAGTGG + Intergenic
938104349 2:128520022-128520044 GCACAGAGCAGAGCAGGGCATGG + Intergenic
938120878 2:128632264-128632286 TGAGAGAGCAGGCCTGGGAAGGG - Intergenic
938379642 2:130829313-130829335 TGACACAGCGGAGCAGGGGTGGG + Intergenic
939014501 2:136886327-136886349 TGGCTGAGAAGAGCAGGGCAAGG + Intronic
939356926 2:141114548-141114570 TGACAGAGGAGAGAAGAGAAGGG - Intronic
939436069 2:142179844-142179866 TAACACAGCAGACCAGGGCAAGG + Intergenic
939557548 2:143694416-143694438 TGTCAGACCAGTGCAGGTAACGG + Intronic
939575824 2:143893467-143893489 TGACAGGGGTGAGAAGGGAATGG - Intergenic
939712969 2:145546482-145546504 CAAAAGAGCACAGCAGGGAAGGG - Intergenic
940462887 2:153989737-153989759 TGACATATGAGAGCAGGAAAAGG - Intronic
941995715 2:171600403-171600425 GGCCAGAGTAGATCAGGGAAAGG - Intergenic
943112300 2:183621561-183621583 GGACAGAGCACCTCAGGGAAGGG - Intergenic
944087228 2:195863492-195863514 GTACAGAGCAGAGCAGAAAAAGG - Intronic
944158229 2:196631960-196631982 TCACAGAGCAGAGAATAGAATGG + Intergenic
944681022 2:202076846-202076868 ATGCAGAGCAGAGCAGGGGAAGG - Intronic
944827602 2:203501221-203501243 AGTCAGAGCAGAGAAGGGAAAGG + Intronic
944899334 2:204198435-204198457 TGAGACAGGAGAGCAGGAAAAGG - Intergenic
945254245 2:207790745-207790767 GGACAGAGTGGAGCAGGGAGAGG + Intergenic
945282402 2:208048162-208048184 GGGCAGGGCAGGGCAGGGAAGGG - Intergenic
945371757 2:209027100-209027122 AGACAGAGCAGAAAAGGGAGAGG + Intergenic
945515330 2:210757089-210757111 TGACAGAGCAGGGAGGAGAAAGG + Intergenic
945944419 2:215980887-215980909 GGACAGGGCAGGGCAGGGAAGGG + Intronic
946129408 2:217594204-217594226 TTTCAGGTCAGAGCAGGGAATGG - Intronic
946181017 2:217948954-217948976 TGTCAGGGCAGAGGATGGAAAGG + Intronic
946336103 2:219037664-219037686 GCTCAGAGCAGAGCAGGGAAGGG + Intronic
946546481 2:220749569-220749591 GGACAGAACAGAACAGGGCAGGG + Intergenic
946735855 2:222753923-222753945 TGAGAAAGCAGAGAAAGGAAAGG - Intergenic
947202153 2:227623439-227623461 TGAAAGAGCATTCCAGGGAAAGG + Intronic
947331380 2:229033024-229033046 TGCCACAGATGAGCAGGGAATGG - Intronic
947577809 2:231290587-231290609 TGCCAGGGAAGAGGAGGGAAAGG + Intronic
947612621 2:231533224-231533246 CCACAGAGCAGAGCTGGGTAGGG - Intergenic
947877546 2:233477697-233477719 TGCCAGTGCAAAGCAGGGGAAGG - Intronic
948107481 2:235427278-235427300 TGACCCAGCAGAGCAAGCAAAGG + Intergenic
948691403 2:239707133-239707155 GGGCAGGGCAGGGCAGGGAAGGG - Intergenic
948691458 2:239707293-239707315 GGGCAGGGCAGGGCAGGGAAAGG - Intergenic
948691461 2:239707303-239707325 GGGCAGAGCAGGGCAGGGCAGGG - Intergenic
948691481 2:239707363-239707385 GGGCAGGGCAGGGCAGGGAAGGG - Intergenic
948691540 2:239707533-239707555 GGGCAGAGCAGGGCAGGGCAGGG - Intergenic
948694071 2:239724421-239724443 TGGCAGAGCAGAGCAAAGCACGG - Intergenic
948922143 2:241070862-241070884 GGACAGAGCAGAGCAGTGCGCGG + Intronic
1168898650 20:1341594-1341616 AGGCTAAGCAGAGCAGGGAAAGG - Intronic
1168963431 20:1884161-1884183 TGAAAGGGCTGAGCAGGGAAGGG + Intergenic
1169004297 20:2193990-2194012 TGACAGAGCGGAGTGGGGGAAGG - Intergenic
1169064250 20:2685211-2685233 TGACACAGCAGAGTAGGGATAGG + Intergenic
1170701725 20:18709757-18709779 TGACAGATGAAAACAGGGAATGG + Intronic
1171368311 20:24642402-24642424 TGACAGAGTACAGCATGGGAAGG - Intronic
1172259078 20:33546513-33546535 TGCTAGAGCTGAGCAGGTAAAGG - Intronic
1172718697 20:36983114-36983136 AGAGAGAGCAGAGGAGAGAAGGG - Intergenic
1172959570 20:38789018-38789040 TGTTAGAGGAGGGCAGGGAAGGG + Intergenic
1173315778 20:41941824-41941846 CAAAAGAGCAGAGCTGGGAAAGG - Intergenic
1173456157 20:43203296-43203318 TTACAGAGCAGAGCAAGGAAAGG + Intergenic
1174536380 20:51254650-51254672 TCACAGGGCAGAGCACAGAAGGG + Intergenic
1174540418 20:51285105-51285127 TGTCATAGCAGAGCCGGGACTGG + Intergenic
1174562148 20:51439086-51439108 GGGCACAGCAAAGCAGGGAAGGG - Intronic
1174712064 20:52717365-52717387 TGACAGATCAGAAAAGGGTAGGG - Intergenic
1175044517 20:56092495-56092517 GCAAAGAGCAGAGAAGGGAAAGG + Intergenic
1175143095 20:56875005-56875027 GGTCAGAGCAGAGCAAGGCAAGG + Intergenic
1175277951 20:57784594-57784616 TTAGAGAGCAGAGCATGGGAAGG + Intergenic
1175309920 20:58004735-58004757 TGAAAGAAAAGAGAAGGGAAAGG - Intergenic
1175959548 20:62628544-62628566 GGCCAGAACAGAGCAAGGAAGGG - Intergenic
1176591966 21:8656184-8656206 GGGCAGGGCAGAGCAGGGCAAGG - Intergenic
1176891584 21:14325903-14325925 TGACAAAGTAAAGCTGGGAAAGG - Intergenic
1176979590 21:15365820-15365842 TGAGGCAGCACAGCAGGGAACGG + Intergenic
1177931416 21:27288707-27288729 TGAAAGAGAAAATCAGGGAAGGG - Intergenic
1178179483 21:30143723-30143745 TGACAAAGCAAGGCGGGGAATGG + Intergenic
1178798840 21:35772884-35772906 AGACAGAGCAGGGCAGAGGAGGG - Intronic
1179435911 21:41361964-41361986 TGACGGAGCAGGGGAGGGAGTGG + Exonic
1180022798 21:45139510-45139532 TGGTAGAGCAGAGTGGGGAATGG + Intronic
1180042204 21:45286740-45286762 AACCAGCGCAGAGCAGGGAAAGG - Intronic
1180118337 21:45726544-45726566 TGACAGGGGAAAGCAGGGATGGG - Intronic
1180274814 22:10633313-10633335 GGGCAGGGCAGAGCAGGGCAAGG - Intergenic
1180549282 22:16528229-16528251 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1180784285 22:18538334-18538356 TGACTGAGGAGAGCAGGGTGTGG + Intergenic
1180958290 22:19750866-19750888 TGGCAGGGCAGGGCAGGGCAGGG - Intergenic
1181006154 22:20014665-20014687 TGACAGGGTAGAGCTGGGATAGG - Intronic
1181127856 22:20712387-20712409 TGACTGAGGAGAGCAGGGTGTGG + Intronic
1181241188 22:21477691-21477713 TGACTGAGGAGAGCAGGGTGTGG + Intergenic
1181355409 22:22293607-22293629 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1181513310 22:23398428-23398450 TCCCAGTGCAGAGCAGGGCAGGG - Intergenic
1182144757 22:27990603-27990625 AGGCAGAGCAGAGAAGGGGACGG + Intronic
1182148869 22:28014531-28014553 TGAAAGGGAAGAGAAGGGAACGG - Intronic
1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG + Intronic
1182946784 22:34331633-34331655 AGACTGAGCAGAGGAGGAAATGG - Intergenic
1183252198 22:36738063-36738085 TGGCAGGGCAGGGCAGGGCAGGG - Intergenic
1183310849 22:37108790-37108812 GGGCAGAGCAGAGCAGAGCAGGG + Intronic
1183349905 22:37329330-37329352 AGGCAGGGCAGAGCAGGGATAGG + Intergenic
1183538273 22:38415614-38415636 TGGCAGAGCAGGGCAGGGCGCGG + Intergenic
1183781455 22:40001792-40001814 TTGCAGAGCAGAGGAGGGAAGGG + Intronic
1184258783 22:43302633-43302655 TGACAGAGCCAGGCTGGGAACGG + Intronic
1184462423 22:44646746-44646768 TGACAGTGCAGAGAAGGGCAGGG + Intergenic
1184857194 22:47152785-47152807 CGGCAGAGCAGAGGAGGGACGGG + Intronic
1184914454 22:47559482-47559504 TGAGGAAGCAGAGGAGGGAAGGG + Intergenic
1184991762 22:48175096-48175118 TTATAGAGAAGAGAAGGGAAAGG - Intergenic
1185015167 22:48338748-48338770 TGCCAGGGCAGAGCAGGCCACGG + Intergenic
1185115359 22:48931720-48931742 TGTCAGAGCAAAACAGGGAGGGG - Intergenic
1185219655 22:49622954-49622976 CCATAGAGCAGAGCAGGGAACGG + Intronic
949283710 3:2376865-2376887 TGACAGAGCTCAGCAGGGCGCGG + Intronic
949421392 3:3870029-3870051 TGACAGAGCAGTACAGCCAAAGG + Intronic
949494549 3:4619591-4619613 GGGCAGAGGAGAGCAGGGGAGGG - Intronic
949494591 3:4619771-4619793 GGGCAGAGGAGAGCAGGGGAGGG - Intronic
949494597 3:4619791-4619813 GGGCAGAGGAGAGCAGGGGAGGG - Intronic
949836492 3:8275482-8275504 TGTCAGAGCAGCCCAGGGAAGGG + Intergenic
949865320 3:8542414-8542436 TGCCAGTGCAGAGCCGTGAAAGG + Intronic
949920830 3:8999233-8999255 TGGCAAAGCAGAGCAGTGGAGGG + Intronic
950132193 3:10554938-10554960 TGGCAGAGAATGGCAGGGAAGGG - Intronic
950247088 3:11430917-11430939 AGAAAGAGTAGAGAAGGGAAGGG + Intronic
950262561 3:11553523-11553545 GGACTGAGCAGTGCAGGGCAGGG - Intronic
950772814 3:15325649-15325671 GGACAGAGCAGTGAAGAGAATGG - Intronic
950826482 3:15828208-15828230 TGACAAAGAATTGCAGGGAATGG + Intronic
950908959 3:16567492-16567514 GGACAGAGCTGAACAGAGAATGG + Intergenic
951614444 3:24525541-24525563 TGACAAGGAAGAGAAGGGAACGG + Intergenic
952210163 3:31222326-31222348 TTACAGAGCAGAGGGGAGAAAGG - Intergenic
952493839 3:33898734-33898756 AGACAGAGCAGAGCAGAGCATGG - Intergenic
952648817 3:35697227-35697249 TGACAGTGCAGAGCAAATAAAGG + Intronic
953150494 3:40320018-40320040 AGACAGAGAAGGGAAGGGAAGGG - Intergenic
953216572 3:40924066-40924088 GCACAGAGCAGGGCAGGGGAGGG - Intergenic
953343938 3:42159759-42159781 TGACAGCGCTGAGCAGAGGAAGG - Intronic
953970074 3:47340347-47340369 GGACAGAGAAGAGCAGGGAGGGG + Intronic
954110824 3:48431823-48431845 GATCAGAGGAGAGCAGGGAAGGG - Intergenic
954294003 3:49664175-49664197 AGGCAGAGAAGAGCAGGAAAGGG - Intronic
954412251 3:50375912-50375934 GGACAGAGCAGAGGAGTGTAGGG - Intronic
955898223 3:63723959-63723981 TGGCTGAGTACAGCAGGGAAAGG - Intergenic
955927065 3:64017463-64017485 TGACTGAGGGAAGCAGGGAAGGG + Intronic
955957946 3:64309802-64309824 AGTTAGAGCAGAGAAGGGAAGGG - Intronic
956105113 3:65809480-65809502 TGACAGAGAAGAGAAATGAATGG + Intronic
956505073 3:69929271-69929293 GGACAAAGCAGAGCAGAGGAGGG + Intronic
956699756 3:71948482-71948504 CTGCAGAGCAGAGCAGGGGAAGG + Intergenic
956710483 3:72034903-72034925 ATACAGAGCAGAGCAGGGGTGGG - Intergenic
956727999 3:72172360-72172382 GCACAGAGCAGAGCAGCTAAAGG - Intergenic
957011185 3:75008175-75008197 GGACAGAGCACATGAGGGAAGGG - Intergenic
957346353 3:78966190-78966212 AGACAGAGAGGGGCAGGGAATGG - Intronic
957678778 3:83404460-83404482 AGGCAGAGCAGAGCAGAGGATGG + Intergenic
957931021 3:86878482-86878504 TGTCACAGCAGAGCAGGAGAAGG - Intergenic
958560099 3:95737322-95737344 TCACAGAGCAGAGTATAGAAAGG + Intergenic
959147714 3:102569622-102569644 TGGCAGAGCAGTGCAGGGCCTGG - Intergenic
959554279 3:107698917-107698939 TCACAGAGCAGGGCATGGCAAGG + Intronic
959593002 3:108099847-108099869 GGTCATAGCAGGGCAGGGAAGGG - Intergenic
959594520 3:108114666-108114688 TCACAGAGAAGAGCAGTGAGTGG - Intergenic
959681099 3:109097507-109097529 TGACACAGAAGAGAGGGGAAGGG + Intronic
960703311 3:120458359-120458381 TGAAACAGCAGAGCTGGGAAAGG + Intergenic
961032728 3:123620496-123620518 TGACAGTGCTGAGCAGAGCAAGG - Intronic
961447269 3:126986742-126986764 TGACTGAGCAGGGCGGGGAGTGG + Intergenic
961700197 3:128737964-128737986 AGACAGGGCAGAGCTGGGCATGG - Intronic
961701156 3:128745687-128745709 AGACACAGAAGAGCAGGGAAGGG + Intronic
961714707 3:128850307-128850329 AGACAGAGAAGAGCAGGGCAGGG + Intergenic
962204850 3:133425987-133426009 GGGCAGGGCAGGGCAGGGAAAGG + Intronic
962359335 3:134724259-134724281 TGACAGAGCAGAAGAGAGAACGG - Intronic
962370433 3:134816930-134816952 AGACCCAGCAGAGCAAGGAAAGG + Intronic
962896160 3:139716768-139716790 AGACAGGGCAGAGCAGTGATGGG + Intergenic
963068413 3:141281951-141281973 TGAGAGAGCCGGGCAGTGAAAGG + Intronic
963085104 3:141429181-141429203 TCAAAAAGCAGAGCAGGGCAAGG + Intronic
963445058 3:145395296-145395318 TGGCAGTGCAGAGAAGGGAAGGG + Intergenic
963604086 3:147399261-147399283 TGAAGGATCAGAGCAGGGGAAGG - Intronic
964042669 3:152281447-152281469 TGAAAGAGCAGACTATGGAATGG + Intronic
964398636 3:156274318-156274340 TTACAGAGCAGGGCAGGAACAGG - Intronic
964806639 3:160617494-160617516 TGAGGGAGCAGAGGAGGAAAGGG - Intergenic
964877161 3:161380527-161380549 TGAATGACCAGAGTAGGGAATGG - Intergenic
965360719 3:167735217-167735239 TGACAGAGCAGAGGAAGGAAGGG + Intergenic
965389438 3:168086897-168086919 AGACAGCACAGAGCAGTGAAGGG + Intronic
965627558 3:170696793-170696815 TGAAAGAGCTGGGCAGAGAAAGG + Intronic
966269149 3:178083834-178083856 TGACAGGGCAGGGCAGGGCAGGG - Intergenic
966574694 3:181487123-181487145 TGACCTAGCAGAGCAAGGGAGGG + Intergenic
966612316 3:181879966-181879988 AGAAAGAGAAGAGCAAGGAAAGG - Intergenic
966621566 3:181969700-181969722 TGACAGAGAAGAGTAGATAAAGG + Intergenic
967339924 3:188385386-188385408 TGACAGAGCTGAGAGGGGAAGGG + Intronic
967512003 3:190322892-190322914 TGACAGAAGAGAGCAGAGAGAGG - Intronic
967782229 3:193452227-193452249 GGACAGAGCAGAATTGGGAATGG - Intronic
968320537 3:197764238-197764260 TTACAGAGCATAAGAGGGAAGGG + Intronic
968366098 3:198185533-198185555 TGTAAGAGCAGAGCAGGTGATGG - Intergenic
968467929 4:762304-762326 GGACAGAGCAGAGGACGGACTGG + Intronic
968627643 4:1634358-1634380 ACACAGAGGAAAGCAGGGAAGGG + Intronic
968644193 4:1730782-1730804 CGGCACAGCAGTGCAGGGAAAGG + Intronic
968921150 4:3522803-3522825 CCCCAGAGCAGAGCAGGGCAGGG + Intronic
969051111 4:4373628-4373650 TCACAGACCAGAGTGGGGAAAGG + Intronic
969060020 4:4426885-4426907 TGTCAGAGCAGAGCTGAGATGGG - Intronic
969094374 4:4720796-4720818 GGACAGAACAGGGTAGGGAAGGG + Intergenic
969824715 4:9748217-9748239 TGGCAGACCAGAGCGGGGAGTGG + Intergenic
969855536 4:9996368-9996390 GCATAGAGCAGAGCAGGGAGGGG - Intronic
970540176 4:17069875-17069897 GGAGAGAGGAGAGAAGGGAAGGG + Intergenic
970647726 4:18142034-18142056 TGACAGAAGAAAGCAGGCAAAGG - Intergenic
971433176 4:26590124-26590146 TGGCAGAGCACAGGAGGAAAAGG - Intronic
972340212 4:38146310-38146332 TGAGAGGGCAGAGCAAGCAAGGG - Intergenic
972367069 4:38385999-38386021 TGACAGATCAGAGAACAGAAAGG + Intergenic
972796628 4:42427782-42427804 TCACAGCGCAGAGCAGCGTAAGG + Intronic
973177599 4:47227116-47227138 TTACAGAGAGGAGCAGAGAAGGG - Intronic
973335705 4:48954365-48954387 AGAGAGAGCAGAGAAGGGGAGGG - Intergenic
974449596 4:62036179-62036201 TGCCATACCAGAGCAGAGAAAGG + Intronic
974923165 4:68267092-68267114 TAAAAGAGTAGAGCAGGCAATGG - Intergenic
975425876 4:74227034-74227056 GGCCAGACCAGGGCAGGGAAGGG - Intronic
975461331 4:74657006-74657028 TGAGAGATCAGAGTAGGCAAGGG + Intergenic
975469322 4:74747215-74747237 AGACAGAGCAGGGCAGAGAAAGG - Intronic
975528158 4:75373756-75373778 ATACAGAGCAGAGCAGGGAAAGG + Intergenic
976435132 4:85009272-85009294 TCACAAAGCAGAGCAGAGAATGG - Intergenic
976441279 4:85077833-85077855 TTTCACAGGAGAGCAGGGAATGG + Intergenic
977161109 4:93636913-93636935 TGGCAGAACAGGGCAGGGGATGG - Intronic
978166521 4:105615188-105615210 TGAAAGTGCAGAGTAGGGACTGG + Intronic
978229888 4:106385773-106385795 AGCCAGAGCAGAGCAGAGGATGG - Intergenic
979453798 4:120903585-120903607 CAACTGGGCAGAGCAGGGAATGG + Intronic
979843082 4:125470545-125470567 GGACAAAGCAAAGCAGTGAATGG - Intronic
979871133 4:125823529-125823551 TGAGAGAGCAGAGCAAGAAGGGG + Intergenic
980249464 4:130295962-130295984 GGGCAGGGCAGGGCAGGGAAGGG - Intergenic
981037404 4:140186951-140186973 AGACAGAACAGAGGAGGAAAAGG + Intergenic
981162524 4:141515542-141515564 TGTCAGAGGAGAGCAGGGGAAGG + Intergenic
981182611 4:141763587-141763609 TGACACTGCAGACCAGGAAATGG + Intergenic
981601068 4:146489282-146489304 TAACAGAGAAGGGCAGAGAAGGG + Intronic
981602269 4:146503557-146503579 GGACAGAGAAGACCTGGGAAAGG - Intronic
981787364 4:148496944-148496966 TGAGAGTTCAGAGTAGGGAAGGG - Intergenic
981800371 4:148648507-148648529 TCACAGAGCAGAGTATAGAATGG + Intergenic
982628748 4:157804229-157804251 AAACAGAGCAGAGCAGGGGGAGG - Intergenic
983442843 4:167809594-167809616 TGACAGAGCAAGTCTGGGAAAGG - Intergenic
984708266 4:182863606-182863628 TGCCAGAGGAGAGCAGGGAAGGG - Intergenic
986744758 5:10734145-10734167 ACACAGAGCAGAGCCTGGAAGGG + Intronic
986749523 5:10774447-10774469 TGATGCAGCAGAGCAGGGGATGG - Intergenic
986971859 5:13346203-13346225 AGACAGAGGAGGGCAGGGAGTGG + Intergenic
987315573 5:16720106-16720128 TGTCAGGGCAGAGCAGGGACTGG - Intronic
987379000 5:17266369-17266391 AGACAGAACAGAGCAAGCAAGGG - Intronic
988412779 5:30908586-30908608 TGACTGAGCATAGCAGTGACTGG - Intergenic
988449022 5:31321052-31321074 TGAAAGAGCAGAGCAGAACAAGG - Intronic
990316342 5:54586360-54586382 GGACAGAGCAGAGCTGGCCATGG + Intergenic
990558284 5:56957984-56958006 GGCCAGAGCAGAGCAGGAAAAGG + Intronic
990732100 5:58820430-58820452 TGCACCAGCAGAGCAGGGAAGGG - Intronic
990861764 5:60335281-60335303 TGAGAGAGTAGAAAAGGGAAGGG + Intronic
991155037 5:63424153-63424175 TGACACAGCAGAAAAGTGAAGGG - Intergenic
992719465 5:79545895-79545917 TGAAAGAGCAAAGAAGGGACTGG - Intergenic
993156307 5:84228935-84228957 TGAGAGACAAGAGCAGGAAAGGG - Intronic
993183178 5:84581790-84581812 TTAGAGAGCAAAGCAGGAAAAGG - Intergenic
993390719 5:87317280-87317302 TGGCAAAGCAGAGCAGCTAAGGG - Intronic
994491424 5:100449869-100449891 TTACAGTGCAGAACATGGAAAGG - Intergenic
994827119 5:104727839-104727861 TGACAGAACAGGGCAGGGTCAGG + Intergenic
994955516 5:106526293-106526315 TCAGAGAGCAGAAAAGGGAAGGG - Intergenic
995169156 5:109086572-109086594 TGACAAAGCAAGGCAGGAAAAGG - Intronic
996559322 5:124811678-124811700 TGGCAAAGCAGAGGAGGCAAGGG + Intergenic
996559382 5:124812461-124812483 TGAGAGAGCAGAGCTCAGAATGG - Intergenic
997818164 5:137037810-137037832 TGGCACAGCTGAGCAGGGAGAGG + Intronic
999177008 5:149638869-149638891 GCACAGAGCAGAGCAAGGCAGGG - Intergenic
999933348 5:156457940-156457962 AGACATAGCATAGCTGGGAAAGG - Intronic
999988116 5:157023848-157023870 TGACAGTGCAAAGCTGGGCATGG + Intergenic
1001134397 5:169090427-169090449 TCACAGAGCAGAGCAGGTGAAGG + Intronic
1001237448 5:170042205-170042227 TGACAGAGCTGAGGATGGATTGG - Intronic
1001753919 5:174151768-174151790 AGGCAGAGCAGGGCAGGAAATGG - Intronic
1001866903 5:175113972-175113994 TGAAAGAGAAGGGAAGGGAAGGG + Intergenic
1001993142 5:176133806-176133828 GGAAAGAGCTGGGCAGGGAAGGG + Intergenic
1002448733 5:179307203-179307225 TGGCGGAGCACAGCAGGGCAGGG - Intronic
1002725324 5:181290758-181290780 TGTAAGAGCAGAGCAGGTGATGG - Intergenic
1003145480 6:3506539-3506561 TGAGAGAGGAGAGAAGGGAAAGG + Intergenic
1004506184 6:16248733-16248755 TGACAGAGCAGAGCAGGGAAAGG - Intronic
1004623316 6:17350598-17350620 TGACTGATCAGAGTAGTGAAGGG - Intergenic
1004754415 6:18596485-18596507 AGACAGAGGAGAGAAGGGAAGGG - Intergenic
1005472867 6:26179103-26179125 GGGCAGGGCAGGGCAGGGAAGGG + Intergenic
1005716425 6:28553734-28553756 TCATAGAGCAGGGCACGGAAGGG - Intergenic
1006945777 6:37783674-37783696 AGACAGAGCAGCACAGGGAGGGG - Intergenic
1007718728 6:43872643-43872665 TGGCAGGCCAGAGCAGAGAATGG + Intergenic
1008274819 6:49530587-49530609 AGACTGAGCCCAGCAGGGAAGGG - Intergenic
1008475081 6:51927733-51927755 AGAAAGAGCAGAGCAGAGAAAGG + Intronic
1009812719 6:68689404-68689426 GTACAAAGCAGAGCAGAGAATGG + Intronic
1010121363 6:72379360-72379382 TTCAAGAGCAGAGGAGGGAAGGG + Intronic
1010196867 6:73248308-73248330 AGACAGAGGAGAGAGGGGAAGGG - Intronic
1010768892 6:79806015-79806037 GCACAGAGCTGAGCAGAGAAGGG + Intergenic
1011163651 6:84421179-84421201 GGACAGAGCAGAGCAAACAATGG + Intergenic
1011200938 6:84835454-84835476 GGGCAGAGCAGGGCAGAGAATGG - Intergenic
1013840460 6:114386555-114386577 TCTCAGAGAAGAGAAGGGAAGGG + Intergenic
1014138767 6:117917538-117917560 TGACAGGGCAGATGAGGGAGAGG + Intronic
1014255132 6:119153599-119153621 AAACAGACCTGAGCAGGGAATGG + Intergenic
1015073394 6:129124904-129124926 TGTCAGAACACAGGAGGGAAGGG + Intronic
1015195919 6:130524670-130524692 AAACAGAGCAGAACAGGGCATGG - Intergenic
1016638508 6:146322500-146322522 GGACAGAGCACCTCAGGGAAGGG - Intronic
1017364625 6:153620625-153620647 TGAAGCGGCAGAGCAGGGAAGGG - Intergenic
1017395236 6:153991249-153991271 CGACAGAGCAGGGCAGAGAAGGG - Intergenic
1017457959 6:154619710-154619732 TGACAGAGGAAGGCAGGGCAGGG + Intergenic
1017821234 6:158050399-158050421 TGAATGACCAGAGCAGGGAATGG - Intronic
1018101560 6:160445364-160445386 TGCCAGGGCAGGGCAGGGACTGG + Intronic
1018489150 6:164273869-164273891 TGACAGAGCAGGGAAGGAAGAGG - Intergenic
1018725789 6:166612518-166612540 TGACAGACCAGGGCGAGGAAAGG + Intronic
1018730674 6:166647484-166647506 TGACGGTGTAGAGTAGGGAAGGG - Intronic
1018842005 6:167524196-167524218 AGAGAGAGAAGAGCAGGGATGGG + Intergenic
1018872480 6:167794135-167794157 TGACAGAGAATGGCAGGGAATGG - Intronic
1019103621 6:169650978-169651000 AGAACAAGCAGAGCAGGGAAGGG + Intronic
1019307747 7:343945-343967 TGACTGGGCAGGGGAGGGAAGGG + Intergenic
1019841726 7:3453024-3453046 GGACAGAGCTGAGGAGGCAATGG - Intronic
1019851281 7:3560769-3560791 TGGAAGAGCAGAGCTGGGGAGGG - Intronic
1019863615 7:3684106-3684128 TGTCACTGCTGAGCAGGGAATGG - Intronic
1019995381 7:4721084-4721106 TGACAGAGTAAAGCAAGAAAGGG - Intronic
1020153011 7:5697892-5697914 TAACAGAGCAGGGGAGAGAAGGG + Intronic
1020431928 7:8123814-8123836 TGAGAGGCCAGAGAAGGGAATGG + Intronic
1020959238 7:14781568-14781590 TGACAGCCCAGAGCAAAGAAAGG - Intronic
1021166435 7:17348398-17348420 TCACAGAGCAGAGGAGGCTAAGG + Intergenic
1021362124 7:19728555-19728577 TATCTGAGCAGATCAGGGAATGG - Intronic
1021369756 7:19829116-19829138 TGCCAGAGTAGAGCAGAAAAAGG + Intergenic
1021982587 7:26068990-26069012 GTACAGAGCAGAGCAGGAAAAGG + Intergenic
1022246010 7:28560025-28560047 TGTCAGAGCAGAGAAGAGCAGGG + Intronic
1023104631 7:36751426-36751448 TCACAGAGAAGAGGAGGGAAAGG - Intergenic
1023114733 7:36851482-36851504 TGACAGAGGAAAGGAAGGAAAGG + Intergenic
1023851172 7:44151323-44151345 TGACAGAGCACAGCCGGGCCAGG - Intronic
1024178462 7:46864028-46864050 TGCCAGAGAAGACCAGGGAGGGG + Intergenic
1024254498 7:47530430-47530452 TGACGGAGAAGGGCAGGGAAGGG + Intronic
1024284620 7:47746580-47746602 TGCCAGAGCAGTGCTGGGTATGG + Intronic
1024608946 7:51046451-51046473 GGACAGAGCAGACCTCGGAAAGG - Intronic
1024664860 7:51536367-51536389 GGACAGAGCACATCCGGGAAGGG - Intergenic
1025015833 7:55438585-55438607 TCACAGAGCAGGACAGGCAAAGG + Intronic
1025235953 7:57234983-57235005 TGAAAGAGGAGAGCAGGCAGGGG - Intergenic
1026101728 7:67389560-67389582 TGAGAGAGCAGGGCATGGAAGGG - Intergenic
1026282410 7:68933499-68933521 TGGCAGGGCAGGGCAGGGAAGGG + Intergenic
1026324371 7:69296063-69296085 TGGCAGAGCAGGCCAGGGAATGG + Intergenic
1026888769 7:73970097-73970119 AGCCAGAGAAGAGCAGGGCAAGG + Intergenic
1027235538 7:76295547-76295569 TGACAGAGAACAGCTGGGCAGGG + Intergenic
1028253350 7:88561643-88561665 TAATAGAGTAGAGCAGGGAGGGG - Intergenic
1028403860 7:90455308-90455330 AGACAGAGCAGGGAATGGAAGGG - Intronic
1028805993 7:95026689-95026711 GGACAGAGCACCTCAGGGAAGGG - Intronic
1029113720 7:98226125-98226147 GGACAGGGCAGGGCAGGGCAGGG - Intronic
1029164421 7:98577087-98577109 TGACAGAGCATGGGAGGAAAAGG - Intergenic
1029320963 7:99759725-99759747 TAACAGAGCAGAGAAGTAAATGG + Intronic
1029590421 7:101503399-101503421 TGACAAGGCAGGGCAGGGTAGGG - Intronic
1029654172 7:101913499-101913521 TGACAGATCAGCCCAGGGAGGGG + Intronic
1030521824 7:110607150-110607172 TGGCAGGGCAGAGCTGGGGAAGG - Intergenic
1030543854 7:110867911-110867933 TGACTGAGCAGTGCATGGAGAGG - Intronic
1030585496 7:111413742-111413764 TCACAAAGCAGGACAGGGAAGGG - Intronic
1030872993 7:114780745-114780767 AGAAGGAGCAGGGCAGGGAATGG - Intergenic
1031105039 7:117530315-117530337 ACACAAAGCAGAGCTGGGAATGG - Intronic
1032422485 7:131793797-131793819 AGTCAGAGGAGAGCAGAGAAGGG - Intergenic
1033168993 7:139066818-139066840 TTACAGAGCTGAGCAGGCAGTGG - Intronic
1033175280 7:139118011-139118033 TGACAGGGAAGGGAAGGGAATGG + Intergenic
1033523510 7:142186464-142186486 TTACAGGGCAGAGCTGGGAGTGG + Intronic
1033604516 7:142916227-142916249 TTACAGAAAAGAGCAGAGAAGGG + Intronic
1033801605 7:144908520-144908542 TGAGAAAGCTGAGAAGGGAAAGG + Intergenic
1034135994 7:148770635-148770657 TGTGAGCCCAGAGCAGGGAAGGG - Intronic
1034291144 7:149932751-149932773 AGACAGGGCAGGGCAGGGCAGGG + Intergenic
1034353489 7:150432677-150432699 TTACTCAGCAGAGAAGGGAAAGG + Intergenic
1034366287 7:150551424-150551446 TGGCAGTGCAGATCAGGGGAGGG - Intergenic
1035179061 7:157076311-157076333 AGACAGAGAAAAGAAGGGAAGGG - Intergenic
1035325577 7:158063819-158063841 GGACACAGCAGGTCAGGGAATGG + Intronic
1035451008 7:158976691-158976713 AGCCAGAGCAGGGCAGAGAAGGG + Intergenic
1036177068 8:6549412-6549434 TGACAGAGCAGAGTCAGGATTGG + Intronic
1037044053 8:14275530-14275552 TGACATGGCAGAGAAGGAAAAGG - Intronic
1037386851 8:18352165-18352187 GGGCAAAGCTGAGCAGGGAAGGG - Intergenic
1037572899 8:20173448-20173470 TTACAGAGCAGATCAGGGAAAGG + Intronic
1037986596 8:23294330-23294352 TGGCAGAGCAGAGCTGGGAGAGG - Intronic
1038248503 8:25881533-25881555 TGACACAGAAGTGCTGGGAAGGG + Intronic
1038381028 8:27094524-27094546 GGACAGAAGAGAGCAAGGAAGGG - Intergenic
1038886710 8:31670600-31670622 TGACAGAGATGATCAGAGAAAGG + Intronic
1038932296 8:32207749-32207771 TGACTGAGAACAGCAGGGAATGG + Intronic
1040651724 8:49456768-49456790 TGCCAGAGCAGAGCAGGGCCAGG + Intergenic
1041401652 8:57451456-57451478 TGAGAATGCAGAGCAGTGAAGGG + Intergenic
1041490634 8:58428845-58428867 TGACAGTGCAGAGCAGTGAGGGG + Intronic
1041677611 8:60551139-60551161 AGAAAAAGCAGAGCAGGGCAAGG - Intronic
1042832991 8:73051670-73051692 TCACAAAGCAGGGCAGAGAAGGG + Intergenic
1043036629 8:75207930-75207952 TGACAGAGCACTGAGGGGAAGGG - Intergenic
1043311062 8:78859733-78859755 TGATAGAGGAGTGCTGGGAAGGG - Intergenic
1043377548 8:79667510-79667532 CGAAAAAGCAGAGGAGGGAAAGG + Intergenic
1043511039 8:80950530-80950552 ACCCATAGCAGAGCAGGGAAAGG - Intergenic
1043679953 8:83011013-83011035 TGACAGAACATAGCAGCAAATGG - Intergenic
1044138986 8:88624552-88624574 TGAGAGAGCATAGAAAGGAAGGG - Intergenic
1045695614 8:104805843-104805865 GCACAGAGCAGGGCAGAGAAGGG + Intronic
1046319680 8:112556788-112556810 TGACAGGGGAGAGAAGGGCATGG - Exonic
1046765006 8:118059614-118059636 TGAGGGACCATAGCAGGGAACGG - Intronic
1046864384 8:119129594-119129616 TAACAGAAGAGAGCAGGAAAAGG + Intergenic
1047145755 8:122197516-122197538 TGACAGAGCACAGCTGGGCTTGG - Intergenic
1047515636 8:125552464-125552486 GGAGAGAGTTGAGCAGGGAACGG + Intergenic
1047640756 8:126819342-126819364 TGAGACAGCATAGCAGGTAATGG - Intergenic
1047700973 8:127449012-127449034 TAACAGAGCAGACCTGGGAAAGG - Intergenic
1047759926 8:127946879-127946901 TGTCAGAGCAGGGAAGGGAAGGG - Intergenic
1048039331 8:130710369-130710391 AGACAGAGAAGAGTGGGGAATGG + Intergenic
1048164296 8:132048776-132048798 CCACAGAGCACAGCAGGAAAGGG + Intronic
1048226338 8:132590078-132590100 TTACAGAGCAGAGCAAAGACAGG - Intronic
1048302246 8:133260272-133260294 CGAGACAGCAGAGCAGGGTAGGG - Intronic
1048949410 8:139482956-139482978 TCACAGAACAGAGTAGAGAAGGG - Intergenic
1049328737 8:142038592-142038614 TGGGAGAACAGAGGAGGGAAAGG - Intergenic
1049731138 8:144179114-144179136 TGACAGGGGAGGGCAGGGCAAGG + Intronic
1050214648 9:3309170-3309192 TGACAGACTACAGCAGTGAAGGG + Intronic
1050307576 9:4321047-4321069 TAGAAGAGCAGAGGAGGGAAAGG - Intronic
1050463251 9:5894841-5894863 TCACAGAGCAGAGCATAGAAAGG + Intronic
1051001775 9:12290815-12290837 AGCCAGAGCAGAGGAGAGAATGG + Intergenic
1053445418 9:38149620-38149642 TGAGAAAGTAAAGCAGGGAAGGG + Intergenic
1053691334 9:40588840-40588862 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1054273468 9:63048645-63048667 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1054302594 9:63389811-63389833 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1054401366 9:64716311-64716333 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1054434974 9:65200631-65200653 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1054495415 9:65821050-65821072 GGACAGGGCAGAGCAGGGCAAGG + Intergenic
1054938369 9:70713342-70713364 TCACTGACCAGAGAAGGGAAGGG - Intronic
1054940060 9:70731335-70731357 TCACTGACCAGAGAAGGGAAGGG - Intronic
1055013711 9:71593828-71593850 AGACAGAGCAGAGAAAGGGAAGG + Intergenic
1055032443 9:71784115-71784137 TTACAGGCCAGAGCAAGGAAGGG + Intronic
1055464498 9:76550628-76550650 TGATAGGGCAGGGCAGGGCAGGG - Intergenic
1055684530 9:78756777-78756799 TGGTAGAACAGAGGAGGGAATGG + Intergenic
1055805337 9:80086932-80086954 ACATAGAGCAGAGCAGAGAAAGG - Intergenic
1056174112 9:84017617-84017639 GGACAGGGCAGGGCAGGGCAGGG - Intergenic
1056174127 9:84017667-84017689 GGACAGGGCAGGGCAGGGCAGGG - Intergenic
1057518111 9:95738482-95738504 TGAAAGGGCAGGGCAGGGAACGG + Intergenic
1057788358 9:98105296-98105318 CTACAGAGCAGAGCCGGGGATGG - Intronic
1057904737 9:98974892-98974914 AGAAACAGCAGAGGAGGGAAAGG + Intronic
1057966404 9:99508220-99508242 AGAGAGACCAGAGTAGGGAAGGG - Intergenic
1058388086 9:104462176-104462198 GGAAAGTGCAGAGGAGGGAAAGG - Intergenic
1058527818 9:105877969-105877991 CAACTGAGCAGAGCTGGGAATGG + Intergenic
1058645147 9:107124983-107125005 TAACAGAGGAGAGCAGGGTGAGG + Intergenic
1059444100 9:114327603-114327625 GGACAGGGCAGGGCAGGGAAGGG + Intergenic
1059445307 9:114334382-114334404 GGACAGGGCAGGGCAGGGAAGGG + Exonic
1059457598 9:114409428-114409450 TGAGTGAGCAGAGCAAAGAAGGG + Intronic
1060163891 9:121392660-121392682 ATACAAAACAGAGCAGGGAAGGG + Intergenic
1060252321 9:121996202-121996224 TGAGAGAGGACAGGAGGGAAGGG - Intronic
1060739879 9:126091137-126091159 AGACACAGCAGGGAAGGGAAGGG + Intergenic
1061168336 9:128937497-128937519 TCACAGAGCAGAGCAGGGCAAGG - Intronic
1061913054 9:133734984-133735006 TGGCACAGCAGGGCAGGGAGGGG + Intronic
1061934589 9:133850295-133850317 GGTCAGGGCAGAGCAGGGTAGGG - Intronic
1062042113 9:134408912-134408934 GGACAGGGCAGAGCAGGGCTGGG - Intronic
1062066969 9:134533855-134533877 TTACAGAGCAGAGCCGAGAAAGG - Intergenic
1062142576 9:134967731-134967753 TGTCAGCTCAGAGCAGGAAACGG + Intergenic
1062636623 9:137494894-137494916 TGAGAGCGCAGAGCAGGTGAAGG - Intronic
1062736484 9:138140323-138140345 TGCCAGGGGAGAGCAGGGAAGGG + Intergenic
1062750467 9:138248400-138248422 TGTAAGAGCAGAGCAGGTGATGG - Intergenic
1203622013 Un_KI270749v1:135031-135053 GGGCAGGGCAGAGCAGGGCAAGG - Intergenic
1186294111 X:8130167-8130189 TGACAGAGGAGAAGATGGAAGGG + Intergenic
1186456245 X:9712240-9712262 TTACGGAGCAGACCAGGGAGTGG + Intronic
1186545345 X:10443354-10443376 TGACAGAGAAGAGGAGGTAAGGG + Intergenic
1186739499 X:12502390-12502412 AGAGAGAGCAGAGCAGGGGAAGG + Intronic
1186805860 X:13139518-13139540 AGACAGAGCAGAGCAGATGAGGG + Intergenic
1187247558 X:17566627-17566649 TTACAAAGCAGAGCAGGAGATGG - Intronic
1187390593 X:18884202-18884224 GGACAGAGCAGAGCAGACAGAGG - Intergenic
1187449332 X:19382865-19382887 TCACAGAGCAGAGCTGAGAGAGG - Intronic
1188002969 X:24999291-24999313 AGACAGTGAGGAGCAGGGAATGG - Intergenic
1188602225 X:31981682-31981704 TGACAGAGCAGACAAGCAAAAGG - Intronic
1188919020 X:35948681-35948703 TGAGAGAGTGGACCAGGGAAGGG + Intronic
1189234438 X:39476714-39476736 TGACACAGCAGTGCTGGGAAGGG + Intergenic
1189293835 X:39904900-39904922 TGACAGATCAGGGCAGTGCACGG - Intergenic
1189881901 X:45502913-45502935 TCACAGAGCAGGACAGAGAAGGG - Intergenic
1190190677 X:48274500-48274522 AGACAGGGCAGAGGAGGGGAGGG + Intronic
1190215930 X:48479350-48479372 AGAGAGATGAGAGCAGGGAAAGG - Intronic
1190296253 X:49029620-49029642 TGCCTGGGCAGAGCAGGGCAGGG + Exonic
1190444083 X:50505639-50505661 TGACAGAGCAGAGCAGTACTGGG + Intergenic
1190710130 X:53061962-53061984 AGAGAGAGAAGAGAAGGGAAGGG + Intronic
1190738574 X:53272201-53272223 TGACAGAGGAGAACACTGAAGGG - Intronic
1190782914 X:53615690-53615712 TGAGAGAGCAGAGAAGGGGAAGG - Intronic
1190801857 X:53796528-53796550 TGAGAAAGCAGGGCAGGGGAAGG + Intergenic
1190932280 X:54959247-54959269 TGACAGAGCAGAGCTAGAACTGG + Intronic
1191088674 X:56597271-56597293 TGACAGAGCACCTCGGGGAAGGG - Intergenic
1192214136 X:69146229-69146251 AGATAGAGCAGGGCAGGTAATGG - Intergenic
1192497026 X:71622901-71622923 TGACAGAGAGGAGGAGGAAATGG - Intergenic
1192508534 X:71707162-71707184 CCACAGAGAAGAGCAAGGAAAGG - Intergenic
1192512113 X:71727554-71727576 CCACAGAGAAGAGCAAGGAAAGG + Intergenic
1192514584 X:71753951-71753973 CCACAGAGAAGAGCAAGGAAAGG - Intergenic
1192518163 X:71774391-71774413 CCACAGAGAAGAGCAAGGAAAGG + Intergenic
1192622650 X:72694566-72694588 TTACAAATCAGAGAAGGGAAGGG - Intronic
1192878637 X:75258657-75258679 GGACAGAGCACCTCAGGGAAGGG + Intergenic
1193334690 X:80274260-80274282 AGACAGAGCACCTCAGGGAAGGG + Intergenic
1193468722 X:81875308-81875330 AGCCAGAGCAGAGCAGAGAAAGG - Intergenic
1193472142 X:81919544-81919566 TCACAAAGCAGAGCATGCAAGGG - Intergenic
1195311641 X:103637847-103637869 TTGCTGAGCAGAGAAGGGAAGGG - Intergenic
1195469082 X:105212495-105212517 GGACAGAGCACCTCAGGGAAAGG + Intronic
1195655053 X:107325053-107325075 AGCCAGAGCAGAGCAGAGGAAGG + Intergenic
1196174764 X:112628418-112628440 GCACAGAGCATGGCAGGGAAGGG - Intergenic
1196245434 X:113393400-113393422 TGACAGAGCAGTGCGAGGACAGG - Intergenic
1196411913 X:115428451-115428473 TGCCAGAGCAGGGCTAGGAAAGG + Intergenic
1196960175 X:120992657-120992679 GGACAGAGCACATGAGGGAAGGG - Intergenic
1197666632 X:129231214-129231236 TGACCAAGTAGAGCAGGGCAGGG + Intergenic
1197998359 X:132405283-132405305 TCACAGAGCAGAGAAGAGAGGGG + Intronic
1198075448 X:133189352-133189374 TGACAGTGCAGAGCTGTGATTGG + Intergenic
1198882921 X:141300856-141300878 TGACAGAGCTGACTAGGCAAAGG + Intergenic
1198991998 X:142525225-142525247 ATGCAGAGCTGAGCAGGGAAAGG + Intergenic
1200077160 X:153556889-153556911 AGACAGATCAGGGCAGGGCAGGG - Intronic
1200182406 X:154158775-154158797 TTATTGAGCAGAGCAGGGAAGGG - Intronic
1200188060 X:154195889-154195911 TTATTGAGCAGAGCAGGGAAGGG - Intergenic
1200193710 X:154233029-154233051 TTATTGAGCAGAGCAGGGAAGGG - Intronic
1200199465 X:154270833-154270855 TTATTGAGCAGAGCAGGGAAGGG - Intronic
1200398722 X:156006412-156006434 TGCCAGGGGAGAGCAGGGAAGGG + Intronic
1201190024 Y:11437501-11437523 GGACAGGGCAGAGCAGGGCAAGG - Intergenic
1201705148 Y:16928528-16928550 TGACAGAGCACCTGAGGGAATGG + Intergenic
1201721750 Y:17105976-17105998 TGTCAGAGAAGGGAAGGGAAAGG - Intergenic
1202275119 Y:23109949-23109971 GGACAGAGCTGAACAGAGAATGG + Intergenic
1202290909 Y:23310740-23310762 GGACAGAGCTGAACAGAGAATGG - Intergenic
1202428110 Y:24743671-24743693 GGACAGAGCTGAACAGAGAATGG + Intergenic
1202442681 Y:24926420-24926442 GGACAGAGCTGAACAGAGAATGG - Intergenic
1202583605 Y:26404426-26404448 GGACAGGGCAGAGCAGGGCAAGG + Intergenic