ID: 1004506185

View in Genome Browser
Species Human (GRCh38)
Location 6:16248738-16248760
Sequence GCTGATGACAGAGCAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 381}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004506185_1004506189 18 Left 1004506185 6:16248738-16248760 CCCTGCTCTGCTCTGTCATCAGC 0: 1
1: 0
2: 5
3: 44
4: 381
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506185_1004506192 27 Left 1004506185 6:16248738-16248760 CCCTGCTCTGCTCTGTCATCAGC 0: 1
1: 0
2: 5
3: 44
4: 381
Right 1004506192 6:16248788-16248810 TATAAAAGTGAGGGGAACCAGGG 0: 1
1: 0
2: 0
3: 19
4: 150
1004506185_1004506190 19 Left 1004506185 6:16248738-16248760 CCCTGCTCTGCTCTGTCATCAGC 0: 1
1: 0
2: 5
3: 44
4: 381
Right 1004506190 6:16248780-16248802 TGTGTTAGTATAAAAGTGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 329
1004506185_1004506191 26 Left 1004506185 6:16248738-16248760 CCCTGCTCTGCTCTGTCATCAGC 0: 1
1: 0
2: 5
3: 44
4: 381
Right 1004506191 6:16248787-16248809 GTATAAAAGTGAGGGGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 144
1004506185_1004506188 17 Left 1004506185 6:16248738-16248760 CCCTGCTCTGCTCTGTCATCAGC 0: 1
1: 0
2: 5
3: 44
4: 381
Right 1004506188 6:16248778-16248800 TATGTGTTAGTATAAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004506185 Original CRISPR GCTGATGACAGAGCAGAGCA GGG (reversed) Intronic
900176164 1:1292345-1292367 CCCGGAGACAGAGCAGAGCAAGG + Intergenic
900347826 1:2219065-2219087 GCAGATGACAGAAGAAAGCAAGG - Intergenic
900814226 1:4831099-4831121 GCTGATGACACAGCAGAAGGGGG - Intergenic
901014263 1:6218912-6218934 GCTGGTGACAGAGCAGAGTCTGG + Intronic
901641333 1:10694560-10694582 GCAGGTGAAAGAGCAGAGCGCGG + Intronic
902242564 1:15098808-15098830 GTGGATGACAGAGCAGTGCTGGG - Intronic
902625968 1:17676542-17676564 GCAGAGCTCAGAGCAGAGCAGGG + Intronic
902810731 1:18886396-18886418 GCAGCTGGCAGGGCAGAGCAGGG + Intronic
903224663 1:21887788-21887810 GGTGATGACAGAGCCAGGCAGGG - Intronic
904496144 1:30887854-30887876 ACTGAGGCCAGAGAAGAGCAGGG - Intronic
904900897 1:33856283-33856305 TCTGGTGATAGAGCAGTGCAGGG + Intronic
905506660 1:38485290-38485312 GCTGACAACAGAGCTAAGCAGGG + Intergenic
906148426 1:43573570-43573592 GCAGATGGCAGAGCAGAGTGGGG - Intronic
906154518 1:43606221-43606243 GAAGCTGGCAGAGCAGAGCATGG - Exonic
906297004 1:44655054-44655076 GCTGAAGACATGGAAGAGCAGGG + Exonic
906484267 1:46222194-46222216 ACTGAGGAGAGAGCAGAGCCTGG + Intergenic
906804254 1:48764842-48764864 GCGGATGACAGAGCTCAGCAAGG + Intronic
906944303 1:50282768-50282790 GGTGAAGACAGAAGAGAGCATGG + Intergenic
908471407 1:64447525-64447547 AGTGAAGTCAGAGCAGAGCAGGG + Intergenic
908499532 1:64729433-64729455 GCTAATGACAGAGCACAGTGAGG - Intergenic
908639907 1:66211062-66211084 CCTGATGACAGAGCACAGCAGGG + Intronic
910291706 1:85606057-85606079 GTGGATGACACAGGAGAGCAGGG + Intergenic
911594430 1:99784285-99784307 GCTGATGACAGGGAAGAGACTGG - Intergenic
911663976 1:100533676-100533698 TGTGATGACAGAGCAGAGGGTGG + Intergenic
912479552 1:109970737-109970759 CATGATGAGAGAACAGAGCAAGG - Intergenic
912600960 1:110933182-110933204 GCTGATTTCGGAGCTGAGCAAGG - Intergenic
912691556 1:111808654-111808676 TCTAATAACAGAGGAGAGCAAGG - Intronic
915898165 1:159827314-159827336 GCAGAGGGCAGGGCAGAGCAGGG + Intronic
916025212 1:160827670-160827692 GCTGATGAAAGAGGAAGGCAAGG - Intronic
916122249 1:161538903-161538925 ACTGATGACAGAGGATGGCAGGG + Intergenic
916132136 1:161620357-161620379 ACTGATGACAGAGGATGGCAGGG + Intronic
916488176 1:165277750-165277772 GCTGCTAAAATAGCAGAGCAAGG + Intronic
916987899 1:170211391-170211413 TCTTGTGACAGAGCAGAGCCTGG + Intergenic
917299012 1:173553513-173553535 GCTGCTGACTGATCAGATCAGGG - Intronic
918065884 1:181101523-181101545 GCTGATACCAGAGCAGATCCTGG - Intergenic
919790660 1:201288778-201288800 CCTGAGGACTGGGCAGAGCATGG - Intronic
920254067 1:204642463-204642485 GCTGATGGGAGCGCAGAGCCGGG - Intronic
921304786 1:213785044-213785066 AGTGATGACACATCAGAGCAAGG - Intergenic
921822710 1:219635847-219635869 GCTCAGAACAGAGCAGAGGAAGG + Intergenic
922208763 1:223471137-223471159 GATGAAGACAGAGCAGACGAAGG - Intergenic
924592792 1:245419587-245419609 GCTGATGACAGAGAGTAGCCGGG + Exonic
924940998 1:248812373-248812395 GCAGAGGGCAGAGCAGAGCAAGG + Intronic
1063345633 10:5310033-5310055 TCTGAGGACAGAGCAGTGCTTGG - Intergenic
1063660391 10:8031759-8031781 GGAGCTTACAGAGCAGAGCAAGG - Intergenic
1063946331 10:11179976-11179998 GCTGCTGACAGAGAAGACTAGGG - Intronic
1065274984 10:24076689-24076711 GGTTAGGACAGAGCAGAGCATGG - Intronic
1066523687 10:36251963-36251985 GTTGTGGACAGAGCAGAGCATGG - Intergenic
1067082493 10:43219462-43219484 GATGATGACAGGACAGAGCAGGG + Intronic
1067184141 10:44012841-44012863 GGTGAAGACAGAACAGAGCAAGG + Intergenic
1069507303 10:69012113-69012135 ACTGATGGCAGTGAAGAGCATGG + Intronic
1069725555 10:70575591-70575613 GCTGCTGACTGAGCAGGGCAGGG + Intergenic
1069842479 10:71348459-71348481 GCCGATGACAGAGCTGGGCAGGG + Intronic
1070417313 10:76203229-76203251 GCTGAGGCCAGAGAAGAGAAGGG - Intronic
1070426400 10:76292360-76292382 GGTGGTGACGGAGCAGAGCCTGG + Intronic
1070752040 10:78969660-78969682 GCTGAGCACAGAGCAGGGCATGG - Intergenic
1071708247 10:88022907-88022929 GCTGATGAAATACAAGAGCATGG + Intergenic
1072460035 10:95610361-95610383 ACTGGTGACAGATCAGGGCAGGG + Intronic
1072929880 10:99652872-99652894 AATGAAGACATAGCAGAGCAGGG - Intergenic
1073562969 10:104512556-104512578 ACGGATGACAGTGCAGAGCTAGG + Intergenic
1073759399 10:106613487-106613509 GCCAATGACAGAGTATAGCAGGG - Intronic
1074435261 10:113428659-113428681 GTGGAAGACAGAGCAGAGCAGGG + Intergenic
1076466163 10:130683305-130683327 GCTGATGTCAGAGCAGAGTCAGG - Intergenic
1076478277 10:130767492-130767514 GCTGGTAACAGCGCAGAGGAGGG - Intergenic
1077316477 11:1921485-1921507 GCTGAGGACTGAGGAGAGCCTGG + Intronic
1078990926 11:16645549-16645571 GATGATGTCATACCAGAGCAGGG + Intronic
1079483777 11:20912213-20912235 GCTGATTAAATAGCAGAGGATGG + Intronic
1080925973 11:36756210-36756232 GCTGTTGTCACAGCAGAGAAAGG + Intergenic
1081622377 11:44626187-44626209 TCTGAGGACTGAGCAGGGCAAGG + Intergenic
1083249425 11:61455975-61455997 GCTACTGACAGTGCAGAGCAAGG - Intronic
1083623782 11:64061508-64061530 GGTGATCACAGTGCAGAGCCGGG - Intronic
1084143569 11:67250626-67250648 GAAGATGACAGTGCAGAGGAGGG + Exonic
1084212859 11:67631838-67631860 GCTGATGATGGAGCCAAGCAGGG + Exonic
1084366964 11:68708020-68708042 GCGGAGGGCAGAGCAGGGCAGGG - Exonic
1084754199 11:71224440-71224462 GGTGAGGACAGCTCAGAGCACGG + Intronic
1085025589 11:73234659-73234681 GGTGGTGACAAAGTAGAGCACGG - Exonic
1087489837 11:98811094-98811116 GCTCATGTCTGAGCATAGCAGGG + Intergenic
1088616190 11:111631243-111631265 GCTGATGAGACATCAGAGAAAGG + Intronic
1088745262 11:112799505-112799527 GCAGAGGCAAGAGCAGAGCAAGG - Intergenic
1089067953 11:115676318-115676340 GCGGATGACAGGGAAGAGGAAGG - Intergenic
1089833240 11:121347669-121347691 CCTGATGACACAGCAGAGATTGG + Intergenic
1089921886 11:122216828-122216850 GGTGATGACAGAACAGAGAAAGG + Intergenic
1090089052 11:123678231-123678253 GCTGAATGCAGAGCAGAGGAGGG - Intergenic
1090228150 11:125083884-125083906 CCTGCTGGCAGAGCAGGGCAAGG - Intronic
1091021461 11:132103829-132103851 GCAGATGAAAATGCAGAGCAAGG + Intronic
1091054870 11:132408463-132408485 GCTGGTGAGGGAGCTGAGCAAGG - Intergenic
1091382960 12:74649-74671 TCTGATGCCAGCACAGAGCACGG - Intronic
1092883955 12:12909645-12909667 AGTGATCACAGAGCAGAGAAGGG + Intronic
1092988654 12:13873608-13873630 TCTGAAGAAAGAGCAGGGCAAGG - Intronic
1093058491 12:14578789-14578811 TCTGATGCCAGATCATAGCACGG + Intergenic
1093627976 12:21372839-21372861 CCTGATGTCAGAGCTGAGAAAGG + Intronic
1095738373 12:45582563-45582585 GTTGAAGACAGTGCAGAGGATGG - Intergenic
1095977832 12:47951928-47951950 GCTGTTGAGAGAGGAAAGCAAGG + Intergenic
1096526751 12:52214593-52214615 GCTGATGCCAGGGGACAGCAAGG + Intergenic
1100759828 12:97794971-97794993 GCTAATGAAAGACAAGAGCAGGG - Intergenic
1101835474 12:108292078-108292100 GCTGAAGACAGAGCCAGGCATGG + Exonic
1102606728 12:114073520-114073542 GCTGATGACTGAGCACAGTAGGG + Intergenic
1103624197 12:122206103-122206125 GATGATGGCAGAGGAGGGCAAGG + Intronic
1103724563 12:122991274-122991296 GCTGAAGACAGGACAGAACAGGG + Intronic
1104487045 12:129160468-129160490 GTTGCTGACACAGCAGATCATGG + Intronic
1105407145 13:20142304-20142326 GCTGATGACTGAGCAGAACTGGG - Exonic
1105456933 13:20549537-20549559 GCTGTAGACTGAGCGGAGCATGG - Intergenic
1106707957 13:32301594-32301616 GCTGATGGCAGAGCAGAGAGGGG - Intergenic
1108742048 13:53348304-53348326 TCTGAAGATAAAGCAGAGCAAGG - Intergenic
1113075748 13:106466519-106466541 GATGATGACTGATCAGAGAATGG - Intergenic
1113572149 13:111365742-111365764 GCACGTGAAAGAGCAGAGCATGG + Intergenic
1113899555 13:113788660-113788682 GCTGATGACGGCACAGAGCCAGG - Intronic
1114567431 14:23643130-23643152 TCTGAAATCAGAGCAGAGCATGG - Exonic
1115301982 14:31894784-31894806 TCTGAAGAGAGAGGAGAGCAAGG + Intergenic
1116083739 14:40207932-40207954 CCTGATGACAAAGCAGGGAATGG - Intergenic
1116699805 14:48226194-48226216 CCTGAAGACAAAGCATAGCATGG - Intergenic
1117485058 14:56187902-56187924 GCGGAGCACAGAGAAGAGCACGG - Intronic
1117514558 14:56487882-56487904 CATGATTACAGAGCACAGCATGG + Intergenic
1119479311 14:74949773-74949795 GTTGAGGACAGAGCAAAGCTTGG - Intronic
1120062176 14:79997033-79997055 GCTGCAGACAGAGCAGAGGCAGG + Intergenic
1121742479 14:96264002-96264024 GTTGATGACACGGCAGAGGAGGG - Exonic
1122457456 14:101865358-101865380 TATGATGACAGAGGAAAGCATGG + Intronic
1123422320 15:20143493-20143515 GCTGATGCCAAAGAAGAGCCAGG + Intergenic
1123442681 15:20302849-20302871 GCTGATGCCAAAGAAGAGCCAGG - Intergenic
1123531548 15:21150033-21150055 GCTGATGCCAAAGAAGAGCCAGG + Intergenic
1124240734 15:28025633-28025655 GCTGCTGAGTGAGCAGAGAAGGG - Intronic
1124344600 15:28913849-28913871 CCAGATGTCAGACCAGAGCAAGG - Intronic
1124906676 15:33875143-33875165 GCTGATGTGGGAGCAGAACAGGG + Intronic
1125487595 15:40123194-40123216 GCAGATCACAGGGCAGGGCAGGG + Intergenic
1126561822 15:50052430-50052452 GGTGATGCCAGACCAGGGCAGGG + Intronic
1127532407 15:59857326-59857348 GCTGATTCCAGAGCAGAGGCAGG + Intergenic
1128369441 15:67029701-67029723 TCTTATGACAGAGAAGGGCAAGG + Intergenic
1129840228 15:78739250-78739272 GGTGATGCAAGCGCAGAGCACGG + Intergenic
1130054817 15:80513356-80513378 GCTGATGGCAGAGGAGAGCGTGG - Intronic
1130834684 15:87638328-87638350 GCTGATGAGAGAGAAGAAGATGG - Intergenic
1131065087 15:89429552-89429574 GCTGAGCCCAGAGCAGGGCAGGG - Intergenic
1131266287 15:90917367-90917389 GCTAAGGAAAGAGCTGAGCAAGG + Intronic
1131508104 15:93033707-93033729 CCTGATGAGAGAACAGAGCCTGG + Intergenic
1131843407 15:96463096-96463118 TCTGAAAGCAGAGCAGAGCAGGG - Intergenic
1132338602 15:101064360-101064382 GCTGGAGTCAGGGCAGAGCAGGG - Intronic
1133103703 16:3493987-3494009 GCTGAGGAAAGAGGAGAGAAAGG + Exonic
1133214747 16:4285089-4285111 GCAGATGAGAGAGCAGAGTCAGG - Intergenic
1134573016 16:15307912-15307934 GCTAATGACTGAGCATGGCAGGG - Intergenic
1134573214 16:15309453-15309475 GCTAATGACTGAGCATGGCAGGG + Intergenic
1134729170 16:16446505-16446527 GCTAATGACTGAGCATGGCAGGG - Intergenic
1134729366 16:16448042-16448064 GCTAATGACTGAGCATGGCAGGG + Intergenic
1134851546 16:17482969-17482991 GCTGTGGAGAGAACAGAGCAAGG - Intergenic
1134938265 16:18265359-18265381 GCTAATGACTGAGCATGGCAGGG + Intergenic
1135285351 16:21188354-21188376 GCTGATGGAAGAGGAAAGCAGGG + Intergenic
1135506440 16:23041088-23041110 GCTGCTGACTGATCAGATCAGGG + Intergenic
1136516109 16:30769302-30769324 GCTAATGTCAGAGCGGATCAAGG + Exonic
1136751275 16:32637962-32637984 GGTGATGGCAGGGCAGGGCAGGG + Intergenic
1137315794 16:47321048-47321070 TCTGATTACAGAGTAGAACATGG + Intronic
1137557736 16:49483437-49483459 AATGATGACAGAGAAGAGCATGG + Intergenic
1137665732 16:50247897-50247919 GCTTTTTACAGAGGAGAGCAGGG + Intronic
1139369681 16:66459089-66459111 GGTGAGCACAGAGCTGAGCACGG - Intronic
1139968197 16:70757205-70757227 GCTGGTGACTGAGCCCAGCAGGG + Intronic
1140388201 16:74561158-74561180 GCTGGTGTCAGAGCTGGGCATGG + Intronic
1141194325 16:81848621-81848643 ACTGATGACTGAGCAGAGCAGGG - Intronic
1141631747 16:85291648-85291670 GCTGCTGACAGAGCCCAGCTGGG + Intergenic
1142308013 16:89296322-89296344 GCAGAGGAGAGAGCAGGGCAGGG - Intronic
1203053409 16_KI270728v1_random:897217-897239 GGTGATGGCAGGGCAGGGCAGGG + Intergenic
1142579885 17:935292-935314 GCTGTTTAAAGAGCACAGCAAGG - Intronic
1143028189 17:3953191-3953213 GCTGAAGTCTGAGCAGGGCAGGG + Intronic
1143529843 17:7496418-7496440 TCTGGGGACAGGGCAGAGCAGGG - Exonic
1146401371 17:32502691-32502713 CCTGGAGACAGAGCAGAGAAAGG + Intronic
1146735835 17:35238097-35238119 GCTGATGACTGAGTATGGCAAGG - Intergenic
1147652687 17:42071393-42071415 GGTGAGGACAGAGCAGACCAGGG - Intergenic
1148049062 17:44760179-44760201 GCTTTGGCCAGAGCAGAGCAGGG - Intronic
1148129999 17:45256848-45256870 GCTGAGGACAGAGCTGCTCAAGG - Intronic
1148194504 17:45703567-45703589 GCTGAGGACAGAGCAGCGCCTGG - Intergenic
1148424901 17:47585662-47585684 CCTGTTGGCAAAGCAGAGCAAGG + Exonic
1148610514 17:48961633-48961655 CCTGACCCCAGAGCAGAGCAAGG - Intronic
1148974145 17:51512092-51512114 GCCAATGACAGAGCACAGCAGGG - Intergenic
1148979918 17:51563655-51563677 GATGATGATAGAGCAGACCTGGG - Intergenic
1149289173 17:55199067-55199089 GATGCTGATAGATCAGAGCATGG + Intergenic
1150331002 17:64294194-64294216 TCTGAAGACAGAACAGAGAATGG + Intergenic
1150573180 17:66406037-66406059 GATGATGACAGAGCAAACTAGGG - Intronic
1151331455 17:73411605-73411627 ACTAAAGACAGAGCACAGCATGG - Intronic
1151539855 17:74759329-74759351 GGTGCTGGCAGAGCGGAGCAAGG + Intronic
1151660778 17:75516881-75516903 GCTGCTGGCAGAGCAGCGCGTGG + Exonic
1151749514 17:76028595-76028617 GCTGAGGACAAAGCACAGCCTGG + Intergenic
1152187355 17:78866193-78866215 GCTGTGCACAGAACAGAGCACGG - Intronic
1152758283 17:82096225-82096247 GGTGAGGACACAGCACAGCAGGG + Intronic
1153553123 18:6283217-6283239 CCTGATGAAAGTGAAGAGCATGG - Intronic
1156043249 18:32847981-32848003 CCTTGTGAGAGAGCAGAGCATGG + Intergenic
1156266339 18:35491449-35491471 GCTGAAGAGAGGGCAGAGAAAGG + Intronic
1156346085 18:36258250-36258272 GCTGATCCAAGAGCAGAGCTAGG + Intronic
1156378222 18:36533400-36533422 GCTCAGGACATAGCAGAGGAAGG - Intronic
1156818509 18:41341745-41341767 GCTGATGACAGGGAATAGGAAGG + Intergenic
1156854858 18:41769668-41769690 GCTGAGGACAAAAGAGAGCATGG - Intergenic
1157391400 18:47306518-47306540 GAGGAAGACAGAGCTGAGCAAGG + Intergenic
1157899253 18:51498207-51498229 GCAGAACCCAGAGCAGAGCAGGG + Intergenic
1158504013 18:58030038-58030060 GCTGTTGAGAGTGCAGAGAAGGG + Intergenic
1158535145 18:58301838-58301860 TCTGATGACAGAGCTGGGCTTGG - Intronic
1160083396 18:75752751-75752773 GTTGATGACAGAGCAGAGGCTGG + Intergenic
1160415944 18:78711003-78711025 GCAGAGGCCAGAGGAGAGCAGGG + Intergenic
1160535349 18:79588676-79588698 GCTCAGGACAGAGCATTGCAGGG + Intergenic
1160946364 19:1645737-1645759 GCTGATGACACAGCAGTGGGCGG - Intronic
1162833477 19:13301397-13301419 GCTGTTGACAGTGCATGGCAGGG - Intronic
1163693439 19:18750216-18750238 GCTCATGACAGAGCAGGCCAGGG + Intronic
1163715069 19:18868657-18868679 GCTGTTGTCAAAGAAGAGCACGG + Exonic
1164601166 19:29564616-29564638 GCTGGTGTCAGAGCACAGGAGGG - Intergenic
1164669049 19:30062733-30062755 CCTGCTGTCAGAGCAGGGCATGG + Intergenic
1164841142 19:31393269-31393291 GTTTTTGACAGAGCAGAGCTGGG + Intergenic
1165478453 19:36046519-36046541 GCTGGTGAAAGAGCACAGAAAGG + Intronic
1166662252 19:44654559-44654581 GCTGCTGACTGTGCACAGCATGG - Intronic
1168201941 19:54821922-54821944 GCTGATGATGGAGAAAAGCATGG + Intronic
925148744 2:1600468-1600490 GCTGATGAACGAGCAGGGGAAGG + Intergenic
925811219 2:7702792-7702814 GCTCAGGGCAGGGCAGAGCACGG + Intergenic
925812487 2:7714011-7714033 GGTGATGACACAGCAGAGTGTGG - Intergenic
926234424 2:11028592-11028614 CCTGCTGGGAGAGCAGAGCAAGG + Intergenic
926314511 2:11699450-11699472 GCGGAAGAAAGAGCAGAACAGGG + Intronic
926400150 2:12488589-12488611 CCTGGTGACAGAGCAGAACGTGG + Intergenic
926604154 2:14879783-14879805 GCTTATCCCAGAGCAGAGAATGG + Intergenic
927119866 2:19948497-19948519 GGTTATGACAGTGCAGAGAAAGG + Intronic
927907619 2:26872166-26872188 GCTGAGGAGAGAGGAGAGCAGGG + Intronic
928190111 2:29157207-29157229 GCTGCTGACAGATCCAAGCAGGG - Exonic
928294863 2:30073803-30073825 GCAGAAGACAGAGCAGAGCTTGG + Intergenic
928361140 2:30663203-30663225 ACTGATGCCACAACAGAGCATGG - Intergenic
928884102 2:36128964-36128986 GCAGATGTCACAGCAGAGAAGGG - Intergenic
931372254 2:61674460-61674482 GCTGATGACAGTATAGAGAAAGG + Intergenic
931663984 2:64596956-64596978 GTGGATGACAGAGCAGAGGAAGG - Intergenic
931683246 2:64769975-64769997 GCTGAGGAGAGAGAAGTGCAGGG + Intergenic
932441933 2:71743079-71743101 CCTCATGACAAAGCAGAGAAGGG + Intergenic
932494251 2:72138657-72138679 GCTGGTGCCAGGGGAGAGCAAGG + Intronic
932771547 2:74503324-74503346 GCTGCTGACAGACAAGACCAAGG + Intergenic
933272580 2:80249049-80249071 GCTGATGATGGAGGAGAGAAGGG - Intronic
934692136 2:96370049-96370071 GCTGTGGAAAGAGCAGAGGAGGG + Intronic
936465876 2:112749826-112749848 CCTGCTGGCAGAGCTGAGCAGGG - Intronic
936800677 2:116261247-116261269 TCTGATGACATAGCAGAGTGTGG - Intergenic
936991355 2:118369924-118369946 GCTGGTGACAAGGTAGAGCAAGG + Intergenic
937118609 2:119426979-119427001 GCTCAAGGCAGAGCAGGGCAGGG + Intergenic
938099567 2:128489632-128489654 ACTGAGAACAGGGCAGAGCAGGG - Intergenic
938104348 2:128520017-128520039 GCTGAGCACAGAGCAGAGCAGGG + Intergenic
938421967 2:131153456-131153478 TCTGATGACATAGCAGTGGAGGG - Intronic
938540892 2:132282621-132282643 GCTGATGACAGAGGTGAGTGTGG + Intergenic
938541715 2:132288524-132288546 GCTGATGACAGAGGTGAGTGTGG + Intergenic
939111568 2:138014017-138014039 CCTGATCTCAGAGCAGAGCTTGG + Exonic
940082491 2:149819804-149819826 GGTGACAACAGAACAGAGCAGGG + Intergenic
941129069 2:161624470-161624492 ACTGAAGACACTGCAGAGCAAGG + Exonic
942295895 2:174516896-174516918 ACTGAAGACAGAGAAGAGAAAGG - Intergenic
943529490 2:189061587-189061609 GCTGGTGAAAGAGGAGAACAAGG - Exonic
943566914 2:189526821-189526843 GCTGATGAGAGAGCAAGGAATGG - Intergenic
946021895 2:216646032-216646054 GTTGAAGACAGAGAAAAGCATGG + Intronic
948320079 2:237062039-237062061 GCTGGTCACAGAGCTGAGGAGGG + Intergenic
948788282 2:240364435-240364457 AAAGCTGACAGAGCAGAGCAAGG - Intergenic
1169832597 20:9840131-9840153 GCTGAAGACAGACAAGAGCGTGG - Intergenic
1169883999 20:10377435-10377457 GCTAATGAGAGAGCTGAGAATGG - Intergenic
1170869810 20:20195268-20195290 GCTGATCACAGAACACATCAGGG + Intronic
1171057741 20:21924043-21924065 GCCAATGACAGAGCACAGCAGGG + Intergenic
1171094668 20:22320139-22320161 CCTGATGCCAGAACAGAGCCTGG + Intergenic
1171869801 20:30515622-30515644 GCTGATGACAGAGGTGAGTGTGG + Intergenic
1171870588 20:30521400-30521422 GCTGATGACAGAGGTGAGTGTGG + Intergenic
1173456156 20:43203291-43203313 TCTGATTACAGAGCAGAGCAAGG + Intergenic
1175327831 20:58142065-58142087 CCTGATGAGAGACCAGAGCCAGG + Intergenic
1175372865 20:58504259-58504281 GCTCATCACAGAGAAGAGCCAGG - Intronic
1175720201 20:61281137-61281159 GCCCATGACAGAGCCAAGCACGG - Intronic
1176160638 20:63646078-63646100 TCTGGTGACAGTGCAGAGAATGG + Intronic
1176282220 20:64320110-64320132 TCTGATGCCAGCACAGAGCATGG + Intergenic
1179336875 21:40464838-40464860 GCTGAGGACAGAGAATTGCATGG - Intronic
1179435910 21:41361959-41361981 GTTGATGACGGAGCAGGGGAGGG + Exonic
1179621525 21:42619624-42619646 GCTGAGAACAAAGCAAAGCAAGG + Intergenic
1179721355 21:43317882-43317904 GCTGATGATAGAGCAGCATAAGG - Intergenic
1180228441 21:46412180-46412202 GCTCATGACACAGCGGAGAAAGG + Intronic
1180840236 22:18955674-18955696 GATGAGGACTGAGCAGATCATGG + Intergenic
1181061640 22:20284692-20284714 GGTGAGGACTGAGCAGACCATGG - Intergenic
1182949771 22:34362639-34362661 GTGGGTGTCAGAGCAGAGCAGGG - Intergenic
1183079008 22:35444445-35444467 GCTGATGGAGGAGCAGGGCAGGG + Intergenic
1183099450 22:35574947-35574969 GCTGAGGAAAGGGCAGACCAAGG + Intergenic
1183465391 22:37977838-37977860 GCTGATGACAGAGCTGAGGGTGG - Intronic
1183711724 22:39508285-39508307 ACAGATGACAGAACAGAGCGTGG - Intronic
1184060567 22:42078783-42078805 GCTGAAGACAGAGTACAGGAGGG - Exonic
1184635135 22:45821996-45822018 GCTGATGATGGGGAAGAGCAGGG - Intronic
1184708927 22:46236402-46236424 GCTTATGACAGTCCAGAGCGGGG - Exonic
1184978919 22:48082254-48082276 GGTGATGACTGACCACAGCAAGG + Intergenic
949355397 3:3175420-3175442 GCTACTGACAGAGCCCAGCACGG - Intronic
950492513 3:13314625-13314647 TCTGAGGACAGGGCACAGCAAGG - Intergenic
952513053 3:34076357-34076379 GCTGGTGACAGAGCATTCCACGG + Intergenic
952603380 3:35112418-35112440 GTTTATGACAGAGCAGCCCAGGG - Intergenic
953690535 3:45114138-45114160 GCTGCTGACAGAGCTGAGGCTGG - Intronic
953792416 3:45958440-45958462 GCTGGTGACAGTGCAGGGCTGGG + Exonic
953996364 3:47522938-47522960 TCTGGTGACTGAGCAAAGCAGGG + Intergenic
954380014 3:50214327-50214349 GCTGAAGACAGGGCAGGGCAGGG + Intronic
954404229 3:50336650-50336672 GCTGGTGACAGGCCAGAACAGGG + Intronic
954460793 3:50625833-50625855 GCGGAGGACAGAGCAGGGCCAGG + Intronic
954704416 3:52471602-52471624 TGTGATGACAGAGGAGGGCAGGG - Intronic
955392276 3:58530489-58530511 GCGGATGACCGAGTAGCGCATGG + Exonic
957637975 3:82811645-82811667 GCTGAGGAGATAGCAGGGCAAGG - Intergenic
958576380 3:95953864-95953886 GCTGATGACTGAGAAATGCATGG - Intergenic
960074508 3:113469110-113469132 CCTGATGAAAGAGCAGATGATGG + Exonic
960902103 3:122563841-122563863 GCTGCCCAAAGAGCAGAGCAAGG - Intronic
961650733 3:128415590-128415612 CCTGGAGACAGAGCAGGGCAAGG - Intergenic
963323425 3:143834977-143834999 GCCGATGACTGAACACAGCAGGG + Intronic
964330332 3:155595001-155595023 GGTGAAGGCAGAGCAGAGCTTGG + Intronic
964435258 3:156644318-156644340 GGGGATGGCAGAGCAGAGCAAGG - Intergenic
964803894 3:160585640-160585662 GGAGATTACAGAGCAGTGCAAGG + Intergenic
967365118 3:188677650-188677672 GCAAATGACAGAGCAGCTCATGG - Intronic
967807539 3:193728971-193728993 GCTGGGGACAGAGCAGCCCATGG - Intergenic
968467928 4:762299-762321 GGTGAGGACAGAGCAGAGGACGG + Intronic
968930490 4:3576223-3576245 CCTGGTGGCAGAGCAGAGCTGGG + Intergenic
969859723 4:10026163-10026185 ACTGAGGACAGAGGAGAGCAGGG - Intronic
969892180 4:10270046-10270068 GGTGAGGACAGGGCACAGCATGG + Intergenic
969893171 4:10278466-10278488 GCTGAGGACAGTGCACATCATGG + Intergenic
971058093 4:22936091-22936113 GCCAGTGACTGAGCAGAGCAGGG - Intergenic
972793246 4:42392916-42392938 GCTGCAGACAGGGCAGAGGAAGG + Intergenic
975612403 4:76215069-76215091 GCTCATGACTGAGCACAGCAGGG - Intronic
975627821 4:76367437-76367459 GCAGATGACAGAGAAGGACAAGG - Exonic
976194038 4:82516009-82516031 GTTGATGTCAGAGCCTAGCAAGG - Intronic
977297631 4:95228577-95228599 GCTGGTGAAACAGCAGAGCCAGG + Intronic
977345327 4:95810150-95810172 GGTGATGACAATGCAGAGTAGGG + Intergenic
978281875 4:107027111-107027133 GCTGCTGAGAGTACAGAGCATGG + Intronic
979689865 4:123548471-123548493 GTTGAGGACAGAACAGAGGAAGG - Intergenic
979767816 4:124483207-124483229 GAGGATGACAGAGCTGAGTAAGG - Intergenic
981226600 4:142302331-142302353 ACTAATGGCAGAGCAAAGCAAGG - Intronic
981488742 4:145317507-145317529 GTTGATCACTGAGCAAAGCAGGG + Intergenic
982641577 4:157968559-157968581 TGAGATGACAGAGCAGGGCAAGG - Intergenic
982719371 4:158843823-158843845 GCTGAAGACAGAGAAGAGTTAGG + Intronic
984036820 4:174679407-174679429 GCTGATGAGGAAGCAGAGAAAGG + Intronic
985530492 5:431130-431152 CCTGGTGTCAGAGCAGGGCAGGG + Intronic
985574371 5:666650-666672 TCTGAGGCCAGAGCAGTGCAAGG - Intronic
985800598 5:2003378-2003400 GCAGATGGCAGAGAACAGCAGGG - Intergenic
985947843 5:3200642-3200664 GCTGAAGACAGAAGGGAGCAGGG - Intergenic
988220499 5:28340085-28340107 GCTGATGAGGGAGCAGAGTGTGG - Intergenic
989498484 5:42137981-42138003 GCTGATGAAGGTGCAGAGAAGGG + Intergenic
990356324 5:54969940-54969962 GCTGCTGACAGATCTGAGCCTGG - Intergenic
990835649 5:60016375-60016397 GCTGATGACTGATCAGAGTGGGG + Intronic
992434018 5:76738040-76738062 CTGGACGACAGAGCAGAGCAAGG + Intergenic
992679453 5:79139524-79139546 TCTGATGCCTGAGCAAAGCAAGG + Intronic
992772759 5:80063921-80063943 GCTGATGCCACAGCAGATCCTGG + Intronic
993205324 5:84871394-84871416 GCAGATGACTGAGCACAACAGGG - Intergenic
994744588 5:103663218-103663240 GCAGGAGAGAGAGCAGAGCAGGG + Intergenic
997306528 5:132841146-132841168 GCTGATGCCAGGGCAGAGAGGGG - Intergenic
998800366 5:145863160-145863182 TCTGATGAAAGAGTAGGGCAAGG - Intronic
998817821 5:146031637-146031659 AATGATGACACAGCAGAGCTTGG - Intronic
1002045778 5:176541155-176541177 GCAGATGCCAGAGCAGAGGTGGG - Intergenic
1002448735 5:179307208-179307230 GCAGATGGCGGAGCACAGCAGGG - Intronic
1002569791 5:180133743-180133765 GATGAGGACAGAGGAGTGCATGG + Intronic
1002799869 6:512153-512175 GCTGTTAACAGAGCTGAGAAGGG - Intronic
1003207604 6:4027624-4027646 GCTTATGACAGTGCCTAGCACGG - Intronic
1003549121 6:7086075-7086097 CCTGATGACAGAGCAGAGGCTGG + Intergenic
1004506185 6:16248738-16248760 GCTGATGACAGAGCAGAGCAGGG - Intronic
1005310524 6:24554761-24554783 ACTGGTAGCAGAGCAGAGCAAGG + Intronic
1005311475 6:24563447-24563469 GCAGCTGACAGAGCAGCGGAAGG - Exonic
1005838699 6:29725819-29725841 GCTGATGACAGACCTCAGGAGGG + Intronic
1007175364 6:39892680-39892702 GCTGGGGGCAGAACAGAGCATGG + Intronic
1007925694 6:45647693-45647715 GATGGTGACAGAACAGAGCCTGG - Intronic
1008592795 6:53010669-53010691 GCTGAGGGCAGAGCACACCAGGG - Intronic
1009195493 6:60679507-60679529 ACTGATAAGAGAGGAGAGCAAGG - Intergenic
1010515123 6:76763111-76763133 GCTGGTGTAACAGCAGAGCACGG - Intergenic
1011659969 6:89586363-89586385 GACGCTGACAGAGCACAGCACGG - Intronic
1011897055 6:92241497-92241519 GATGATGAGAGAGGAGAGCAAGG - Intergenic
1014783975 6:125597157-125597179 GCTGGGGACAGTGCAGAGCCTGG - Intergenic
1015099454 6:129458611-129458633 AGTGATGACAGAGCATTGCAAGG + Intronic
1016388696 6:143553790-143553812 GGTGATTACAAAGCAGAGGAAGG + Intronic
1017373179 6:153736492-153736514 GCTGATCCCAGGGCAGAGAAAGG - Intergenic
1017780471 6:157711612-157711634 GCTGATGACACAGAAGCCCAGGG - Intronic
1017929736 6:158941386-158941408 GCGGAGGACAGGGCTGAGCAAGG + Intergenic
1018090132 6:160339197-160339219 GCTGAAGATAGAGCAGACCTGGG + Intergenic
1018999628 6:168738236-168738258 GTTGATGACAGAGAAGAGTTGGG + Intergenic
1019003299 6:168774397-168774419 GCTGAGGAAAGAAAAGAGCAAGG + Intergenic
1019361096 7:604499-604521 GCTCAGGACAGAGCACACCAGGG + Intronic
1023285525 7:38615292-38615314 GCTCATCACAGAGCCTAGCAGGG + Intronic
1023625523 7:42111731-42111753 GCTGAGGAAAGAACAGAGCTAGG - Intronic
1023850869 7:44149634-44149656 GGTGATGTCAGAGCAGAGCCTGG - Intronic
1026307965 7:69158955-69158977 GATTATGAGAGATCAGAGCAAGG - Intergenic
1028667362 7:93362390-93362412 GCTGCTGTCAGAGAACAGCAAGG + Intergenic
1029127405 7:98304094-98304116 CCTGGGGACAGAGCAGAGCAAGG + Intronic
1029306799 7:99625596-99625618 GAGGATGACAGAACAAAGCAGGG + Intronic
1029512516 7:101005048-101005070 ACTGTTGACAGAGCTGAGCCTGG - Exonic
1030673958 7:112365588-112365610 GCTGATGACAGAGGCTAGCCTGG + Intergenic
1030774843 7:113521639-113521661 GATGAAGACAGAGCAGGACAGGG + Intergenic
1031877654 7:127160472-127160494 GAAGATTCCAGAGCAGAGCAGGG + Intronic
1033163166 7:139015264-139015286 GCTGGTGACAGAGCAGGGGCTGG + Intergenic
1034366290 7:150551429-150551451 GATGATGGCAGTGCAGATCAGGG - Intergenic
1035228357 7:157445797-157445819 GGTGATGACAGAGGGGAACAGGG - Intergenic
1035312119 7:157975998-157976020 GAGGATGGCAGAGCAGAGCTGGG + Intronic
1035430286 7:158814997-158815019 GCTAATGTCAGAGGTGAGCAAGG - Intronic
1035729653 8:1845206-1845228 GATGATGCCCCAGCAGAGCAGGG + Intronic
1036096641 8:5732205-5732227 TTTGATGAAAGAGCAGAGAAAGG + Intergenic
1036659936 8:10701424-10701446 GCAGATGGCAGAGCAGGGCAGGG - Intronic
1036698345 8:10993968-10993990 CCTCATGATAGGGCAGAGCAAGG - Intronic
1037602549 8:20409895-20409917 GCTGCTGACAGTGGAGAGCACGG - Intergenic
1038390112 8:27189587-27189609 AGCGATGACAGAGCAAAGCAGGG - Intergenic
1038412449 8:27368815-27368837 GCACATGACAGAGCAGAGTGTGG - Intronic
1040982940 8:53264118-53264140 TCTGATGACACAGCAGAGATTGG + Intergenic
1041453987 8:58038153-58038175 GCTGATGACATAGAAATGCATGG + Intronic
1046576613 8:116037649-116037671 GCTTATGACAGAGCACAGTCAGG + Intergenic
1046765007 8:118059619-118059641 GCTGATGAGGGACCATAGCAGGG - Intronic
1048020816 8:130537423-130537445 GATGTTTCCAGAGCAGAGCATGG + Intergenic
1048034965 8:130668999-130669021 GCTGGTTACAGAGCAGAGAGGGG + Intergenic
1048108231 8:131436472-131436494 GCTGATGAGAATGCAGAGAAAGG + Intergenic
1049290685 8:141800065-141800087 GCTGTGGACAGACCAGAGCCAGG - Intergenic
1049319500 8:141988476-141988498 GCTGGAGACTGAGAAGAGCAGGG - Intergenic
1049545257 8:143227813-143227835 GCTGAGGAAACAGCAGCGCAGGG - Intergenic
1050173860 9:2850285-2850307 GCCAATGACTGAGCACAGCAGGG - Intergenic
1051936545 9:22448219-22448241 GCTGAAAACAGTCCAGAGCAGGG - Intronic
1052847399 9:33349383-33349405 GAGGATGACAGGGCAGAGCATGG + Intronic
1052943859 9:34151604-34151626 GCTGATCACAGAGAAGAGCAAGG - Intergenic
1053102361 9:35381531-35381553 GCAGGAGACAGAGCAGAGAAAGG - Intronic
1053380133 9:37642119-37642141 CCTGTTGACAGAACAGAGGAGGG + Intronic
1054459619 9:65455691-65455713 CCTGGTGGCAGAGCAGAGCTGGG - Intergenic
1055013709 9:71593823-71593845 GGGGAAGACAGAGCAGAGAAAGG + Intergenic
1055742192 9:79402358-79402380 ACTGAGGTCAGAGCAGAGCTGGG - Intergenic
1055797410 9:79989650-79989672 GCTTTTGACAGTACAGAGCAGGG + Intergenic
1055859981 9:80737804-80737826 GCTGAGGACTGAGCAGCACACGG + Intergenic
1056214656 9:84395699-84395721 ACTGATGAAAGTGCAGACCATGG + Intergenic
1056712383 9:89001328-89001350 GCAGATGACCAAGAAGAGCACGG - Exonic
1056835203 9:89949322-89949344 GCTGATAACAGAGAAGGGGAGGG - Intergenic
1057268044 9:93631714-93631736 GCAGGTGTCAGAGCAGAGTAGGG + Intronic
1057559632 9:96117038-96117060 GCTGAAGACAGAGCTCAGCCTGG + Intergenic
1058744979 9:107981614-107981636 GCAGATGAGAAAGCATAGCAAGG - Intergenic
1059178275 9:112187837-112187859 CCTGAGAACAGAGCAGAGCTAGG - Intergenic
1059366016 9:113786899-113786921 GCAGATGGCAGAGTGGAGCAGGG - Intergenic
1059544225 9:115160250-115160272 GCTGCTGACAAAGCAGTGAATGG - Intronic
1059814380 9:117895163-117895185 TCTGATCACAGAGCAAAGCTTGG + Intergenic
1060205119 9:121678149-121678171 GCTGATGAGAGAGGGGAACAAGG - Intronic
1061168337 9:128937502-128937524 CAAGATCACAGAGCAGAGCAGGG - Intronic
1061291976 9:129655553-129655575 CCTGAGGACCCAGCAGAGCAAGG - Intergenic
1061954508 9:133954640-133954662 GCTGATGCTCGAGCAGGGCAAGG + Intronic
1062018363 9:134303801-134303823 GCTGAGGACGGAGGTGAGCAGGG - Intergenic
1062114647 9:134801882-134801904 GCTGAGAACAGTGCAGGGCAGGG + Intronic
1187096337 X:16152380-16152402 GCTGGTGACAAAGTGGAGCATGG - Exonic
1188322136 X:28752726-28752748 TATGATAACAGAGGAGAGCATGG + Intronic
1189280764 X:39818917-39818939 CCCGATGACAGAGCATAGCAGGG - Intergenic
1189724858 X:43958290-43958312 ACTGATAACAGTGCAAAGCACGG + Intronic
1191842200 X:65521293-65521315 GGGAATGAGAGAGCAGAGCACGG + Intronic
1192054084 X:67755833-67755855 GCTGCTGAAAGCTCAGAGCATGG + Intergenic
1193186134 X:78514908-78514930 GCTGATGGCAGAGAACAGCAGGG - Intergenic
1195317462 X:103693033-103693055 GCTAATGACAGAGGACACCAGGG + Intergenic
1195861758 X:109390523-109390545 GCTGTTCTCAGAACAGAGCAGGG - Intronic
1196741815 X:119031849-119031871 GCAGATGAGAGAGTAGAGAAGGG + Intergenic
1197415007 X:126164791-126164813 GCGGATGTCATAGAAGAGCAGGG + Exonic
1197649879 X:129052798-129052820 GCTGAAGACACAGAATAGCATGG - Intergenic
1199034500 X:143033895-143033917 GCTTGTGCCAGAGAAGAGCAAGG - Intronic
1200043502 X:153387515-153387537 CAGGAGGACAGAGCAGAGCAGGG + Intergenic
1200078130 X:153561967-153561989 CGTGATGACAGAGCAGTGCATGG - Intronic