ID: 1004506186

View in Genome Browser
Species Human (GRCh38)
Location 6:16248739-16248761
Sequence GGCTGATGACAGAGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004506186_1004506188 16 Left 1004506186 6:16248739-16248761 CCTGCTCTGCTCTGTCATCAGCC 0: 1
1: 0
2: 2
3: 46
4: 339
Right 1004506188 6:16248778-16248800 TATGTGTTAGTATAAAAGTGAGG No data
1004506186_1004506191 25 Left 1004506186 6:16248739-16248761 CCTGCTCTGCTCTGTCATCAGCC 0: 1
1: 0
2: 2
3: 46
4: 339
Right 1004506191 6:16248787-16248809 GTATAAAAGTGAGGGGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 144
1004506186_1004506192 26 Left 1004506186 6:16248739-16248761 CCTGCTCTGCTCTGTCATCAGCC 0: 1
1: 0
2: 2
3: 46
4: 339
Right 1004506192 6:16248788-16248810 TATAAAAGTGAGGGGAACCAGGG 0: 1
1: 0
2: 0
3: 19
4: 150
1004506186_1004506189 17 Left 1004506186 6:16248739-16248761 CCTGCTCTGCTCTGTCATCAGCC 0: 1
1: 0
2: 2
3: 46
4: 339
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506186_1004506190 18 Left 1004506186 6:16248739-16248761 CCTGCTCTGCTCTGTCATCAGCC 0: 1
1: 0
2: 2
3: 46
4: 339
Right 1004506190 6:16248780-16248802 TGTGTTAGTATAAAAGTGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004506186 Original CRISPR GGCTGATGACAGAGCAGAGC AGG (reversed) Intronic
900387723 1:2418168-2418190 GGCTGAAGACAGAGCAACGTGGG - Intergenic
900814227 1:4831100-4831122 TGCTGATGACACAGCAGAAGGGG - Intergenic
901764412 1:11490792-11490814 GGCTGCTTACAGAGCTGAGCTGG - Intronic
901974037 1:12930274-12930296 GGCTGAGGACAGATCAGTGCTGG + Intronic
902011143 1:13271494-13271516 GGCTGAGGACAGATCAGTGCTGG - Intergenic
902242565 1:15098809-15098831 TGTGGATGACAGAGCAGTGCTGG - Intronic
902663894 1:17924077-17924099 GGAAGAAGTCAGAGCAGAGCTGG + Intergenic
903224664 1:21887789-21887811 GGGTGATGACAGAGCCAGGCAGG - Intronic
903972252 1:27126585-27126607 GTCTGATGACACGGCACAGCTGG + Intronic
904058332 1:27686767-27686789 GGCACATCACAGAGCAGAGGCGG + Intergenic
904496145 1:30887855-30887877 GACTGAGGCCAGAGAAGAGCAGG - Intronic
905506659 1:38485289-38485311 GGCTGACAACAGAGCTAAGCAGG + Intergenic
906148427 1:43573571-43573593 CGCAGATGGCAGAGCAGAGTGGG - Intronic
906690526 1:47789858-47789880 GGCTGATGATACAGGAGAGAGGG - Intronic
906785394 1:48611104-48611126 GGCAGCTGACAGAGCTGGGCAGG - Intronic
907617284 1:55938070-55938092 GGCTGCTAACAGAGCAGCCCTGG + Intergenic
908639905 1:66211061-66211083 TCCTGATGACAGAGCACAGCAGG + Intronic
909392965 1:75136610-75136632 GGCTCATGTCAGAGGAGTGCGGG + Exonic
909688630 1:78379242-78379264 GGCTGAAGACAGTACAGTGCTGG - Intronic
910667177 1:89738515-89738537 GGCTGGAGGCAGAGCAGAGAGGG - Intronic
910675152 1:89808722-89808744 GGCAGTTGTCAGAGGAGAGCTGG + Intronic
911226430 1:95310732-95310754 GGCTGAGGACTGAGGAGAGAAGG - Intergenic
913491292 1:119382628-119382650 GACTTCTGACAGAGCAAAGCAGG + Intronic
913637688 1:120780030-120780052 GGCAGATCACAGAGTAGAGATGG + Intergenic
915314418 1:155019952-155019974 ACCTGCTGAGAGAGCAGAGCAGG - Intronic
915557344 1:156668033-156668055 TGCTGATGACAGTGCTGTGCTGG - Intergenic
915913652 1:159929000-159929022 GCCTGAGCCCAGAGCAGAGCTGG + Exonic
917311522 1:173684049-173684071 GGCAGAAGTCAGGGCAGAGCAGG + Intergenic
917724943 1:177819409-177819431 TGGTCATCACAGAGCAGAGCAGG + Intergenic
918421538 1:184369114-184369136 GGCTGAGGAGAGAGAAGAGTGGG + Intergenic
919885478 1:201930983-201931005 GGCTGATGTCTGTGCAGTGCGGG + Intronic
920052656 1:203173048-203173070 GGCTTATCACAGGGCAGAGTGGG - Intronic
920254068 1:204642464-204642486 GGCTGATGGGAGCGCAGAGCCGG - Intronic
920516840 1:206591329-206591351 GATTGATGACAGAGAACAGCTGG + Intronic
920694272 1:208170037-208170059 GGCTGAGGACTGAGAAGAGGTGG - Intronic
921560154 1:216647953-216647975 GGCTGATGGCACAGCAGGTCTGG - Intronic
924205843 1:241710696-241710718 GGCTGATGAGAGAGTATAGCTGG + Intronic
924249451 1:242116877-242116899 TGCTGATGACAGAGGAGTGTAGG - Intronic
924397491 1:243638463-243638485 GAATGTTGATAGAGCAGAGCAGG - Intronic
924592791 1:245419586-245419608 AGCTGATGACAGAGAGTAGCCGG + Exonic
924624389 1:245687396-245687418 TGCTGAGACCAGAGCAGAGCAGG + Exonic
1063946332 10:11179977-11179999 GGCTGCTGACAGAGAAGACTAGG - Intronic
1064277110 10:13916226-13916248 GGCAGATGATGGAGCTGAGCGGG - Intronic
1064698237 10:17989379-17989401 GGCTTATGACTGAGTAGAGGCGG + Intronic
1066586645 10:36943644-36943666 GGAGGGTGACAGAGCAGAGAGGG + Intergenic
1067082492 10:43219461-43219483 TGATGATGACAGGACAGAGCAGG + Intronic
1067082966 10:43221870-43221892 GGCTGAGGACAGGGCACAGCTGG + Intronic
1067975989 10:51025681-51025703 GCCTGACGACAGAGTAGAGGTGG - Intronic
1069725554 10:70575590-70575612 GGCTGCTGACTGAGCAGGGCAGG + Intergenic
1069842478 10:71348458-71348480 AGCCGATGACAGAGCTGGGCAGG + Intronic
1069882463 10:71602329-71602351 GGCTGCTGGGAGAACAGAGCTGG - Intronic
1070159874 10:73859907-73859929 GGCCGCCAACAGAGCAGAGCAGG + Intronic
1070330126 10:75410390-75410412 AGCTGAAGCCAGTGCAGAGCAGG + Intergenic
1070476141 10:76830910-76830932 GGCAGATGACAGAGCAAATCAGG + Intergenic
1070551676 10:77495298-77495320 GGCCCATCACAGAGCAGTGCAGG - Intronic
1070557494 10:77539795-77539817 GGCAGATTACGAAGCAGAGCTGG - Intronic
1071501339 10:86206398-86206420 GGCTGGTGACGGAGCTGCGCTGG - Exonic
1071771983 10:88739460-88739482 TGCTGAGGACAGGACAGAGCTGG + Intronic
1072433288 10:95392742-95392764 GGCTGATGACACAGGAGCTCTGG + Intronic
1072460034 10:95610360-95610382 GACTGGTGACAGATCAGGGCAGG + Intronic
1072849447 10:98872255-98872277 GGCTGGAGACAGAGTAGAGCAGG - Intronic
1072929881 10:99652873-99652895 GAATGAAGACATAGCAGAGCAGG - Intergenic
1073141995 10:101254249-101254271 GGATGGTGACAGAAGAGAGCAGG - Intergenic
1073426077 10:103456473-103456495 GTGAGGTGACAGAGCAGAGCTGG - Intronic
1073932034 10:108587134-108587156 GGCATGTGTCAGAGCAGAGCAGG - Intergenic
1073949562 10:108790672-108790694 GGCCGATGATAGAGCACAGCAGG - Intergenic
1074435260 10:113428658-113428680 GGTGGAAGACAGAGCAGAGCAGG + Intergenic
1076270072 10:129144648-129144670 AGAAGCTGACAGAGCAGAGCGGG + Intergenic
1076303187 10:129443291-129443313 GGCTGAAGACAGAGAAGGACAGG + Intergenic
1076858280 10:133127944-133127966 GGCTGAGCAGAGGGCAGAGCTGG - Intronic
1077143920 11:1036456-1036478 GGCTGGTCACGGAGCCGAGCTGG + Intronic
1077476002 11:2790781-2790803 GGCTGATGGCAGAGCTCAGAGGG + Intronic
1078929303 11:15901165-15901187 GGCTGACCACAGACCAGACCAGG + Intergenic
1080128230 11:28762934-28762956 GCCTGAGGACAGAGGAGAGATGG - Intergenic
1080773575 11:35364951-35364973 GGTGGATGGCAGAGCAGGGCAGG + Intronic
1082859007 11:57835815-57835837 AACTGATGACAGAGCAGAGAAGG + Intergenic
1083623783 11:64061509-64061531 CGGTGATCACAGTGCAGAGCCGG - Intronic
1083828738 11:65217724-65217746 GGCTCCTGAAAGAGCAGGGCGGG + Intergenic
1083890966 11:65595631-65595653 GGCTGAGCTCAGGGCAGAGCTGG - Exonic
1084143568 11:67250625-67250647 GGAAGATGACAGTGCAGAGGAGG + Exonic
1084318586 11:68360418-68360440 GGCTGAGAACAGACCAGACCTGG - Intronic
1084366965 11:68708021-68708043 GGCGGAGGGCAGAGCAGGGCAGG - Exonic
1084504431 11:69556361-69556383 GGCTGCTGAGGGAGCAGAGCCGG - Intergenic
1084531878 11:69732248-69732270 GGCTGACCACAGCGCAGAGATGG - Intergenic
1084750106 11:71198969-71198991 GGCAGGTGACTGAGCAGAACGGG - Intronic
1085265763 11:75236993-75237015 CTCTGATGACAAAACAGAGCTGG + Intergenic
1088267009 11:107997534-107997556 GGCTGAGGCCAGAGGATAGCTGG - Intergenic
1089177145 11:116557209-116557231 GGCTCAGGAAGGAGCAGAGCAGG + Intergenic
1090094520 11:123730026-123730048 GGGTGGTGAGAGAGCAGTGCAGG - Intronic
1090621217 11:128562679-128562701 GGCTCACCTCAGAGCAGAGCAGG - Intronic
1090931635 11:131302858-131302880 GGCTGCTGATAAATCAGAGCTGG + Intergenic
1092480760 12:8857290-8857312 GGCTGCTGACGGAGGAGATCAGG + Exonic
1094069060 12:26392973-26392995 AGCAGATGACAGAGCTGAGCAGG - Intronic
1096420919 12:51456960-51456982 GGCAGATGACAGAACAAAGCAGG + Intronic
1096781410 12:53994390-53994412 GGCCGCAGACAGAGCAGAGCGGG + Intronic
1099866286 12:88286294-88286316 GGTTGATACCAGAGCTGAGCAGG + Intergenic
1102606727 12:114073519-114073541 AGCTGATGACTGAGCACAGTAGG + Intergenic
1103217244 12:119211449-119211471 GGCTTATGAAATAACAGAGCTGG - Intronic
1103226648 12:119293474-119293496 GGCTGATGACCCAGCAGTGGTGG - Intergenic
1103340762 12:120220029-120220051 GTATGAGGACGGAGCAGAGCTGG + Intronic
1103724562 12:122991273-122991295 GGCTGAAGACAGGACAGAACAGG + Intronic
1103907542 12:124335279-124335301 GCCTGCAGGCAGAGCAGAGCTGG + Exonic
1104000440 12:124856761-124856783 GGCTGATAAAGGCGCAGAGCGGG + Intronic
1104504798 12:129321481-129321503 GGAGGATGGCAAAGCAGAGCTGG - Intronic
1105407146 13:20142305-20142327 TGCTGATGACTGAGCAGAACTGG - Exonic
1105415738 13:20210079-20210101 TGCTGATGGAAGAACAGAGCAGG - Intergenic
1106707958 13:32301595-32301617 AGCTGATGGCAGAGCAGAGAGGG - Intergenic
1108201355 13:48046997-48047019 GTCTGATGACAGACGAAAGCTGG - Exonic
1108345335 13:49540490-49540512 AGCTTATGACAGGGCAGAGGTGG + Intronic
1111556286 13:89884896-89884918 GGCTGTTGAGATAGCAGAGATGG - Intergenic
1112315890 13:98361778-98361800 GGCTAATGACAGATCAAAGGAGG - Intronic
1113358516 13:109606539-109606561 TTCTGAAGACAGAGCAGAGGAGG - Intergenic
1113885960 13:113658503-113658525 GATTGAGGTCAGAGCAGAGCCGG + Intergenic
1113954432 13:114089589-114089611 GGCTGATGTCCGTGCAGGGCTGG - Intronic
1114637286 14:24195191-24195213 GGAGGATGAGAGAGCAGAGGTGG - Intronic
1116338490 14:43691079-43691101 GGCTGATGACATAGCACACGTGG + Intergenic
1118609071 14:67526014-67526036 GGTTGGTGATGGAGCAGAGCAGG - Intronic
1118839627 14:69500787-69500809 GGTGGGTGACAGGGCAGAGCTGG + Intronic
1119762071 14:77158754-77158776 GGGTGAGGACAGAGCAAGGCTGG - Intronic
1121321728 14:92995478-92995500 GGCTGATTTCAGAGCAGAAGTGG - Intronic
1122608425 14:102963906-102963928 GCCTCATGGCACAGCAGAGCTGG + Intronic
1123999539 15:25743303-25743325 ATCTGATGACTGAGCAGATCTGG - Intronic
1124230025 15:27936515-27936537 GGCTGATGGCCAAGCAGTGCAGG - Intronic
1124240735 15:28025634-28025656 GGCTGCTGAGTGAGCAGAGAAGG - Intronic
1124444370 15:29716138-29716160 GGAAAATGACAGGGCAGAGCTGG - Intronic
1124798624 15:32807542-32807564 ATCTGCTGAGAGAGCAGAGCTGG - Intronic
1126499201 15:49325792-49325814 GGGTGGTGACAGAGCAGCTCTGG + Intronic
1127638262 15:60891657-60891679 GGCAGAGGCCAGAGCAGAGTGGG - Intronic
1129128769 15:73470948-73470970 GGCTGATGAGAGTGCACAGTAGG + Intronic
1129348244 15:74938035-74938057 GGCTGAGGACAGAGAGAAGCCGG + Exonic
1129661357 15:77554733-77554755 GGCTGAAGAGGGAGCAGAGAGGG + Intergenic
1130221208 15:82021068-82021090 GGGTGCTGACAGAGCCCAGCAGG + Intergenic
1130223291 15:82039434-82039456 GGCTGATGTCTGAGCATAGGAGG - Intergenic
1130371988 15:83292812-83292834 GGCTGATGTTTGTGCAGAGCAGG + Intergenic
1132188382 15:99825667-99825689 GGCTGATGGCAGATTAGAGTAGG - Intergenic
1132998627 16:2837868-2837890 GGCTGATGGCACAGCAGCCCTGG + Intronic
1133726588 16:8543173-8543195 GACTGACTACAGAGCAAAGCTGG + Intergenic
1134573017 16:15307913-15307935 GGCTAATGACTGAGCATGGCAGG - Intergenic
1134573213 16:15309452-15309474 GGCTAATGACTGAGCATGGCAGG + Intergenic
1134729171 16:16446506-16446528 GGCTAATGACTGAGCATGGCAGG - Intergenic
1134729365 16:16448041-16448063 GGCTAATGACTGAGCATGGCAGG + Intergenic
1134938264 16:18265358-18265380 GGCTAATGACTGAGCATGGCAGG + Intergenic
1135086369 16:19477729-19477751 GGAAGATGACACAGCACAGCTGG - Intronic
1135506439 16:23041087-23041109 GGCTGCTGACTGATCAGATCAGG + Intergenic
1136751274 16:32637961-32637983 GGGTGATGGCAGGGCAGGGCAGG + Intergenic
1137665731 16:50247896-50247918 GGCTTTTTACAGAGGAGAGCAGG + Intronic
1137762969 16:50955586-50955608 GGCTGCAAACAGAGCAGATCTGG - Intergenic
1141194326 16:81848622-81848644 TACTGATGACTGAGCAGAGCAGG - Intronic
1141631746 16:85291647-85291669 AGCTGCTGACAGAGCCCAGCTGG + Intergenic
1141641639 16:85344929-85344951 CGGTGAGGGCAGAGCAGAGCTGG - Intergenic
1141774016 16:86110327-86110349 GGCTCATGGGAGAGCAGAGGAGG + Intergenic
1141774028 16:86110390-86110412 GGCTGATGGGAGTGCAGAGGAGG + Intergenic
1142308014 16:89296323-89296345 GGCAGAGGAGAGAGCAGGGCAGG - Intronic
1203053408 16_KI270728v1_random:897216-897238 GGGTGATGGCAGGGCAGGGCAGG + Intergenic
1142940762 17:3378416-3378438 GGGAGAGGCCAGAGCAGAGCAGG + Intergenic
1142943147 17:3400062-3400084 GGATGAAGACAGGGCATAGCGGG - Intergenic
1144776723 17:17788515-17788537 AGCTGAGGACAGGGCAGAGGAGG - Intronic
1146447676 17:32945482-32945504 GTGTGATGACAGCGCAGAGCAGG + Intergenic
1147652688 17:42071394-42071416 GGGTGAGGACAGAGCAGACCAGG - Intergenic
1147903022 17:43802864-43802886 GACTGGTGACAGAGAAGAGGGGG - Intronic
1148974146 17:51512093-51512115 GGCCAATGACAGAGCACAGCAGG - Intergenic
1148979919 17:51563656-51563678 AGATGATGATAGAGCAGACCTGG - Intergenic
1150289869 17:63974919-63974941 GGCAGGTCCCAGAGCAGAGCTGG - Intergenic
1151201073 17:72468408-72468430 GGCTAATGACAGGGCACCGCAGG - Intergenic
1151451036 17:74198455-74198477 AGCTGATGTCAGCCCAGAGCGGG - Intergenic
1151894444 17:76970489-76970511 GGCTGGAGTCAGGGCAGAGCAGG - Intergenic
1152389208 17:79992760-79992782 GGGTGATGTGAGAGCAGAGTTGG - Intronic
1152431719 17:80251992-80252014 GGATCAGGACAGAGCAGGGCCGG + Intronic
1152739340 17:82012217-82012239 GGGTGATGACTGAGGAGAGAAGG - Exonic
1152992895 18:378852-378874 GGGGGATGGCAGAGCAAAGCAGG - Intronic
1153343551 18:4002428-4002450 GGCTGATGAGGGAGAAGAGATGG - Intronic
1155998691 18:32359823-32359845 GGCTGAGGACAGAGGATGGCTGG + Intronic
1156910015 18:42400595-42400617 GCATGATGACACAACAGAGCTGG - Intergenic
1157179969 18:45488368-45488390 GGCTGAGGGCAGGGCAGGGCAGG + Intronic
1157332736 18:46715264-46715286 GGCTGAAGGCAGAGCAGCGGAGG - Intronic
1157713623 18:49867020-49867042 TGCAGAAGACAGAGCAGAGCTGG + Intronic
1157899252 18:51498206-51498228 GGCAGAACCCAGAGCAGAGCAGG + Intergenic
1158558190 18:58492399-58492421 GCCTCATGACAGATCAGAGAGGG - Intronic
1159201735 18:65195291-65195313 TGGTGAGGACAGAGCAGAGTGGG - Intergenic
1159541093 18:69777676-69777698 GGCTGAGGAGAGAGAAGAGGTGG - Intronic
1159857928 18:73611782-73611804 GGCTGATGACAGAACCTACCTGG - Intergenic
1160535348 18:79588675-79588697 GGCTCAGGACAGAGCATTGCAGG + Intergenic
1161332359 19:3694413-3694435 GACTGAGGACAGAGCAGGACTGG - Intronic
1162487860 19:10972750-10972772 AGCTGATAACACAGCAGACCCGG + Intronic
1162833478 19:13301398-13301420 GGCTGTTGACAGTGCATGGCAGG - Intronic
1163693438 19:18750215-18750237 AGCTCATGACAGAGCAGGCCAGG + Intronic
1164841141 19:31393268-31393290 GGTTTTTGACAGAGCAGAGCTGG + Intergenic
1165108714 19:33488974-33488996 GGCTGATGCCATAGCAGACAAGG - Intronic
1165438852 19:35812454-35812476 GGCTGGTGAGACAGCAGAGGAGG - Exonic
1166015236 19:39974503-39974525 GTCTGGTGGGAGAGCAGAGCTGG - Exonic
1166156973 19:40921037-40921059 GTCAGATGACACAGCACAGCAGG + Intergenic
1166740377 19:45111096-45111118 GGCAGAGGACTCAGCAGAGCTGG - Intronic
1166868082 19:45853189-45853211 GGCTGATGAAGGAGCCGAACGGG + Intronic
1167671591 19:50856686-50856708 GACTGAAGACAGAGAAGAGAGGG - Intronic
1168270746 19:55248486-55248508 TGCTGAGAACAGAGCAGAGCCGG + Intronic
926890276 2:17633674-17633696 GGAGGATGTCAGAGCAGAGTTGG + Intronic
927000854 2:18792803-18792825 GGCTGGTCACAGAGCAAAGTCGG - Intergenic
927907618 2:26872165-26872187 GGCTGAGGAGAGAGGAGAGCAGG + Intronic
928037609 2:27839809-27839831 GACTGATCCCAGAGCAGAGTGGG - Intronic
928428996 2:31202388-31202410 GGATGATGAGTGAGCAGAGGTGG + Intronic
929573978 2:43040785-43040807 TCCTGCTGACAGAGCACAGCAGG - Intergenic
930027677 2:47039365-47039387 GGAAGTTGGCAGAGCAGAGCTGG - Intronic
931859012 2:66334192-66334214 GCCTGATGTCAGAACAGAGAAGG - Intergenic
932139546 2:69263471-69263493 GGCTGATGAGAGAGGCCAGCTGG - Intergenic
932308880 2:70724211-70724233 GGCTCATGGCAGAACAGTGCTGG - Intronic
932432253 2:71683055-71683077 TGTTGATGGCAGAGCAGAGAAGG + Intronic
932449756 2:71802026-71802048 GGCTGATTCCAGAGCAGAAGAGG + Intergenic
935098387 2:99968990-99969012 GGCTGCAGAAAGAGCACAGCAGG + Intronic
935289925 2:101601458-101601480 GGTTGCTGAGAGAGCAGAGGTGG - Intergenic
937118608 2:119426978-119427000 GGCTCAAGGCAGAGCAGGGCAGG + Intergenic
938104347 2:128520016-128520038 GGCTGAGCACAGAGCAGAGCAGG + Intergenic
940168611 2:150802463-150802485 AGCCAATGACTGAGCAGAGCTGG + Intergenic
941683678 2:168426301-168426323 GGCAGATCACAGGGGAGAGCAGG - Intergenic
943442134 2:187938367-187938389 TGCTGATAACAGTGCAGAGTTGG - Intergenic
944821617 2:203438307-203438329 GGGTGATGAGAGAACAGAACTGG - Exonic
944891537 2:204122610-204122632 GGATCATGACAGATCTGAGCTGG + Intergenic
945189451 2:207171592-207171614 GGCTGCTGACTGATCAGAGTGGG - Intergenic
945483814 2:210370848-210370870 GGCTGAGGCAAGAGCAGGGCAGG - Intergenic
945709127 2:213274396-213274418 TGCTGATGACAAACTAGAGCAGG - Intergenic
946296364 2:218786893-218786915 GGCTGATGTGAGAGGACAGCTGG - Intronic
946426404 2:219600161-219600183 GGCTGAGGCCAGAGAACAGCTGG - Intronic
946680166 2:222205415-222205437 GGCTGATGTGAGAGCATAGAGGG + Intronic
947090517 2:226505901-226505923 GGCTGAGGTGAGAGGAGAGCTGG + Intergenic
947286478 2:228521893-228521915 TGATTATGACAGAGGAGAGCTGG + Intergenic
947418625 2:229922173-229922195 GGCTGCTGAGAGAGTCGAGCCGG - Intronic
948915857 2:241034779-241034801 GGTTGATGGCAGAGGAGAGGTGG + Intronic
1168807665 20:682072-682094 GGCTGATGACTGAGCATGGTGGG - Intergenic
1169729288 20:8768746-8768768 GTCAGATGACATAGCAGATCTGG + Intronic
1170775373 20:19370870-19370892 GGCTGCTGACAGCCCAGAGCCGG - Intronic
1171057740 20:21924042-21924064 AGCCAATGACAGAGCACAGCAGG + Intergenic
1172200947 20:33125562-33125584 GACTCATGACAGGGCAGATCTGG - Intergenic
1172567458 20:35941834-35941856 GGCTGATGTCAATGCAGAGGAGG + Intronic
1173744603 20:45426725-45426747 GTCTGAGGACAGAGCACAGCAGG - Intergenic
1175596711 20:60240459-60240481 AGCTTCTGTCAGAGCAGAGCAGG + Intergenic
1175881589 20:62262523-62262545 GGACGATGGCGGAGCAGAGCTGG + Intronic
1176035785 20:63035828-63035850 GGCTGAGGGCAGGGCAGAGCAGG + Intergenic
1179252693 21:39686024-39686046 GGTTGATGTGAGAGCTGAGCAGG - Intergenic
1179447986 21:41446883-41446905 GGCTTAAGACAGAGAAGAGTGGG + Intronic
1179561091 21:42216654-42216676 GGCTGAGGACAGAGTAGTACAGG + Intronic
1179873624 21:44256366-44256388 GGCTGGAGACAGGTCAGAGCGGG - Intronic
1180664330 22:17497872-17497894 GGCTGATGACAGAACAAACAGGG - Intronic
1180954180 22:19734149-19734171 GGCTGCTGTCTGAGCAGGGCTGG + Intergenic
1181831756 22:25565259-25565281 GGCGGGTGACACAGCGGAGCGGG + Intronic
1182037940 22:27214058-27214080 GGATGACGACAGAGGAGAGGTGG - Intergenic
1182159791 22:28110127-28110149 GGCTGAAGTCAGGGCAGGGCAGG + Intronic
1182582150 22:31320624-31320646 GGCTGATGCCAGTGGAGAGAGGG + Intergenic
1183061429 22:35338646-35338668 GGCTGATGCAAGAACGGAGCGGG - Intronic
1183079007 22:35444444-35444466 GGCTGATGGAGGAGCAGGGCAGG + Intergenic
1183834861 22:40443874-40443896 GGATGATGTCAGAGGAGGGCTGG + Intronic
1184708928 22:46236403-46236425 AGCTTATGACAGTCCAGAGCGGG - Exonic
1184799671 22:46751944-46751966 AGCCAAGGACAGAGCAGAGCAGG + Intergenic
1185246323 22:49775154-49775176 GGTGGATGTCTGAGCAGAGCTGG + Intronic
1185324187 22:50217641-50217663 GGCTGAGGACAGGGCAGGGTGGG - Intergenic
949915731 3:8963188-8963210 GGCTAGTGGCAGGGCAGAGCCGG + Intronic
950014362 3:9745396-9745418 GGCTGATGACCTAACAGAGGTGG - Intronic
953792415 3:45958439-45958461 GGCTGGTGACAGTGCAGGGCTGG + Exonic
954137048 3:48586718-48586740 GGAGGATGACAGAGCAGGGATGG + Intronic
954380013 3:50214326-50214348 GGCTGAAGACAGGGCAGGGCAGG + Intronic
955164290 3:56495519-56495541 GGCTGCTGACAGATCAGGGTGGG + Intergenic
955234284 3:57125818-57125840 GGCTGAAGACAGAGTCGAGGAGG + Intronic
955767217 3:62357433-62357455 GGATGAAGGCAGAGCAGAGTTGG - Intergenic
956677777 3:71752312-71752334 GAGGGATGACAGAGCAGAGCCGG - Intronic
957911528 3:86624939-86624961 GGCTGATGACACAGCTCAGAAGG + Intergenic
958006529 3:87818961-87818983 AGCTGAAGACAGAGGGGAGCAGG - Intergenic
958988652 3:100814481-100814503 GGCTGATGACAGAGAGTAGTTGG - Intronic
961636576 3:128336604-128336626 GGCAGAGGGAAGAGCAGAGCAGG - Intronic
962741939 3:138368203-138368225 GGCTGTTAACAGAGCAGAGATGG + Intronic
963121478 3:141780547-141780569 GGCTCATGACAAGGCAGAGATGG - Exonic
964511791 3:157460597-157460619 GGGTGCTAACAGAGCAGAGAAGG + Intronic
964600587 3:158496699-158496721 GGCTCATCACAGACCAAAGCTGG - Intronic
966306514 3:178541932-178541954 GGCTGGAGTCGGAGCAGAGCAGG - Intronic
967022365 3:185533902-185533924 AGCTGGGGAGAGAGCAGAGCAGG + Intronic
967325563 3:188235152-188235174 GGAGGAGGAGAGAGCAGAGCAGG + Intronic
968930488 4:3576222-3576244 GCCTGGTGGCAGAGCAGAGCTGG + Intergenic
969859724 4:10026164-10026186 AACTGAGGACAGAGGAGAGCAGG - Intronic
970275122 4:14391391-14391413 GTCCAATGACAGAGCAGACCTGG - Intergenic
971478287 4:27092184-27092206 GGGTGGGGAAAGAGCAGAGCTGG + Intergenic
972331457 4:38068009-38068031 GGATGATGAGAGAGCAGAGCTGG + Intronic
975612404 4:76215070-76215092 AGCTCATGACTGAGCACAGCAGG - Intronic
975615789 4:76245581-76245603 TGCTGACGCCAGGGCAGAGCAGG + Intronic
975995360 4:80307901-80307923 GGCTGATTCTGGAGCAGAGCTGG + Intronic
978466705 4:109016335-109016357 GGCTGAGGGCAGCGCAGTGCAGG + Intronic
982764994 4:159335918-159335940 GGCTCAGGACAAAGCATAGCTGG - Intronic
984657850 4:182339042-182339064 GTCTGATGACAGAGGTGAGGGGG - Intronic
984707382 4:182857581-182857603 GGCCCAAGGCAGAGCAGAGCAGG - Intergenic
985930799 5:3056150-3056172 GGCTGCTCACAGAGGAGAGGCGG + Intergenic
986559672 5:9048015-9048037 AGCTGATGCCTCAGCAGAGCTGG - Intronic
986676367 5:10189159-10189181 GGCAGATGACAGAGCAGCGGGGG - Intergenic
989393645 5:40929283-40929305 GGGTGATGTGAGAGCACAGCAGG + Intronic
989700762 5:44262120-44262142 GGGTGATGACAGAGCGCAGAGGG - Intergenic
990835648 5:60016374-60016396 AGCTGATGACTGATCAGAGTGGG + Intronic
991777463 5:70099115-70099137 GGCTGAAGGCATTGCAGAGCTGG - Intergenic
991856751 5:70974559-70974581 GGCTGAAGGCATTGCAGAGCTGG - Intronic
992947983 5:81828257-81828279 GGCAGAAGGCACAGCAGAGCTGG - Intergenic
994744587 5:103663217-103663239 GGCAGGAGAGAGAGCAGAGCAGG + Intergenic
996461728 5:123752572-123752594 GGCTGATGGTAGAGGAGAGGAGG + Intergenic
997196487 5:131983695-131983717 GGCTGTTGCCTGGGCAGAGCTGG - Intronic
997198433 5:131994973-131994995 GGCAGGTGGCAGAGGAGAGCAGG + Intronic
997306529 5:132841147-132841169 GGCTGATGCCAGGGCAGAGAGGG - Intergenic
998975022 5:147636087-147636109 AGCCGAGGACAGAGCAGTGCCGG + Intronic
999928071 5:156401272-156401294 GGCTGATGACGAGACAGAGCTGG + Intronic
1001342794 5:170862474-170862496 GGCTGACGATAGAGCCGCGCCGG - Intronic
1001753920 5:174151774-174151796 GACTGAAGGCAGAGCAGGGCAGG - Intronic
1002045779 5:176541156-176541178 AGCAGATGCCAGAGCAGAGGTGG - Intergenic
1002448736 5:179307209-179307231 GGCAGATGGCGGAGCACAGCAGG - Intronic
1004506186 6:16248739-16248761 GGCTGATGACAGAGCAGAGCAGG - Intronic
1006006957 6:31010309-31010331 GGCGGAGGAGAGAGCAGAGTCGG - Intergenic
1006260161 6:32861204-32861226 GCCTGACGTCAGGGCAGAGCTGG - Intergenic
1006981724 6:38153144-38153166 GGCGAATGGCAGACCAGAGCCGG - Exonic
1007094718 6:39206141-39206163 AGCTGGTGACCCAGCAGAGCAGG + Intronic
1008409173 6:51153276-51153298 GGGTGATGACAAAGCTGACCAGG + Intergenic
1012273656 6:97245038-97245060 GGCTGTTGAGGGAGCATAGCGGG - Intronic
1012369464 6:98485751-98485773 AGCTGAAGGCAGATCAGAGCAGG - Intergenic
1015200841 6:130578456-130578478 GGCTGAGGACAGGGCAGAAGAGG + Intergenic
1015620108 6:135122828-135122850 GGAAGGTGACACAGCAGAGCTGG - Intergenic
1016748022 6:147601963-147601985 GGCTGAAGACTCAGCAGAGTTGG + Intronic
1016904170 6:149132592-149132614 TGCTGGTGGCACAGCAGAGCTGG - Intergenic
1017507089 6:155078617-155078639 GGATGATGTCAGGGCAGAGCTGG - Intronic
1017510766 6:155112721-155112743 TGCAGACGGCAGAGCAGAGCAGG - Intronic
1018090131 6:160339196-160339218 GGCTGAAGATAGAGCAGACCTGG + Intergenic
1018608692 6:165625312-165625334 GGCTGCAGGCAGAGCAGTGCAGG + Intronic
1018706652 6:166468436-166468458 GGCTGAAGGAAGAGGAGAGCTGG + Intronic
1018833842 6:167468704-167468726 GGCCCAGGACACAGCAGAGCAGG - Intergenic
1018999627 6:168738235-168738257 TGTTGATGACAGAGAAGAGTTGG + Intergenic
1019272195 7:156571-156593 GGATGATGACAGACCAGGGCCGG - Intergenic
1019304098 7:324353-324375 GGCTCAGGAGAGGGCAGAGCTGG - Intergenic
1019361095 7:604498-604520 GGCTCAGGACAGAGCACACCAGG + Intronic
1019405759 7:883144-883166 GACTCCTGGCAGAGCAGAGCAGG + Intronic
1020006205 7:4784903-4784925 CGCAGATGACAGGTCAGAGCAGG + Exonic
1020628709 7:10615109-10615131 GACTGGTGGTAGAGCAGAGCTGG - Intergenic
1022044485 7:26612164-26612186 GGCAGTTCACATAGCAGAGCAGG - Intergenic
1022289282 7:28985625-28985647 AGCTGATGTCTGAGCAGGGCTGG - Intergenic
1023660146 7:42462672-42462694 TGCTGAGGACAAAGCAGAGGGGG - Intergenic
1023680050 7:42676407-42676429 GGATGGTCACAGAGGAGAGCTGG - Intergenic
1024241316 7:47438655-47438677 GTCTGATGCCAGAGCAGCCCTGG - Intronic
1029339252 7:99929576-99929598 GGCTGCTGGCGGAGGAGAGCCGG - Exonic
1029347940 7:99992422-99992444 GGCTGCTGGCGGAGGAGAGCTGG + Intergenic
1029735050 7:102460976-102460998 GGTTGGTGGCAGAGCAGAGAGGG - Intronic
1031076679 7:117220038-117220060 GGCTGGTGAAAGGGCAGAGATGG - Intronic
1033343870 7:140512458-140512480 GGCTGGTGAGAGAGAAGGGCAGG + Intergenic
1033409504 7:141104511-141104533 AGCTGATGACAGGGCTGAGAGGG - Intronic
1033431767 7:141295790-141295812 GGCAGGTGAAAGAGCAGAGAGGG + Intronic
1035228358 7:157445798-157445820 GGGTGATGACAGAGGGGAACAGG - Intergenic
1035312118 7:157975997-157976019 CGAGGATGGCAGAGCAGAGCTGG + Intronic
1035479894 7:159173332-159173354 GGCTGCTGACTGATCAGAGTGGG + Intergenic
1036173193 8:6510226-6510248 GGTTCAGGACAGATCAGAGCAGG + Intronic
1036659937 8:10701425-10701447 GGCAGATGGCAGAGCAGGGCAGG - Intronic
1037468618 8:19185457-19185479 GGCTGAGAGCAGAGCAGAGGAGG - Intergenic
1037709655 8:21345502-21345524 GGCTGAGGACACAGCAAACCAGG - Intergenic
1037816062 8:22112644-22112666 GGCTGCAGGCAGAGCACAGCTGG + Intergenic
1040507153 8:48059287-48059309 GGCTTATGAAAGAGCTGAGAAGG - Intronic
1042282918 8:67074300-67074322 GGCCGAAGACAAAGCAGAGTTGG + Exonic
1042705411 8:71661408-71661430 GGCTAATGACAGTGCAGATCGGG - Intergenic
1044254383 8:90043442-90043464 GGATAATGAGAGAGCAGAGAAGG - Intronic
1044379079 8:91512206-91512228 GGCTGAAGCCACAGCAGAACCGG - Intergenic
1045354390 8:101372450-101372472 GGCCGAGGTCAGAGCAAAGCAGG + Intergenic
1045362119 8:101442385-101442407 GGTTAATGACATAGCAGAGGGGG + Intergenic
1045703505 8:104894224-104894246 GGCTGATGGCAGGGCATGGCTGG + Intronic
1047145757 8:122197522-122197544 GGGACATGACAGAGCACAGCTGG - Intergenic
1047906725 8:129480575-129480597 GGCTGCTCAAGGAGCAGAGCTGG - Intergenic
1048034964 8:130668998-130669020 AGCTGGTTACAGAGCAGAGAGGG + Intergenic
1049069417 8:140345261-140345283 TGCTGAGGACAGAGCAGGCCAGG + Intronic
1054459621 9:65455692-65455714 GCCTGGTGGCAGAGCAGAGCTGG - Intergenic
1055370904 9:75597992-75598014 GCCTGATGACAGTCCAGTGCAGG + Intergenic
1055742193 9:79402359-79402381 TACTGAGGTCAGAGCAGAGCTGG - Intergenic
1055797409 9:79989649-79989671 GGCTTTTGACAGTACAGAGCAGG + Intergenic
1055930931 9:81559208-81559230 GGTTGATGTCTGGGCAGAGCTGG - Intergenic
1057268043 9:93631713-93631735 GGCAGGTGTCAGAGCAGAGTAGG + Intronic
1057565746 9:96164545-96164567 TGCTAATGACACAGCAGGGCAGG - Intergenic
1058267309 9:102918715-102918737 GGCTGATCAAAGAGGACAGCTGG - Intergenic
1059281490 9:113137939-113137961 TACTGGTGGCAGAGCAGAGCTGG - Intergenic
1059430124 9:114244991-114245013 GGCTGAGCCCAGAGCAGAGATGG + Intronic
1060304131 9:122395033-122395055 GGTGGATGACAGGGCAGAGCAGG + Exonic
1060822210 9:126668021-126668043 GGGTGTGGACAGAGCAGGGCTGG + Intronic
1062018364 9:134303802-134303824 GGCTGAGGACGGAGGTGAGCAGG - Intergenic
1062562194 9:137146576-137146598 GGCTGCAGAGAGATCAGAGCTGG + Intronic
1186145405 X:6619531-6619553 CGCTGAGGACAGAGAAGAGCTGG + Intergenic
1186658283 X:11640204-11640226 GCCTGATGAGAGAGCAGTGAGGG - Intronic
1189280766 X:39818918-39818940 GCCCGATGACAGAGCATAGCAGG - Intergenic
1190057085 X:47187263-47187285 GGCTGATGACAGAGGGGTGGAGG + Intergenic
1190255101 X:48756507-48756529 GGATGGTGACAGAGTACAGCTGG - Intergenic
1192157730 X:68758962-68758984 GGCTGACCACAGAACTGAGCTGG - Intergenic
1193186135 X:78514909-78514931 AGCTGATGGCAGAGAACAGCAGG - Intergenic
1193203057 X:78714999-78715021 GGCTGTTGAGGGAGCACAGCGGG + Intergenic
1195861759 X:109390524-109390546 GGCTGTTCTCAGAACAGAGCAGG - Intronic
1196427931 X:115590717-115590739 GGCTGAGGCCAGAGAATAGCTGG + Intronic
1196889331 X:120276950-120276972 GGATGGTGGCAGACCAGAGCAGG + Exonic
1200247113 X:154532149-154532171 GGCTGGGGACAGAGCCCAGCGGG - Intronic