ID: 1004506187

View in Genome Browser
Species Human (GRCh38)
Location 6:16248760-16248782
Sequence ACATAATTCATTAGTAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004506187_1004506190 -3 Left 1004506187 6:16248760-16248782 CCATTGCTACTAATGAATTATGT 0: 1
1: 1
2: 3
3: 13
4: 209
Right 1004506190 6:16248780-16248802 TGTGTTAGTATAAAAGTGAGGGG 0: 1
1: 0
2: 2
3: 19
4: 329
1004506187_1004506191 4 Left 1004506187 6:16248760-16248782 CCATTGCTACTAATGAATTATGT 0: 1
1: 1
2: 3
3: 13
4: 209
Right 1004506191 6:16248787-16248809 GTATAAAAGTGAGGGGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 144
1004506187_1004506188 -5 Left 1004506187 6:16248760-16248782 CCATTGCTACTAATGAATTATGT 0: 1
1: 1
2: 3
3: 13
4: 209
Right 1004506188 6:16248778-16248800 TATGTGTTAGTATAAAAGTGAGG No data
1004506187_1004506189 -4 Left 1004506187 6:16248760-16248782 CCATTGCTACTAATGAATTATGT 0: 1
1: 1
2: 3
3: 13
4: 209
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506187_1004506192 5 Left 1004506187 6:16248760-16248782 CCATTGCTACTAATGAATTATGT 0: 1
1: 1
2: 3
3: 13
4: 209
Right 1004506192 6:16248788-16248810 TATAAAAGTGAGGGGAACCAGGG 0: 1
1: 0
2: 0
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004506187 Original CRISPR ACATAATTCATTAGTAGCAA TGG (reversed) Intronic
905611228 1:39353559-39353581 ACAGAATTCATTAGTGCAAATGG - Intronic
906980962 1:50628921-50628943 ACATAAATAATAAGTAGCAGTGG - Intronic
907768681 1:57437937-57437959 ACACAATTAATTAGTGGCAGAGG - Intronic
910439157 1:87234439-87234461 AGATATTTCATTAATAGCTAGGG + Intergenic
910534751 1:88284414-88284436 ACATAATTGTTTAGAAGCAGAGG - Intergenic
910571361 1:88708305-88708327 ACTTATTTCATTATGAGCAAGGG - Intronic
910735770 1:90455257-90455279 ACATAATTCCATGCTAGCAAAGG + Intergenic
912046037 1:105459077-105459099 AAATAATTCATTGGTTCCAAAGG + Intergenic
913660415 1:121001963-121001985 ACATAATCCCCTAGAAGCAAAGG - Intergenic
914011779 1:143785120-143785142 ACATAATCCCCTAGAAGCAAAGG - Intergenic
914166054 1:145176014-145176036 ACATAATCCCCTAGAAGCAAAGG + Intergenic
914650405 1:149693779-149693801 ACATAATCCCCTAGAAGCAAAGG - Intergenic
915803264 1:158817287-158817309 ACACAGCTCATTAGTAGCTAAGG - Intergenic
916392011 1:164341643-164341665 ACAAAATTCATTGTAAGCAAAGG + Intergenic
918814067 1:189160209-189160231 TCATAATTCAATATTAGAAAAGG + Intergenic
919265629 1:195261073-195261095 ACACAATTCATAAATAGCTAAGG + Intergenic
920517538 1:206597429-206597451 ACATGCTTAGTTAGTAGCAAAGG - Intronic
923420744 1:233812361-233812383 ACATCCTTCATCTGTAGCAAAGG - Intergenic
923884500 1:238139792-238139814 ACATAACTCCTGAGTAGTAAGGG - Intergenic
1063028734 10:2209950-2209972 ATATAATTCATAAGTGGCCAGGG + Intergenic
1063719798 10:8568546-8568568 ACATAATTAATTATTACCAGAGG + Intergenic
1064837220 10:19546795-19546817 ACATAAATCAACAGAAGCAATGG - Intronic
1066033666 10:31456606-31456628 ACATACTTCATTATGTGCAAAGG - Intronic
1068006130 10:51393533-51393555 ATATAATTAATAAGAAGCAAAGG + Intronic
1069523762 10:69149132-69149154 AAATTATTCATTAATAGCAAAGG + Intronic
1071008231 10:80908468-80908490 ACTTAATTCTTTATTAGGAAGGG - Intergenic
1071231111 10:83586926-83586948 AAATAATTCGTTAGAAGCACTGG + Intergenic
1071244481 10:83747381-83747403 ACATATTTCATAAGTAGATAAGG - Intergenic
1071595363 10:86918537-86918559 ACATGATTCTCTAGTAGAAAAGG - Intronic
1072262033 10:93687248-93687270 TCATGATACATTATTAGCAAAGG - Intronic
1073271498 10:102268398-102268420 ACCTAATTTCTTTGTAGCAAAGG + Intronic
1076507702 10:130988614-130988636 AAAAAATTTTTTAGTAGCAACGG - Intergenic
1080349230 11:31363426-31363448 ACTTAATTCATCATTAGCAATGG - Intronic
1080805497 11:35649451-35649473 ACATAGCTCATTAGTGGCAGAGG + Intergenic
1081350840 11:42050648-42050670 ACATAATTCTTAAAGAGCAAAGG + Intergenic
1085564968 11:77505486-77505508 AGATAAATAAATAGTAGCAATGG - Intergenic
1086234926 11:84617707-84617729 ATATAATTCATCATTAACAATGG + Intronic
1086302301 11:85440392-85440414 ACATAATTGATGATTAGGAAGGG - Intronic
1088507068 11:110537362-110537384 ACAATATTCATTTGTAGGAAAGG + Intergenic
1090159457 11:124477560-124477582 ACATAATTAATGAGTAGTCATGG + Intergenic
1090165411 11:124541645-124541667 AAATAATTTATTAGTAGCAAAGG - Intergenic
1092768600 12:11876056-11876078 AAATAATTCCTTGGGAGCAAGGG - Intronic
1093862828 12:24188789-24188811 CTGTAATTCATTAGTAGAAATGG - Intergenic
1095593006 12:43925711-43925733 ATATAATTCATAGGTAGAAAAGG - Intronic
1097325638 12:58273285-58273307 TCAGAAGTCAATAGTAGCAAAGG - Intergenic
1099510680 12:83532385-83532407 TAATTATCCATTAGTAGCAAGGG - Intergenic
1099960271 12:89390472-89390494 ACATATTTCAGTAGTAGCTGTGG - Intergenic
1099978175 12:89568418-89568440 ACATTATTCAGTAACAGCAAAGG - Intergenic
1102665883 12:114572400-114572422 ATATAATTCATTTGTATTAAAGG - Intergenic
1103226596 12:119293085-119293107 ACATAACAAATTTGTAGCAAAGG + Intergenic
1104171762 12:126288711-126288733 AAATAATTCACTTGTAGCAGAGG - Intergenic
1106461442 13:29973855-29973877 ACATAATTTAGTAGTGGCAGAGG - Intergenic
1106936238 13:34724017-34724039 ACATAGTTAATAAGTAGCAGAGG + Intergenic
1107653355 13:42567175-42567197 ACATAATTAAATAATATCAAAGG - Intronic
1108894860 13:55313479-55313501 AGATAATACATCAGGAGCAAAGG - Intergenic
1110183080 13:72640361-72640383 GCAAAATTCATTAGTTGAAAAGG - Intergenic
1111312827 13:86511935-86511957 ACATAATTCATTTGTGTAAATGG - Intergenic
1112991625 13:105520829-105520851 AAAAAATTCATTAATAGCATGGG - Intergenic
1113015083 13:105819688-105819710 ACATAAATCTTTAGTGGCCAAGG - Intergenic
1115060539 14:29183754-29183776 ATATAATTGATTATTAACAATGG - Intergenic
1117763191 14:59054329-59054351 ATGTAATTCATTAGTATAAAAGG + Intergenic
1120055428 14:79918558-79918580 ACATAATTTCTTAGTTGCAAGGG - Intergenic
1120118396 14:80648052-80648074 AAATAATTCATCAGGACCAAAGG - Intronic
1120259062 14:82159602-82159624 ACATGATTCCTGAGCAGCAAGGG - Intergenic
1124238099 15:28006692-28006714 ACATATTGCATAAGTAGCACTGG - Intronic
1124812581 15:32955946-32955968 AAAAAAATCATTAGTAGCCATGG - Intronic
1125401572 15:39310124-39310146 TCAAAATTCATTAGTACCAAGGG - Intergenic
1126189848 15:45867937-45867959 ACTTAATTTATTGATAGCAATGG + Intergenic
1127007631 15:54588180-54588202 ATATGGTTCATTAATAGCAATGG + Intronic
1128853214 15:70983462-70983484 AATTAATTCATTATAAGCAACGG - Intronic
1131040336 15:89259089-89259111 ACATAATCCATGCTTAGCAAGGG + Intronic
1133533331 16:6675794-6675816 AGATAATTGATTCGTAGCAGTGG - Intronic
1137225448 16:46502007-46502029 ACATGTTTTGTTAGTAGCAAGGG + Intergenic
1138868806 16:60855170-60855192 ACATAATTAACAAGTAGCAGAGG - Intergenic
1139063021 16:63278377-63278399 ACAAAAATTATTATTAGCAATGG + Intergenic
1140021196 16:71240497-71240519 ACATAAATCATTGATAGCAGAGG - Intergenic
1140268079 16:73437268-73437290 ACACAATTAACTAGTAACAAAGG + Intergenic
1146195878 17:30812253-30812275 ACATCAGTCATTAGTAATAATGG + Intronic
1146628478 17:34453047-34453069 ACATAGTTAACCAGTAGCAATGG + Intergenic
1148540454 17:48476277-48476299 ACACAATTCATAAATAGCAAAGG + Intergenic
1149369768 17:55981507-55981529 AGATAATTCATTAATAGCAATGG - Intergenic
1158177373 18:54672410-54672432 ACATAATTCATGATTAGGAACGG - Intergenic
1159423694 18:68255900-68255922 ATAGAATTCATTAATATCAAAGG - Intergenic
1159722610 18:71911460-71911482 AGAAAATTAATTAATAGCAAAGG - Intergenic
1165380035 19:35472782-35472804 ACTTAATTCATTACATGCAATGG + Intergenic
1166924714 19:46259464-46259486 ACATTATACATTAGAAGAAAAGG - Intergenic
927533269 2:23830786-23830808 ACAAACTTCATTAGCAGCACAGG + Intronic
930004031 2:46881908-46881930 ACACAGTTCATTTGCAGCAACGG - Intergenic
931947525 2:67326838-67326860 ATATAACTCATTTTTAGCAAAGG - Intergenic
933379698 2:81527018-81527040 AAATATTTCACTGGTAGCAAAGG + Intergenic
936168900 2:110150455-110150477 ATATAATTTATTACTAGCATAGG - Intronic
936557111 2:113505513-113505535 AAATAATCCATTAATAGCATCGG + Intergenic
936729562 2:115363972-115363994 ACATAGCTAGTTAGTAGCAAAGG + Intronic
938808086 2:134825411-134825433 ACATTATTCAGTAGTTGCACTGG - Intergenic
939353085 2:141066392-141066414 ACATAAATCATAAGTCACAAAGG + Intronic
939491861 2:142886126-142886148 AAATAAAACATAAGTAGCAAAGG + Intronic
939821149 2:146958500-146958522 ACAGAATGCATTGGTAGAAAGGG + Intergenic
941158094 2:162003076-162003098 ACAAAATTCATTGCTGGCAATGG - Intronic
941212339 2:162656364-162656386 ACATAATACATGAGGAGTAAGGG + Intronic
941784904 2:169487199-169487221 ACATACTTCTTTGGTATCAAAGG - Intronic
943089438 2:183356850-183356872 ACATAACTAATTAGAAGCAGAGG - Intergenic
943588242 2:189765550-189765572 AAATAATACATTAGTATTAATGG - Intergenic
944682157 2:202086986-202087008 ACATAGTTCATGATTACCAATGG + Intronic
944858103 2:203787224-203787246 ACATAATGCATTTGTTTCAATGG + Intergenic
945766283 2:213982394-213982416 ACATAATTCATTAGTAAGAACGG - Intronic
946375256 2:219304037-219304059 ACATAATTCATCAGTAGCAAAGG - Intronic
946808301 2:223495012-223495034 ACAAAATACATTAGCATCAAAGG + Intergenic
1170465787 20:16621458-16621480 ACATGACTCTCTAGTAGCAAGGG - Intergenic
1172491537 20:35342492-35342514 ACTTACTTCATTAGTAGGAGAGG + Intronic
1173898985 20:46572995-46573017 ACACAGCTCATTAGTAGCAGAGG - Intronic
1177549998 21:22608191-22608213 AAATTAATCATTAGTATCAAAGG - Intergenic
1177635213 21:23778796-23778818 AAATAAATCATTAATATCAATGG - Intergenic
1179543263 21:42098129-42098151 ACAGAAAACATTTGTAGCAATGG - Intronic
1181868943 22:25882704-25882726 ACATAAACCAGTAGTAGCACTGG - Intronic
1182192831 22:28481353-28481375 ATATGATTAATTATTAGCAATGG - Intronic
951155299 3:19345483-19345505 GCATATTTCTTTAGTACCAATGG - Intronic
951311709 3:21134170-21134192 ACATAATTTACCAATAGCAAGGG + Intergenic
951465428 3:22996153-22996175 ACATAATGCTTTAATAGAAATGG - Intergenic
952326585 3:32325830-32325852 TCATCATTCATTAGTCACAAAGG + Intronic
952833225 3:37582773-37582795 ACATAATTCCTGACTAGAAATGG - Intronic
953835775 3:46342124-46342146 ACAAATTTCATTAGTAGTCAGGG + Intergenic
954905189 3:54056068-54056090 ACATACTGCATTTGTACCAAAGG - Intergenic
955755894 3:62224583-62224605 ACATAATTCAATGATACCAATGG - Intronic
957738806 3:84235387-84235409 ACAAAATTAATTAGAAGAAAAGG - Intergenic
958108348 3:89106354-89106376 ACTGAATACATTATTAGCAAGGG + Intergenic
958119632 3:89268196-89268218 ACACAAGTCAGTAGTAGCACAGG + Intronic
959364107 3:105435023-105435045 ATATCATTGATTAGTAGCATAGG - Intronic
960706292 3:120484918-120484940 AAATAATTTATTAGAAGGAATGG + Intergenic
962941902 3:140132706-140132728 AAATACATCGTTAGTAGCAAAGG + Intronic
963097023 3:141554368-141554390 ACAGATTTCATGAGTAGAAAAGG - Intronic
963322995 3:143829699-143829721 ACATTATCTAATAGTAGCAATGG + Intronic
963713268 3:148772452-148772474 AAATACTCCATTAGCAGCAAAGG - Intergenic
964903286 3:161687047-161687069 ACATAGTTAATGAGTAGAAAGGG + Intergenic
965307733 3:167088017-167088039 ACATACATCATTATTAGGAAAGG - Intergenic
965989747 3:174801965-174801987 AAATTATTCATTTGTATCAAAGG - Intronic
966822612 3:183936996-183937018 ACATAATTCCAGAGTATCAAAGG + Intronic
968163414 3:196445413-196445435 ACATGATTCCTGAGTAGAAAGGG - Intergenic
972195755 4:36651845-36651867 ACATACTTCAATAGTAGGAACGG - Intergenic
973116860 4:46471940-46471962 ACAGAAGTAATGAGTAGCAATGG + Intronic
975701690 4:77073809-77073831 AAAGAATTCATTATTAGGAAAGG - Intronic
975926125 4:79455947-79455969 ACATATTTCACCAGTAGAAAAGG + Intergenic
976905267 4:90228582-90228604 ACATAATTCATCACCAGCAACGG + Intronic
976996365 4:91438594-91438616 ACATAATTCATCACCAGCAACGG + Intronic
977030255 4:91874330-91874352 ACATAAGACATTGGTAGCATTGG - Intergenic
977549035 4:98420897-98420919 ACATAATTCATTCCTAGGAGTGG - Intronic
977865399 4:102020156-102020178 TACTAATTTATTAGTAGCAATGG - Intronic
978148523 4:105406855-105406877 TCACCATTCATTAGAAGCAATGG + Intronic
978757759 4:112322648-112322670 AATTAATTCATTAGTTACAATGG + Intronic
980241864 4:130188454-130188476 TCATAAGTCATTAGTTGGAATGG + Intergenic
982449030 4:155530395-155530417 ACAGGATTCAATAGTACCAATGG - Intergenic
989433217 5:41379832-41379854 ATATAATCCAGTAGTAGAAAGGG + Intronic
990933895 5:61125987-61126009 AAATAATACAGTAGTACCAAAGG + Intronic
993169164 5:84394820-84394842 ACAGAACTAATTAGAAGCAAAGG - Intergenic
994491321 5:100447927-100447949 AAATAATTCCTAAATAGCAATGG + Intergenic
994818065 5:104610315-104610337 ACATAATTCATTATAAAAAATGG - Intergenic
997714355 5:136030719-136030741 ACACAATTCATTGGCAGGAAAGG - Intronic
1001112919 5:168913039-168913061 AAATAACTCATCAGTAGCAGGGG - Intronic
1004506187 6:16248760-16248782 ACATAATTCATTAGTAGCAATGG - Intronic
1005172486 6:23004285-23004307 ACAGAATTGATTAGCAGCCAAGG - Intergenic
1007503565 6:42316854-42316876 ACATGACTCATGAGTAGCAAGGG - Intronic
1008063268 6:47020874-47020896 AAATAAATCAACAGTAGCAAAGG + Intronic
1011310252 6:85973277-85973299 AAATAACTCATTAGCAGCCACGG - Intergenic
1011989404 6:93494496-93494518 AAAGAATTCACTAGTATCAATGG - Intergenic
1012109504 6:95210964-95210986 ATCTAATTCATTCTTAGCAATGG + Intergenic
1012360524 6:98372301-98372323 ACACAATTGGTTAGTAGCAGAGG - Intergenic
1012601833 6:101108101-101108123 ACATGGTTCATTAGCAGGAATGG + Intergenic
1013080017 6:106804220-106804242 ACAAAATTATTTAGAAGCAAAGG - Intergenic
1013798604 6:113913386-113913408 AGATACCTCATTAGAAGCAATGG - Intergenic
1013834651 6:114319553-114319575 ACATATATCATAAGTAGCACAGG + Intronic
1015764641 6:136702987-136703009 AAATAATTAATTAGGAGCCAGGG - Intronic
1018533289 6:164791571-164791593 AACTAATTCATTAGTAAAAATGG + Intergenic
1023292505 7:38683038-38683060 ACAGAATTCAGCAGAAGCAATGG + Intergenic
1025008303 7:55373145-55373167 ACTTAATTCATGATTACCAAGGG + Intronic
1027954133 7:84857996-84858018 CCATTATTCATTAGAAGAAATGG + Intergenic
1028072940 7:86475045-86475067 AGATAGTTCTTTACTAGCAAAGG - Intergenic
1029110042 7:98209170-98209192 ACAATATTCCTAAGTAGCAATGG + Exonic
1029949137 7:104564233-104564255 ACATCATTCAGTAGAAGCAGTGG - Intronic
1030331625 7:108277774-108277796 ACATAACTCCTTACCAGCAAGGG - Intronic
1030359877 7:108583989-108584011 ACATATTTCATAATTAGAAATGG + Intergenic
1030399766 7:109033876-109033898 ACATAATTCATTTAGAGCAGTGG + Intergenic
1034836586 7:154357992-154358014 ACATAATTCAAGAGTAACAAGGG - Intronic
1036041652 8:5089576-5089598 AAATAATTCATGAGTAAAAAAGG + Intergenic
1036179497 8:6571444-6571466 ACATATTTTTTTAGAAGCAACGG - Intronic
1038502005 8:28052771-28052793 ACACAACTCATTAGAAGGAAGGG - Intronic
1038884840 8:31651846-31651868 ACATAATTTATAAGCAGCATTGG - Intronic
1039137790 8:34346065-34346087 ACATAGTTCATAAGTGGCAGAGG + Intergenic
1039654450 8:39386411-39386433 ACATAATTCATGTGGAGAAAAGG - Intergenic
1042357798 8:67848181-67848203 AAATAATTAATTAGAAGGAAAGG - Intergenic
1042393357 8:68261854-68261876 AAAGATTTCATTAGTAGAAATGG + Intergenic
1044215662 8:89607268-89607290 ACATAATACCCTAGTTGCAAGGG - Intergenic
1044529429 8:93290804-93290826 ACATAAATTTTTAGTAGAAAGGG + Intergenic
1046333920 8:112757741-112757763 ATATAATTCCTTAGATGCAAAGG - Intronic
1046533627 8:115479716-115479738 ACAGAATAAATAAGTAGCAAAGG + Intronic
1048479667 8:134777063-134777085 ACAGAACTAATTATTAGCAAAGG - Intergenic
1049895886 9:111788-111810 AAATAATCCATTAATAGCATCGG - Intergenic
1050375473 9:4968044-4968066 ACATAATTCACTCGTGGCCAGGG - Intergenic
1050790810 9:9466488-9466510 ACATAATTTAATTGAAGCAAAGG + Intronic
1051656571 9:19387594-19387616 AAATAATTCCTTGGAAGCAAGGG - Intergenic
1052424159 9:28282506-28282528 ACATACTTCACTAGCAGAAAGGG - Intronic
1053315275 9:37045876-37045898 AAATAGTTCATTAGTAGCATAGG + Intergenic
1053739067 9:41121971-41121993 AAATAATCCATTAATAGCATCGG - Intergenic
1054689283 9:68309351-68309373 AAATAATCCATTAATAGCATCGG + Intergenic
1055050710 9:71977396-71977418 AAATGATTCATTAGTAGTGAAGG + Intronic
1055644613 9:78350933-78350955 AAATAATGGATGAGTAGCAAGGG - Intergenic
1056404484 9:86260804-86260826 AGATTCTGCATTAGTAGCAAAGG - Intergenic
1060763933 9:126279649-126279671 ACATTTTTCAATAGTAGCATTGG + Intergenic
1062075039 9:134583246-134583268 ACAATATTCCTAAGTAGCAATGG - Intergenic
1187054626 X:15731034-15731056 ACATATTTGATTTGTAGGAATGG - Intronic
1187280448 X:17854748-17854770 AAATAATTCATTAACAGCCAGGG - Intronic
1187552589 X:20321209-20321231 ACATAATGCCTTGGCAGCAATGG - Intergenic
1188192695 X:27192130-27192152 ACATAATTCATATTTAGCATTGG - Intergenic
1189530173 X:41872263-41872285 ACATAATGCATTTGGAGTAAAGG + Intronic
1193995442 X:88361558-88361580 ACATAATTCATCAGAGACAAAGG + Intergenic
1194683187 X:96879510-96879532 ACAAAGTTCATCAGTAACAAGGG - Intronic
1195232337 X:102862131-102862153 AAATATTTCATAAGTAGCAGGGG - Intergenic
1195431286 X:104792299-104792321 ACATATCTAATTAGTAGCAAGGG + Intronic
1195998943 X:110760439-110760461 CCATAAATCATTTGCAGCAAGGG + Intronic
1198211452 X:134520188-134520210 AAATAATTCCTTAATATCAATGG - Intronic
1198480631 X:137036429-137036451 TCATAATTCAGTAGCAGCAGAGG + Intergenic
1199372139 X:147062362-147062384 TCATTATTCATTATTAACAATGG + Intergenic
1199918353 X:152369485-152369507 ACATATTTCATGAGCAGCGAAGG - Intronic
1201799840 Y:17943127-17943149 AAATTCTTCATTAGGAGCAATGG - Intergenic
1201801713 Y:17962829-17962851 AAATTCTTCATTAGGAGCAATGG + Intergenic
1202361696 Y:24117470-24117492 AAATTCTTCATTAGGAGCAATGG + Intergenic
1202363377 Y:24135626-24135648 AAATTCTTCATTAGGAGCAATGG - Intergenic
1202507403 Y:25534491-25534513 AAATTCTTCATTAGGAGCAATGG + Intergenic
1202509082 Y:25552643-25552665 AAATTCTTCATTAGGAGCAATGG - Intergenic