ID: 1004506189

View in Genome Browser
Species Human (GRCh38)
Location 6:16248779-16248801
Sequence ATGTGTTAGTATAAAAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004506182_1004506189 29 Left 1004506182 6:16248727-16248749 CCTCACCCTTTCCCTGCTCTGCT 0: 1
1: 1
2: 15
3: 124
4: 1008
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506184_1004506189 23 Left 1004506184 6:16248733-16248755 CCTTTCCCTGCTCTGCTCTGTCA 0: 1
1: 0
2: 13
3: 146
4: 807
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506183_1004506189 24 Left 1004506183 6:16248732-16248754 CCCTTTCCCTGCTCTGCTCTGTC 0: 1
1: 0
2: 17
3: 105
4: 904
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506185_1004506189 18 Left 1004506185 6:16248738-16248760 CCCTGCTCTGCTCTGTCATCAGC 0: 1
1: 0
2: 5
3: 44
4: 381
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506186_1004506189 17 Left 1004506186 6:16248739-16248761 CCTGCTCTGCTCTGTCATCAGCC 0: 1
1: 0
2: 2
3: 46
4: 339
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data
1004506187_1004506189 -4 Left 1004506187 6:16248760-16248782 CCATTGCTACTAATGAATTATGT 0: 1
1: 1
2: 3
3: 13
4: 209
Right 1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004506189 Original CRISPR ATGTGTTAGTATAAAAGTGA GGG Intronic
No off target data available for this crispr