ID: 1004511795

View in Genome Browser
Species Human (GRCh38)
Location 6:16289199-16289221
Sequence GAGGCTTTTTCCTTCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 11, 3: 31, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004511795_1004511803 25 Left 1004511795 6:16289199-16289221 CCCCACCAGAAGGAAAAAGCCTC 0: 1
1: 0
2: 11
3: 31
4: 271
Right 1004511803 6:16289247-16289269 ACACTCACAGTGAGAGTCTATGG 0: 1
1: 1
2: 8
3: 198
4: 945

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004511795 Original CRISPR GAGGCTTTTTCCTTCTGGTG GGG (reversed) Intronic
902033604 1:13440246-13440268 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
904042329 1:27592123-27592145 GAGGCTTATTACTTGTGGAGGGG - Intronic
904238718 1:29130375-29130397 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
905078857 1:35298918-35298940 GTGTCATTTTCCTTCTGCTGAGG + Intronic
905582271 1:39091166-39091188 CAGGCTTTTGCCTTGTGGTCAGG + Intronic
905743068 1:40389003-40389025 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
906229772 1:44152118-44152140 AAGGCATTTTACTTCTGATGGGG - Intergenic
906538873 1:46569610-46569632 CAGGCTTTTGCCTTCTAGTCGGG - Intronic
906671277 1:47656825-47656847 GAGGCTGTTTCTTTTTGCTGGGG + Intergenic
906799734 1:48726031-48726053 GGGCCTTGTTTCTTCTGGTGTGG - Intronic
907469452 1:54663820-54663842 GAGCCTTGTTCCTTTTAGTGGGG + Intronic
910531879 1:88246392-88246414 AATTCTTTTTCCTTCTGGTTAGG - Intergenic
912612489 1:111062421-111062443 TAGGCTTTGTGCTGCTGGTGAGG - Intergenic
913469162 1:119172559-119172581 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
913470363 1:119180241-119180263 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
914329995 1:146659226-146659248 GAGGCTTTTTCATTAATGTGAGG - Intergenic
914438262 1:147679972-147679994 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
916960441 1:169883104-169883126 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
917025151 1:170633385-170633407 GAAGATTTTTGCTTCTGGTCTGG + Intergenic
917186164 1:172358585-172358607 GTTGCTGTTTCATTCTGGTGGGG - Intronic
917952377 1:180052792-180052814 GAGGCTTTTTCTTGCTTGTAAGG + Intronic
919325277 1:196099586-196099608 GAGACTTCTTCCTTCTGCTTAGG + Intergenic
919540701 1:198841524-198841546 GAGGCTTTTTCCATGTTGTGGGG - Intergenic
919801827 1:201359024-201359046 GTGGCTTTTTATTACTGGTGTGG + Exonic
920567469 1:206986375-206986397 GTGGCTTTTTCCTTCTAGTAAGG + Intergenic
922053647 1:222019582-222019604 TGGGCTTTTTCCTTCTGCTTTGG - Intergenic
922377085 1:224979722-224979744 GTGGCTCCTTCCTTCTGTTGAGG + Intronic
923946533 1:238894367-238894389 GAGGCAGCTTCCTTCTGCTGTGG + Intergenic
924077587 1:240357084-240357106 CATGCTTTTTCCATCTAGTGGGG + Intronic
1063167176 10:3473963-3473985 GGAGATTTTTCCTTCTGGTTAGG - Intergenic
1063309156 10:4936730-4936752 GGAGTTTCTTCCTTCTGGTGGGG + Intronic
1064186740 10:13168361-13168383 CTGGCTTTTTCCTTCTGGTAAGG + Intronic
1064449035 10:15425328-15425350 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1064907377 10:20361257-20361279 AAGGCTGTTTCCTTCTGATGTGG - Intergenic
1066439345 10:35423502-35423524 GAGGCTTTTTTTTTTTGGTGGGG + Intronic
1067363356 10:45601787-45601809 GGAGTTTTTTCCTTCTGGTGGGG - Intergenic
1067937582 10:50624486-50624508 GAGGCTTTTTTTTTCTGTTGTGG - Intronic
1075818144 10:125282468-125282490 GATGGTTTTGCCTTCTGGTCAGG + Intergenic
1076622670 10:131802462-131802484 GAGGCTTTTTCCTTCAAGAAGGG - Intergenic
1076634573 10:131873970-131873992 GAGGCATTTTCCTTCTGGGGTGG - Intergenic
1077603392 11:3589788-3589810 AAAGCTTCTTCCTTCTGGTGGGG - Intergenic
1079408717 11:20166744-20166766 GATTCATTTTCCTTCTGTTGGGG - Intergenic
1079460497 11:20673980-20674002 GAGGCATTTTCATCCTGGTGGGG + Intronic
1079969859 11:27023625-27023647 CAGGCTTTTTTCTACTTGTGAGG - Intergenic
1080657151 11:34266987-34267009 AAAGCTTTTTCCTTTTTGTGGGG + Intronic
1082251999 11:49992600-49992622 GAGTCTTTCTCCCTCTGTTGTGG - Intergenic
1082912170 11:58389936-58389958 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1083510868 11:63208615-63208637 GAGGCTTGTTTCATCTGATGAGG + Intronic
1084259291 11:67964333-67964355 GAAGCTTCTTCCTTCTGGTGGGG - Intergenic
1084813482 11:71630848-71630870 GAAGCTTCTTCCTTCTGGTGGGG + Intergenic
1084889421 11:72229366-72229388 TAGCCTTTATCCTTGTGGTGAGG + Intronic
1085376056 11:76061671-76061693 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
1086209950 11:84307802-84307824 GGAGTTTCTTCCTTCTGGTGGGG + Intronic
1088742707 11:112780137-112780159 CAGGCTTCTGCCTTCTGGAGGGG + Intergenic
1089533243 11:119145435-119145457 GAGGCTCTGTCCTGATGGTGGGG + Intergenic
1090827410 11:130397507-130397529 GAGGCTTTATCCTTTTGCTGTGG - Intergenic
1091106615 11:132925800-132925822 GAGGGTTTTTTCTTGTTGTGAGG + Intronic
1091574011 12:1715458-1715480 GAGGTTTTTTCTTTCAGATGGGG - Intronic
1092430603 12:8405332-8405354 GAAGTTTCTTTCTTCTGGTGGGG - Intergenic
1094247127 12:28311373-28311395 GAGTCTTTTTCCTTTTGGATGGG + Intronic
1095123268 12:38443201-38443223 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1095968122 12:47883037-47883059 GAGGCTGTTTCCTTCTGCCTGGG - Intronic
1098135332 12:67396025-67396047 GTGGTTTTTTCCTTCTGGTGGGG + Intergenic
1098373340 12:69783495-69783517 GAGACTCCGTCCTTCTGGTGAGG + Intronic
1099690855 12:85949365-85949387 GAGGCTTTTCCCTACCGGAGAGG + Intergenic
1100222823 12:92524300-92524322 GAGGTTTTTTCATCCTGGGGTGG - Intergenic
1101857289 12:108454578-108454600 GAGGCATTCTTCTTCTGCTGAGG - Intergenic
1103270856 12:119672453-119672475 CAGGCAATTACCTTCTGGTGAGG - Exonic
1106600388 13:31182319-31182341 GGGGTTTCTTCCTTCTGGTGGGG + Intergenic
1108121619 13:47194072-47194094 TCGGCTTTTTCCTTGTTGTGAGG + Intergenic
1108435511 13:50397682-50397704 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
1108856405 13:54799260-54799282 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1110688297 13:78401338-78401360 GAGGCTATTTCTTTCTGCTGTGG + Intergenic
1110838827 13:80117444-80117466 GGGCCCTTTTCCCTCTGGTGAGG - Intergenic
1112279804 13:98052842-98052864 CAGGCATTCTCCTTCTGGAGAGG - Intergenic
1112287626 13:98118163-98118185 CAGGCATTTTCCACCTGGTGAGG + Intergenic
1113584662 13:111456958-111456980 GAAGCTTTTGCCATATGGTGAGG + Intergenic
1113702792 13:112399557-112399579 GAGGCTTTTCCCTACTTCTGGGG - Intronic
1114797582 14:25734121-25734143 AAACCTTTTTCCTTCTGCTGTGG - Intergenic
1117449971 14:55840513-55840535 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1118306473 14:64659221-64659243 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1118366655 14:65102272-65102294 GGGGCTTCTTCCTTCCCGTGCGG - Intronic
1118561080 14:67083459-67083481 GTGGCTTTTTTCTTCTGGGGAGG - Intronic
1119044966 14:71310418-71310440 GAGTCATTTTGCTTCTGGTCAGG - Intergenic
1120700677 14:87695672-87695694 TAGGCATTTTTATTCTGGTGGGG - Intergenic
1121734770 14:96210633-96210655 GAGGCCTTTTCCTTTCTGTGGGG + Intronic
1126316611 15:47376741-47376763 AAGGCATTTGCCTTCTTGTGGGG + Intronic
1127618049 15:60706848-60706870 GAGGCTTTTTCCTTTTTGGGAGG - Intronic
1127765914 15:62185899-62185921 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1128250454 15:66160207-66160229 GAGGCTTTGTCCTTTTGTTTAGG - Intronic
1128564878 15:68694629-68694651 GAGGCTCTTTCCTGCTGCTCTGG - Intronic
1131302895 15:91215107-91215129 GAGTCTTTGTCCTTGTGGTTGGG + Intronic
1132562099 16:600269-600291 GAGCCTGTGTCCTCCTGGTGGGG + Intronic
1133402207 16:5496457-5496479 GAGGCCTTTTCCATCTGCAGTGG + Intergenic
1134354201 16:13465759-13465781 GCAGCTTTTTCTTTCTGGAGAGG - Intergenic
1134624549 16:15714424-15714446 GGATCTTTTTCCTTCTGATGGGG + Intronic
1135340213 16:21638945-21638967 AAAGCTATTTCCTTTTGGTGTGG + Intronic
1138340033 16:56283009-56283031 TGGGCATTTTCCATCTGGTGGGG + Intronic
1138639777 16:58375563-58375585 AAGGCTTTATCCTGGTGGTGGGG + Intronic
1139051211 16:63126772-63126794 GAGCCTTTTTTCTTCTGTTTGGG - Intergenic
1140003559 16:71051687-71051709 GAGGCTTTTTCATTAATGTGAGG + Intronic
1203140688 16_KI270728v1_random:1763627-1763649 GAGGACTTTTCCTTCTGAGGTGG - Intergenic
1146057395 17:29588359-29588381 GAGGCTGCTCCCTTCTGATGAGG - Intronic
1147561941 17:41514621-41514643 AAGGCTTTACTCTTCTGGTGTGG - Intronic
1147744700 17:42688057-42688079 GAGGCCTTTACATTCTGGAGAGG + Intronic
1148688076 17:49511951-49511973 GAGTTTTTCTCCCTCTGGTGGGG - Exonic
1151582736 17:74989259-74989281 GAGGCTCTGTCCTTGTGCTGAGG + Intronic
1151944033 17:77309613-77309635 GAGCCTTCGTCCTTCTGGGGAGG - Intronic
1152250188 17:79208438-79208460 GAGGCACTTGCCTTCTGCTGGGG + Intronic
1152424224 17:80210307-80210329 GAGGGTTCTTCCTTCCTGTGGGG - Exonic
1152441390 17:80312343-80312365 GAGGGGTTTTCCCTCTGGTCTGG + Intronic
1154020398 18:10659802-10659824 GAGGCTCTTTCTTTGTGGTCTGG - Intergenic
1154200408 18:12296029-12296051 GAGGCTTGGTCATGCTGGTGGGG + Intergenic
1154939782 18:21100305-21100327 GAAACTCTTTCCTTTTGGTGGGG - Intronic
1157294055 18:46429351-46429373 GAGGGATTTTGCCTCTGGTGTGG - Intronic
1157489558 18:48113334-48113356 GATGGTTTTTCCTTGTGATGGGG - Intronic
1159704478 18:71669696-71669718 GAAGCATTTTCATTTTGGTGAGG + Intergenic
1160127504 18:76189793-76189815 GGGCCTTTTGCCTTGTGGTGTGG - Intergenic
1164073848 19:21794904-21794926 GCGAATTTCTCCTTCTGGTGCGG - Intergenic
1164768615 19:30790723-30790745 CAGGCATTTTCCCTTTGGTGAGG + Intergenic
1164783723 19:30913101-30913123 GAGGCTTTTTCCCTCCAGAGGGG - Intergenic
1168574483 19:57498766-57498788 GGGGCTTCTTGCTTCTAGTGAGG - Intronic
925902565 2:8518789-8518811 GGGGCTTTTTATTTTTGGTGGGG + Intergenic
926522416 2:13931641-13931663 AAGCCTTTTTTCTACTGGTGAGG - Intergenic
926564115 2:14451461-14451483 GTTGCTTTTTGCTTCTAGTGTGG + Intergenic
926899057 2:17729480-17729502 AAGGCTTCTTCCTTCTTCTGTGG - Intronic
929085260 2:38161712-38161734 GAGGCTGTTTCCTTCAGGCACGG + Intergenic
929715619 2:44306410-44306432 GAGCCTTTCTCCGTCTGGTGAGG + Intronic
930104848 2:47631725-47631747 GATGCTTGGTGCTTCTGGTGTGG + Intergenic
931449772 2:62358929-62358951 TAGGCTTTGTCCTGCTAGTGTGG + Intergenic
932109159 2:68978992-68979014 AAGGCTTTTTATTTTTGGTGAGG + Intronic
936041247 2:109151241-109151263 GAGGCTTTTTCATGTTTGTGGGG + Intronic
937898307 2:126995711-126995733 TTGGCATTTTCCATCTGGTGGGG - Intergenic
938556205 2:132426509-132426531 CAGGCATCTCCCTTCTGGTGAGG - Intronic
942917167 2:181324630-181324652 GAGAACTTTTCCTTTTGGTGTGG - Intergenic
943365440 2:186963431-186963453 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
943400165 2:187398737-187398759 GAAGCTTTTTCTTTCTGCTGGGG + Intronic
943836118 2:192516023-192516045 GAGGTTTCTACCTGCTGGTGGGG - Intergenic
946244443 2:218378747-218378769 GAGAGTTTTTCCTTCTAGAGAGG - Intergenic
946488982 2:220129582-220129604 TAGGCTTTTTCTTTCTTGTCAGG - Intergenic
948448972 2:238057317-238057339 GGAGTTTCTTCCTTCTGGTGGGG + Intronic
948958594 2:241315110-241315132 CTAGCTTTCTCCTTCTGGTGTGG - Intronic
1169244856 20:4017141-4017163 GAGGCATGTTCCTTCTGCTTTGG + Intergenic
1169783437 20:9333268-9333290 GAGGTTGTTGCATTCTGGTGTGG + Intronic
1169785991 20:9359622-9359644 GGGGCACTTTCCTTCTGGTCCGG - Intronic
1175126226 20:56753834-56753856 GAGGCTCTTTCCATCTGCAGTGG - Intergenic
1175134916 20:56815876-56815898 GAGACTTTGTCCTTCTGAGGAGG - Intergenic
1175261549 20:57677411-57677433 GAGGCGCTTTCTTGCTGGTGAGG - Intronic
1175309094 20:57999078-57999100 GAGGCTTGGTCCTGGTGGTGTGG + Intergenic
1175476792 20:59281479-59281501 GTTGCTTTTTACCTCTGGTGAGG - Intergenic
1175645220 20:60665031-60665053 GAGGTGTTTGCCTTCTGCTGAGG - Intergenic
1176315474 21:5238357-5238379 GAGGCTGTTTACTCCAGGTGAGG - Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1181890833 22:26062186-26062208 GAGACCTTTTCCATCTGGTATGG + Intergenic
1182127947 22:27829901-27829923 GAGGGATTTTCTCTCTGGTGGGG - Intergenic
1183489348 22:38108397-38108419 GAGGCTCTTTTCATCTGGAGGGG + Intronic
1184450301 22:44578586-44578608 AAGGCTTTGTTCTTCAGGTGTGG + Intergenic
1184920734 22:47603882-47603904 GCAGCTTTTTGTTTCTGGTGAGG + Intergenic
950632839 3:14294562-14294584 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
950983594 3:17335453-17335475 GGGTCTTTCTCCTTATGGTGTGG - Intronic
951405358 3:22290311-22290333 GAGGCTTTTGTCTTTGGGTGTGG - Intronic
952438703 3:33300192-33300214 ATGGTTTTTTCCTTCTGGTGGGG + Intronic
952730872 3:36635435-36635457 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
953407251 3:42665566-42665588 CACACTTGTTCCTTCTGGTGTGG - Exonic
953426701 3:42801021-42801043 GAGGTTTTTTACTACTGCTGAGG + Intronic
953981610 3:47416101-47416123 GAGTCTTTTTCCTTGGGGAGGGG - Intronic
954540222 3:51388723-51388745 GAGGCTAGTTCCCTCTTGTGGGG + Intronic
954628967 3:52038058-52038080 GAGGCTTTCCCCTTCTGCTGGGG + Intergenic
954892255 3:53941599-53941621 GATGGTTTTTCTTTTTGGTGGGG - Intergenic
956271433 3:67451654-67451676 TATACTTTTTACTTCTGGTGGGG + Intronic
956446047 3:69326877-69326899 GAGGCTGTTTCTTTCTGGAGAGG - Intronic
957074247 3:75588863-75588885 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
957504790 3:81105848-81105870 GAGGCATTTTGCTTCTCATGCGG - Intergenic
958022804 3:88016735-88016757 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
958776887 3:98496281-98496303 GAGGCTTTTTGGTTTTGGTTTGG + Intergenic
959248783 3:103912046-103912068 GAGGCTTATTATTTCTGGTTTGG - Intergenic
959323905 3:104911718-104911740 AAGACTTTTTTCTTTTGGTGTGG + Intergenic
961000785 3:123372487-123372509 GGGGCTTTTTCCCTCTGGGAAGG - Intronic
961279855 3:125757881-125757903 GAAGTTTCTTCCTTCTGGTGGGG + Intergenic
961688975 3:128654505-128654527 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
961744618 3:129056484-129056506 GAGGCTGTTTCCTTCAGCTCAGG + Intergenic
961746572 3:129067670-129067692 GGAGTTTCTTCCTTCTGGTGAGG + Intergenic
961874547 3:130011702-130011724 GAAGCTTATTCCTTCTGGTGGGG - Intergenic
963196719 3:142540023-142540045 GAGGCTTTGTGCTTCTCTTGTGG - Intronic
963416429 3:145001014-145001036 GAGGCTTATGCCCTCTGGAGTGG + Intergenic
963651656 3:147988636-147988658 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
964378701 3:156074346-156074368 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
964381262 3:156100509-156100531 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
964977920 3:162641177-162641199 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
966096353 3:176208395-176208417 GAGGCTTTTTCCTGCTGTGAAGG + Intergenic
966824569 3:183952908-183952930 GCGTTTTTTTCCTTCTGGTGAGG + Intronic
967104644 3:186245647-186245669 GAGGTCTTTTCTTTCAGGTGTGG + Intronic
967273016 3:187746138-187746160 GGGTTTTTTTCTTTCTGGTGTGG + Intergenic
968804290 4:2762484-2762506 GGAGTTTTTTCCTTCTGGTGGGG + Intergenic
969017862 4:4116463-4116485 GAAGCTTCTTCCTTCTGGTGGGG - Intergenic
969482905 4:7456343-7456365 GAGGCATTTCCCTTCTGCTGAGG + Intronic
969736135 4:8992231-8992253 GAAGCTTCTTCCTTCTGGTGGGG + Intergenic
969795338 4:9523712-9523734 GAAGCTTCTTCCTTCTGGTGGGG + Intergenic
969998420 4:11339098-11339120 GAGACATTTTCCTGCAGGTGTGG - Intergenic
970423199 4:15924046-15924068 GAGCCTTCTTCCTTCTGGATGGG + Intergenic
970437335 4:16048279-16048301 GAGCCTATTTCCTTATGCTGTGG + Intronic
970673000 4:18417601-18417623 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
970857670 4:20667438-20667460 GAGTCTTTTTCCTTGGGGTTTGG - Intergenic
971920291 4:32930591-32930613 CAGGGTTTTTCTTGCTGGTGTGG - Intergenic
973190160 4:47377409-47377431 GAAGTTTCTTCCTTCTGGTGGGG + Intronic
974128785 4:57728909-57728931 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
976248711 4:83029041-83029063 AAGCCTTTTTCCTTTTAGTGGGG - Intergenic
976565676 4:86548291-86548313 GGAGTTTCTTCCTTCTGGTGGGG - Intronic
978701200 4:111648318-111648340 GAGACTTTTTCCTTGTGGCAAGG - Intergenic
978813612 4:112878275-112878297 GAAGCTTTCTCTTTCTGTTGTGG + Intronic
983295325 4:165859696-165859718 GAGGCGTTTTCCTGGTGCTGAGG + Intergenic
984354817 4:178644321-178644343 GAGGCTTTTTCCTTGTGGAGAGG - Intergenic
985526542 5:405877-405899 GAGGCTGCGTCCTTCTGGTGTGG + Intronic
987146084 5:14993109-14993131 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
991113213 5:62925171-62925193 GAGCCTTTTTCCTTCTGGTCTGG + Intergenic
991482237 5:67093255-67093277 GAGTCTTTTTCCTTGTGGGTGGG - Intronic
991618770 5:68523556-68523578 AAGTCTTTTTCTTTCTGGTATGG - Intergenic
992097315 5:73374866-73374888 GAGGCTCTTCCGTTCTGGTTTGG - Intergenic
994251348 5:97541131-97541153 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
994769623 5:103965591-103965613 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
994841559 5:104930090-104930112 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
994935432 5:106247240-106247262 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
997404488 5:133634114-133634136 GTGCCTTCTTCCTGCTGGTGGGG + Intergenic
998545190 5:143021789-143021811 GTGGGTTTTTCCTTTTGTTGTGG - Intronic
998744024 5:145236416-145236438 GAGGCTTTTACCTTTTCATGAGG - Intergenic
999896199 5:156036500-156036522 TAGGCATTTTCCATCTGATGAGG + Intronic
1000049597 5:157550533-157550555 GATGTTTTTTCCTTTTGGAGTGG + Intronic
1000752019 5:165108579-165108601 GAGGGTTTGTCTTTCTGGTAAGG - Intergenic
1000753101 5:165121453-165121475 CAGTCTTTTTCTTTCTGGAGAGG - Intergenic
1001254745 5:170175052-170175074 GAGGCATTCTGCTTCTGGGGAGG + Intergenic
1001970252 5:175949614-175949636 GAGGCATCCTCCTTCTGCTGGGG + Intronic
1002247186 5:177894150-177894172 GAGGCATCCTCCTTCTGCTGGGG - Intergenic
1002717358 5:181235812-181235834 GAGGTCTGTTCCTTCAGGTGAGG + Intergenic
1003753446 6:9088737-9088759 GGGCCTTTTTCCGTCTGCTGGGG - Intergenic
1004511795 6:16289199-16289221 GAGGCTTTTTCCTTCTGGTGGGG - Intronic
1004705293 6:18118745-18118767 GAAGCTTTTACTTTCTGCTGGGG + Intergenic
1004738656 6:18434131-18434153 GGCGCTTTTTCCTTCTGTTTGGG + Intronic
1007789966 6:44303208-44303230 GAGGCTTTATCCTTCTCCTTTGG - Intronic
1016217359 6:141619151-141619173 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1018032492 6:159852841-159852863 GAGCCTTTGTTCTTCTGGCGGGG + Intergenic
1018754256 6:166835802-166835824 AAGGCTTTTGCCTTCAGATGAGG - Intronic
1021567723 7:22031618-22031640 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1021686597 7:23192985-23193007 GGAGTTTATTCCTTCTGGTGGGG + Intronic
1024741932 7:52363707-52363729 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1025228782 7:57185113-57185135 CAGGTTCGTTCCTTCTGGTGGGG + Intergenic
1026241935 7:68583293-68583315 TAGGCTTGTTCCATCTGGAGAGG - Intergenic
1026954954 7:74371330-74371352 GAGGCTTTTTCTTGCCTGTGCGG + Intronic
1027266133 7:76496231-76496253 GAAGCTTTGTTCTTCTAGTGGGG + Intronic
1027317510 7:76994349-76994371 GAAGCTTTGTTCTTCTAGTGGGG + Intergenic
1027852951 7:83472531-83472553 TGAGCTTTTTCATTCTGGTGAGG - Intronic
1028105550 7:86873320-86873342 AAGGCTTTTTCTTTGTGATGAGG + Intergenic
1029076299 7:97936991-97937013 GAAGCTTCTTCCTTCTGGTGGGG - Intergenic
1029408757 7:100394868-100394890 GAGGCTTTTTCCCTATGGTTTGG - Intronic
1029617256 7:101666711-101666733 GAGGTTTTTTTTTTTTGGTGGGG - Intergenic
1029988339 7:104941311-104941333 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1031409393 7:121422980-121423002 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1031891516 7:127299384-127299406 GAGGATTTTTTTTTTTGGTGGGG - Intergenic
1032088436 7:128896182-128896204 CAGCCTATTTCCTTCTGGTCGGG - Intronic
1032683810 7:134210572-134210594 GGGGCCTTTTCCCTCTGGAGAGG - Intronic
1033148419 7:138891349-138891371 GAAACTTATTCCTTCTGATGGGG - Intronic
1033771473 7:144557430-144557452 GAGGCATTTATCTTCTGGTAAGG - Intronic
1034119068 7:148610827-148610849 GACACTTTGTCCTTTTGGTGGGG - Intronic
1034248284 7:149666021-149666043 GAGGCTTTTTCCTTCAGCTTCGG - Intergenic
1034577699 7:152015311-152015333 GAAGCTATTTGCTTCAGGTGTGG - Intronic
1036046417 8:5146412-5146434 GAGGATATTTGCTTATGGTGAGG + Intergenic
1036260627 8:7236759-7236781 GAAGTTTCTTCCTTCAGGTGGGG - Intergenic
1036305986 8:7602763-7602785 GAAGTTTCTTCCTTCAGGTGGGG + Intergenic
1036312664 8:7695315-7695337 GAAGTTTCTTCCTTCAGGTGGGG - Intergenic
1036356833 8:8050748-8050770 GAAGTTTCTTCCTTCTGGTGGGG + Intergenic
1036762034 8:11515939-11515961 GAGGCTTTTGTATCCTGGTGTGG + Intronic
1036831511 8:12023708-12023730 GAAGTTTCTTCCTTCTGGTGGGG - Intergenic
1037319798 8:17631739-17631761 GAGGCTGTTCCCTGCAGGTGAGG - Intronic
1037837926 8:22225142-22225164 GAGGCCTCTTGCTCCTGGTGGGG - Intronic
1038118395 8:24583359-24583381 GAGGATTCTGCCTTCTGATGTGG - Intergenic
1039516670 8:38139535-38139557 AACGCTATTTCCTTTTGGTGTGG + Exonic
1040949227 8:52919351-52919373 TAGGCTTTTTTCCTATGGTGTGG - Intergenic
1040958608 8:53006281-53006303 GAGGCTTTCTGCTTCTGTTAGGG + Intergenic
1041478906 8:58296305-58296327 GTGGCTCTCTCCTCCTGGTGTGG - Intergenic
1042469223 8:69164103-69164125 GAGATTTTTTCCCTCTGTTGTGG + Intergenic
1044404724 8:91815172-91815194 TAGGCTTTTTCCTTCTGTATTGG + Intergenic
1044405067 8:91817579-91817601 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1044763663 8:95548853-95548875 GAGCCTTCTTCCTTTGGGTGAGG - Intergenic
1045179377 8:99763566-99763588 AAGGATTTTTCCATCTGGGGAGG + Intronic
1045518135 8:102879166-102879188 GAGCCTTCTTGCTGCTGGTGGGG - Intronic
1045599221 8:103694050-103694072 GAGACTTTTTCCATGTGGTTTGG + Intronic
1046602647 8:116335376-116335398 GAGTCTTTTTCCTGATGCTGAGG - Intergenic
1048616294 8:136079202-136079224 CAGGCTCTCTCCTTGTGGTGGGG - Intergenic
1048878095 8:138852301-138852323 GTGACTTGTTCCTTGTGGTGGGG + Intronic
1049607002 8:143534442-143534464 GAGGTTGCTTCCTGCTGGTGGGG - Intronic
1050747805 9:8897681-8897703 GAGGCTCTTTACTTCTGGCCAGG - Intronic
1055102403 9:72479493-72479515 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1055730004 9:79270758-79270780 GTGCCTTTTTCCTTAAGGTGGGG - Intergenic
1056391193 9:86143023-86143045 TTGGCATTTTCCATCTGGTGGGG - Intergenic
1057019115 9:91681935-91681957 GAGGCTGTTTCCTGCCTGTGGGG - Intronic
1058286725 9:103187957-103187979 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1058898582 9:109421461-109421483 GAGCCTTTTTACTTCTGCTTTGG - Intronic
1059790999 9:117642029-117642051 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1059954022 9:119497113-119497135 GAGGCTGTTTCCATCGGCTGAGG - Intronic
1186295511 X:8144432-8144454 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1189896688 X:45664047-45664069 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1193040032 X:76995762-76995784 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1193336823 X:80299388-80299410 TAGGCTTTTTCAACCTGGTGTGG + Intergenic
1193585879 X:83320306-83320328 GAGGCTTTTCCCATATGGTGTGG - Intergenic
1193951608 X:87807949-87807971 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1195006148 X:100687736-100687758 GTGCCTTTTCACTTCTGGTGGGG - Intronic
1195111573 X:101656243-101656265 AAGGCTTTTTCCTTAATGTGTGG + Exonic
1197376645 X:125689885-125689907 GGAGTTTCTTCCTTCTGGTGGGG + Intergenic
1197525320 X:127554697-127554719 GAGGCAGTTTCCTTCAGCTGAGG + Intergenic
1199113864 X:143966521-143966543 GAAGCTTTCTCCTTGTGGTGAGG + Intergenic
1199146020 X:144368117-144368139 GAGGCTTTTCCCTGCTCTTGGGG - Intergenic
1199628287 X:149759804-149759826 GGAGTTTCTTCCTTCTGGTGGGG - Intergenic
1202362664 Y:24128103-24128125 GTTGCTTTCTCCTGCTGGTGTGG + Intergenic
1202508370 Y:25545120-25545142 GTTGCTTTCTCCTGCTGGTGTGG + Intergenic