ID: 1004512448

View in Genome Browser
Species Human (GRCh38)
Location 6:16294074-16294096
Sequence CTTTGTGAAGAGAGGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004512440_1004512448 10 Left 1004512440 6:16294041-16294063 CCCAAGTAACAATCAAGCAGTGT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1004512448 6:16294074-16294096 CTTTGTGAAGAGAGGGACATGGG No data
1004512441_1004512448 9 Left 1004512441 6:16294042-16294064 CCAAGTAACAATCAAGCAGTGTT 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1004512448 6:16294074-16294096 CTTTGTGAAGAGAGGGACATGGG No data
1004512439_1004512448 19 Left 1004512439 6:16294032-16294054 CCTGTGTTACCCAAGTAACAATC 0: 1
1: 0
2: 2
3: 13
4: 82
Right 1004512448 6:16294074-16294096 CTTTGTGAAGAGAGGGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004512448 Original CRISPR CTTTGTGAAGAGAGGGACAT GGG Intronic
No off target data available for this crispr