ID: 1004512589

View in Genome Browser
Species Human (GRCh38)
Location 6:16294913-16294935
Sequence CTACAGAAAGTGCTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004512589 Original CRISPR CTACAGAAAGTGCTGGAGCT GGG Intronic
900561558 1:3309610-3309632 CTGGAGAAGGTGCTGGAGCGGGG + Intronic
900714915 1:4138056-4138078 CTCCAGAAAGTGCTGGTGGAAGG - Intergenic
901423753 1:9168003-9168025 CTAGAGACAGGGCTGGAGCTGGG + Intergenic
902570894 1:17346501-17346523 CCATGGAAAGTGCTGGAGCTGGG - Intronic
902935520 1:19762076-19762098 GGTCAGAGAGTGCTGGAGCTTGG + Intronic
902968930 1:20032675-20032697 GTACAGAAGGTCCTGGAACTTGG + Intronic
903542472 1:24104802-24104824 CTTCCCAAAGTGCTGGAGGTGGG + Intronic
904464666 1:30700725-30700747 CCACAGACAGTTCTTGAGCTGGG + Intergenic
904882846 1:33713855-33713877 GCTTAGAAAGTGCTGGAGCTAGG - Intronic
904963636 1:34354778-34354800 CCACAGGGAGCGCTGGAGCTGGG - Intergenic
905504731 1:38468511-38468533 CTAAAGAAGGTGCTGGGGCCAGG - Intergenic
906251352 1:44313164-44313186 CTGCAGCAAGTGCTGGAGGTAGG - Exonic
906345524 1:45012178-45012200 CTACAGAAAGGGGCGGAGCCTGG + Exonic
907676248 1:56520438-56520460 CTGCAGGAAGTTCTGGAGTTGGG - Intronic
907678128 1:56537588-56537610 CCAGAGGAAGTGCTGGATCTGGG - Intronic
908654884 1:66378037-66378059 GTACAGGTAATGCTGGAGCTGGG - Intergenic
910075718 1:83276195-83276217 CCACAGAAACTGGTGGGGCTGGG - Intergenic
910972547 1:92870875-92870897 CTACAGGGAATTCTGGAGCTGGG - Intronic
911349784 1:96739405-96739427 CTCCAAAAAGTTCTGGAGATGGG - Intronic
911476564 1:98380632-98380654 TTATAGTAAGTGCTAGAGCTGGG - Intergenic
913209776 1:116572452-116572474 CCACAGAAAGTTTTTGAGCTGGG + Intergenic
913363945 1:118014853-118014875 GTTCAGAAAGTGCTGAAGCCAGG - Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915929987 1:160054347-160054369 CTACTGGGATTGCTGGAGCTGGG - Intronic
916825210 1:168436065-168436087 CTACAGGAAGCCCGGGAGCTGGG - Intergenic
916856766 1:168758025-168758047 CTTCAGAGAGTTCTGGACCTGGG - Intergenic
917491522 1:175502498-175502520 CTACAGGAAGCTCTGGAACTAGG - Intronic
918093375 1:181316055-181316077 CCTCAGAATCTGCTGGAGCTCGG - Intergenic
918526403 1:185469381-185469403 CAACAGCAAGTGATTGAGCTGGG - Intergenic
918542847 1:185650150-185650172 TTACAGAAAGAACAGGAGCTTGG + Intergenic
918628344 1:186684432-186684454 CTAAAGAGAGGGCTGGAGTTGGG - Intergenic
923533196 1:234827889-234827911 CCACAGAATATGCTGGAACTAGG - Intergenic
924009706 1:239651607-239651629 CCTCAGAAAGTGCTGGAGGTAGG - Intronic
1063494172 10:6491418-6491440 CGGCAGAAGGTGATGGAGCTAGG + Intronic
1065782553 10:29183628-29183650 CAACAGGAAGTGCTGGACCTTGG + Intergenic
1065822922 10:29542962-29542984 CCAGAGACAGAGCTGGAGCTTGG - Intronic
1066466698 10:35657663-35657685 GTACAGAAAGTGCGAGAGCCTGG - Intergenic
1067093517 10:43283867-43283889 CGACAGTGAGTGGTGGAGCTGGG + Intergenic
1067222594 10:44354786-44354808 TTACACACAGTGCTGGAACTGGG + Intergenic
1068879660 10:62035149-62035171 CTAGGGAAGGTGCTGGAGATAGG + Intronic
1069057678 10:63861900-63861922 CTAGAGAGAGGGCTGGAGGTTGG + Intergenic
1070723664 10:78773601-78773623 CTCCAGGAAGAGCTGGAGCTTGG - Intergenic
1070971049 10:80567566-80567588 CTATATACAGTGCTGGAGCAGGG + Intronic
1072608154 10:97000586-97000608 CTACAGAATCTGCTGGTGGTAGG - Exonic
1073500369 10:103931673-103931695 CCACAGAAAGTTCTAGAGCTGGG - Intergenic
1074449486 10:113547630-113547652 CCACAGAAAGTTCTGGATCTAGG - Intergenic
1075063275 10:119271776-119271798 CTAATCAAAGTGCTGGAGCTGGG - Intronic
1075686483 10:124368191-124368213 CTACACAAAGCCCCGGAGCTGGG + Intergenic
1077454420 11:2669914-2669936 CTCCAGACTGTCCTGGAGCTTGG - Intronic
1079142986 11:17825739-17825761 ATACAGAAAGCTCTGAAGCTTGG + Intronic
1082894174 11:58172603-58172625 CTCCAGAAAGTGATGGAGCCAGG + Intronic
1084302427 11:68260272-68260294 CTATAGAGTGTTCTGGAGCTCGG - Intergenic
1084993113 11:72947624-72947646 CAACAGAATGTGCTGGAGGATGG - Intronic
1088102186 11:106167752-106167774 CTACAGAAAGAACAGGGGCTTGG + Intergenic
1089294670 11:117460466-117460488 AGGCAGAAAGTGCAGGAGCTGGG + Intronic
1089363734 11:117908556-117908578 CTGCAGAGGGTGCTGGGGCTGGG + Intronic
1089363845 11:117909159-117909181 CTGCAGAAGGTGCTGGGACTAGG + Intronic
1090402299 11:126456619-126456641 CTTCAGACAGTCCTGGAGGTGGG + Intronic
1092236282 12:6812064-6812086 CTCCCGTAAGTGGTGGAGCTAGG - Intronic
1094292394 12:28866637-28866659 CTACTGAAAGAGCTGGGTCTGGG - Intergenic
1095398809 12:41791357-41791379 CAACAGCAAGTGTTGGAGCTAGG + Intergenic
1096199481 12:49671474-49671496 CTTCTGAGAATGCTGGAGCTTGG - Intronic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097677676 12:62620517-62620539 TTACAGACAGTGATGGGGCTAGG - Intergenic
1098141690 12:67456641-67456663 CTTCAGAAACTGCTGGAGGGTGG - Intergenic
1098598606 12:72302587-72302609 CCATTGTAAGTGCTGGAGCTGGG + Intronic
1099948549 12:89273691-89273713 ATCCAGTAAGTGGTGGAGCTAGG + Intergenic
1100616435 12:96235074-96235096 CTATGGAAAGTACTGGAGCGTGG + Intronic
1101030354 12:100652052-100652074 CAACAGTAAGTGGTGGAGCCTGG + Intergenic
1101923873 12:108955351-108955373 CTGCAGGAATTCCTGGAGCTGGG + Intronic
1102243845 12:111342520-111342542 CAGCTGAAAGTGATGGAGCTGGG - Intronic
1102575880 12:113855908-113855930 CTCCAGACAGACCTGGAGCTGGG + Intronic
1102878412 12:116465787-116465809 GTATAGAAAATGCTGAAGCTAGG - Intergenic
1106598963 13:31171050-31171072 CTCCAGAAAATTCTGGAACTGGG + Intergenic
1110444273 13:75560086-75560108 CAACAGAAAATGCTGGATATAGG - Intronic
1110603880 13:77408909-77408931 ATTTAGCAAGTGCTGGAGCTGGG + Intergenic
1110740217 13:78986482-78986504 CTAGAGAAAGTGCATGAGATTGG + Intergenic
1113423528 13:110188569-110188591 AGCCAGAAAGTGCTGGAACTGGG + Intronic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1119461481 14:74808167-74808189 AGACAGAAAGTGCTGGGACTGGG - Intronic
1121636530 14:95457461-95457483 CTAGAGAAAGGGCTAGAGGTTGG - Intronic
1122069189 14:99194708-99194730 CTACAGGAAGTGAAGGAGCTGGG + Intronic
1122823733 14:104359722-104359744 CCACAGCAGGTGCTGGAGCCGGG - Intergenic
1123817953 15:23998791-23998813 CTACAGCAAGTCCTCGAGCCAGG + Intergenic
1127008240 15:54594633-54594655 CTACAGTTTGTGCGGGAGCTGGG - Intronic
1127590772 15:60420424-60420446 CTAGAGAATGCGATGGAGCTGGG - Exonic
1128891004 15:71331721-71331743 CCACAAAAAGTCCTGGAGATGGG - Intronic
1129175765 15:73838808-73838830 CTTCAGAAAGGGCTAGAGCCAGG + Intergenic
1130672231 15:85922860-85922882 AGAAAGAAAGTGATGGAGCTGGG + Intergenic
1130685420 15:86032815-86032837 CCACAGAGAGCTCTGGAGCTGGG - Intergenic
1130801779 15:87272311-87272333 CTACAGAAAGTCCTAAAGCTAGG + Intergenic
1130909956 15:88264119-88264141 AGCTAGAAAGTGCTGGAGCTGGG - Intergenic
1132029283 15:98427266-98427288 CAACAGAACGTGCTGGGGCCGGG - Intergenic
1134113336 16:11530016-11530038 CTAGAGAAAATGCTTGAGCTGGG - Intergenic
1134338579 16:13324331-13324353 CTACAGAAACTCCCAGAGCTAGG - Intergenic
1134413393 16:14022257-14022279 TTACAGTAAGTGTTGGAGCCAGG - Intergenic
1135054866 16:19223039-19223061 CTACAGAATGAAGTGGAGCTGGG + Exonic
1135393581 16:22114110-22114132 CTAGAGAAGGTGCTAGACCTGGG + Intronic
1135983251 16:27165129-27165151 CTTAAGAAAGGCCTGGAGCTGGG - Intergenic
1137299739 16:47137344-47137366 ATGCAGAAGCTGCTGGAGCTGGG + Intronic
1137785060 16:51131734-51131756 CTTCAGAAAGCACTGGAGCCAGG + Intergenic
1138332028 16:56222985-56223007 ACCCAGAAGGTGCTGGAGCTGGG - Intronic
1138814950 16:60193425-60193447 GTACAGAAAGGGAAGGAGCTTGG - Intergenic
1141273804 16:82566241-82566263 AGACTGAAAGTGCTGGAGATAGG + Intergenic
1141340441 16:83199109-83199131 AGTCAGAAGGTGCTGGAGCTGGG + Intronic
1141556189 16:84838249-84838271 AGACAGGAAGTGGTGGAGCTGGG - Intronic
1141949427 16:87331131-87331153 CTACATAAAGTGCTGGGGGGTGG + Exonic
1142224371 16:88870461-88870483 CCTCAGACAGTGCTGGGGCTGGG - Intergenic
1142872416 17:2829392-2829414 CTCCATAAAGGGCTGGGGCTGGG + Intronic
1143141203 17:4742742-4742764 CTGCAGTTAGTGGTGGAGCTGGG - Intronic
1143688424 17:8538804-8538826 ATTCAGAAAGTATTGGAGCTGGG - Intronic
1144811879 17:18005756-18005778 TTACACAGAGTGCTGGAGCTGGG + Intronic
1147566611 17:41540346-41540368 CTATATAAACTGCTGGAGGTAGG - Intergenic
1147873098 17:43601612-43601634 CTACAGAAAGCGTTGGAGAAAGG + Intergenic
1147992843 17:44345587-44345609 CTACCGACAGGGGTGGAGCTGGG - Intronic
1148194200 17:45701556-45701578 CTACCGGGAGTTCTGGAGCTAGG - Intergenic
1149295967 17:55263296-55263318 CTAGAGAAGGTGCCTGAGCTGGG - Intergenic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1153471781 18:5454318-5454340 CCTTAGAAAGGGCTGGAGCTGGG + Intronic
1153660278 18:7319917-7319939 CTACAGACAGCGATGGAGCTTGG - Intergenic
1155350137 18:24898100-24898122 CAAGAGTGAGTGCTGGAGCTGGG + Intergenic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1155952316 18:31927017-31927039 CTACAGAAATTGGTGGGGCAAGG + Intronic
1155965584 18:32032505-32032527 AAATAGAAAGTGCTTGAGCTTGG - Intronic
1156899251 18:42281735-42281757 ATACAGAAAGAGGTGGAGGTGGG - Intergenic
1157117922 18:44879845-44879867 GTTCAGAAAGTGCTGTAGGTGGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159514692 18:69443370-69443392 TTGCCGGAAGTGCTGGAGCTGGG - Intronic
1160371578 18:78376591-78376613 CTGCTGAAAGCGCTGGAGCCAGG - Intergenic
1162164598 19:8743714-8743736 CGCCAGAAAGTGGAGGAGCTGGG - Intergenic
1162165670 19:8751182-8751204 CGCCAGAAAGTGGAGGAGCTGGG - Intergenic
1162166735 19:8758638-8758660 CGCCAGAAAGTGGAGGAGCTGGG - Intergenic
1162167801 19:8766094-8766116 CGCCAGAAAGTGGAGGAGCTGGG - Intergenic
1162168740 19:8772392-8772414 CGCCAGAAAGTGGAGGAGCTGGG - Intergenic
1162170486 19:8785156-8785178 CGCCAGAAAGTGGAGGAGCTGGG - Intergenic
1162779721 19:13000724-13000746 ACACAGAAAGTTCTGGAGCTTGG - Intronic
1165182036 19:33979681-33979703 CTTCAGAAAGGACTGGAGCCAGG - Intergenic
1165419223 19:35714841-35714863 ATACACAAAGTTCAGGAGCTGGG - Exonic
1167853394 19:52219139-52219161 ACACAGCAAGGGCTGGAGCTGGG + Intronic
926128346 2:10285512-10285534 CTTCAGAGAGTTCTGGAGCCTGG + Intergenic
926806423 2:16715992-16716014 CCACGGGCAGTGCTGGAGCTGGG + Intergenic
927205095 2:20603960-20603982 GTCTAGAGAGTGCTGGAGCTCGG + Intronic
927768138 2:25832664-25832686 GTACAGAAAGTGCTGTTGCTGGG - Intronic
929079194 2:38105875-38105897 CTACAGGGTGTTCTGGAGCTGGG + Intronic
931221424 2:60291634-60291656 CTACAGAATGTCCTGGGCCTGGG - Intergenic
932812806 2:74838302-74838324 CTGCAGGAAGTGGAGGAGCTGGG + Intronic
933840475 2:86282336-86282358 CTACAGAAAGTGCTGCTGTGGGG + Intronic
935536510 2:104300662-104300684 AGACAGTAAGTACTGGAGCTGGG - Intergenic
935589900 2:104836541-104836563 CCACATAAGGAGCTGGAGCTGGG + Intergenic
939700480 2:145385385-145385407 CTACAGAAAGCTCTGGAGCTTGG + Intergenic
939915218 2:148032616-148032638 CTACACAAAGTTCTGCAGTTTGG - Intronic
941003966 2:160228261-160228283 GTACAGAGAGTTCAGGAGCTGGG + Intronic
944542710 2:200768710-200768732 ATGCAGACAGTCCTGGAGCTTGG + Intergenic
946013827 2:216588153-216588175 CCACAGACAGGGCTGGAGTTGGG + Intergenic
947000137 2:225445048-225445070 CCACAGAAAGTGCTGTAGTTTGG + Intronic
947309785 2:228788800-228788822 CTACAGTCAGTGGTGGAGGTGGG + Intergenic
948315196 2:237023163-237023185 CAATAGGAAGTGCTGAAGCTTGG - Intergenic
948670863 2:239567859-239567881 CTCCAGAAAGTGCTTGTGCCTGG + Intergenic
949001269 2:241615547-241615569 CTGCAGTAGGTGCTGCAGCTTGG - Intronic
1168999112 20:2154129-2154151 CCACAGAAAAAGCTAGAGCTTGG + Intronic
1169554607 20:6736044-6736066 ATAGAGAAAGTGTTGGAGCATGG - Intergenic
1170377057 20:15711582-15711604 CTGCAGCAGGTGCTGCAGCTTGG + Intronic
1171024747 20:21619706-21619728 CTACAGAAAGAGCTGAGGATAGG - Intergenic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1173096712 20:40038501-40038523 GCAGAAAAAGTGCTGGAGCTGGG - Intergenic
1174502361 20:50995019-50995041 CTTCAGGAACTGCTGGATCTAGG + Intergenic
1174518044 20:51108433-51108455 CAACAGTAAGTGCCAGAGCTGGG - Intergenic
1175547603 20:59788647-59788669 CATCAGAAAGAGCTGGAGCCAGG - Intronic
1175734193 20:61373924-61373946 CTTCAGAAAGTGATGGGGATGGG + Intronic
1177084301 21:16682719-16682741 TAACAGAAAATGCTGGAGCATGG + Intergenic
1177653876 21:23991782-23991804 ATACAGAAAATGCTGTAGATTGG + Intergenic
1179014618 21:37585180-37585202 CTTCAGGAAGTTCTGAAGCTGGG - Intergenic
1181423883 22:22820400-22820422 CTACAGAGAGCTGTGGAGCTGGG - Intronic
1181615347 22:24050387-24050409 ATACAGAAAGGGCAGGGGCTTGG - Intronic
1182130434 22:27846261-27846283 CTACTAAAAGTGGTGGAGCCAGG - Intergenic
1183548977 22:38470074-38470096 CCTCCGAAAGTGCTGGTGCTGGG + Intronic
1184258731 22:43302329-43302351 CTAAAGAAGCTGCTTGAGCTGGG + Intronic
1184270778 22:43381672-43381694 CCGCAGAGAGTGCTGGAGCTGGG + Intergenic
1184596228 22:45515857-45515879 AGCAAGAAAGTGCTGGAGCTGGG + Intronic
1185060600 22:48604523-48604545 CTACAGGGAGTGCTCAAGCTTGG + Intronic
949211979 3:1513899-1513921 CTACAGAAAGAACAGGAGATTGG - Intergenic
949875558 3:8624102-8624124 CTACAGAAAGTCCGGGCACTGGG + Intronic
949953505 3:9248688-9248710 CTGCAGATAGCGCTGGGGCTGGG - Intronic
950338935 3:12224489-12224511 CCACAGAAAGTTCTGGAGCTGGG - Intergenic
950724966 3:14911294-14911316 GTAGAGAAAGTGCTGGACTTGGG - Intronic
950841754 3:15974698-15974720 CTACAGGAGCTGCTGCAGCTGGG + Intergenic
950866987 3:16197200-16197222 GTACGGAAAGTGGAGGAGCTGGG + Intronic
951988050 3:28642919-28642941 CCATAGTAAGTGATGGAGCTAGG + Intergenic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
953670548 3:44958719-44958741 GTGAAGACAGTGCTGGAGCTAGG - Intronic
954657304 3:52203071-52203093 CTGCAGTAAGTGCTGGTCCTAGG + Intronic
954980622 3:54742121-54742143 CTTCAAATAGTGCTGGGGCTGGG + Intronic
955701495 3:61686278-61686300 TGACAGATAGAGCTGGAGCTAGG + Intronic
956114849 3:65907927-65907949 CCACAGAGAGTGATGGAGCCGGG - Intronic
956596833 3:70976438-70976460 CTACAAACAGTGCTAGTGCTTGG + Intronic
956623996 3:71248998-71249020 ATTCAGAAAGTGCTGGGGCTGGG - Intronic
958856763 3:99394749-99394771 CTCCAGGAAGCTCTGGAGCTGGG + Intergenic
959060672 3:101613482-101613504 CAAAACAAAGTGTTGGAGCTGGG - Intergenic
961429776 3:126873199-126873221 ATAGTGATAGTGCTGGAGCTGGG + Intronic
961449602 3:126996570-126996592 GTCCTGAAAGAGCTGGAGCTGGG + Intronic
963298417 3:143573033-143573055 CAACAGTAAGTGATGGAGCTGGG - Intronic
964020716 3:152007058-152007080 CAATAGAAAGTGCTCGAGATGGG + Intergenic
964371784 3:156007980-156008002 AAACAGAAAGTCCTGGTGCTGGG + Intergenic
965034609 3:163422796-163422818 CTAAGGAAAGTGCTGCTGCTGGG + Intergenic
965752014 3:171985137-171985159 CTACAGAGAGTTCTGGAGCTGGG - Intergenic
965771170 3:172182398-172182420 CAACAGAACTTCCTGGAGCTGGG + Intronic
966840669 3:184084350-184084372 CCACAGGAAGGGCTGGAGCAGGG - Intergenic
967039222 3:185674123-185674145 CAACAGAAAGTGCTGCAGTGAGG + Intronic
972734710 4:41829433-41829455 CTACAGGGAATTCTGGAGCTGGG - Intergenic
973652238 4:53007554-53007576 CTATAATAAGTGCTTGAGCTAGG - Intronic
974921460 4:68245693-68245715 CTACATCCAGTGTTGGAGCTTGG + Exonic
975293587 4:72706320-72706342 ATACAGAATCTGCTGGAGTTCGG - Intergenic
975761459 4:77624489-77624511 CTGCAGGAAGTTCTGAAGCTGGG - Intergenic
976816479 4:89153568-89153590 CTACAGAAAGAGCAGGGGTTAGG - Intergenic
978074394 4:104511106-104511128 CTACAGGAAGTTCTAGAGTTTGG - Intergenic
978595135 4:110369205-110369227 CTACAGAAAGAACTCTAGCTAGG + Intronic
980871136 4:138612519-138612541 CTACCTAAACTGCTTGAGCTGGG - Intergenic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
981401828 4:144322265-144322287 CTGAAGCAAGTGCTTGAGCTGGG - Intergenic
981845248 4:149160454-149160476 ACACAGAAACTGGTGGAGCTAGG - Intergenic
983393407 4:167162653-167162675 TTACTGAAAGTGCTGCAGCTGGG + Intronic
983909862 4:173225911-173225933 CCACAGAGAGCTCTGGAGCTAGG + Intronic
985838539 5:2288765-2288787 CTGCAGAAATTCCTAGAGCTTGG - Intergenic
986859292 5:11906463-11906485 CTACAGATACTGTTGGGGCTGGG + Intergenic
987961217 5:24811641-24811663 CCAGACAAAGTGCTGGACCTTGG - Intergenic
990820631 5:59835948-59835970 CAACACAAAGTGATGGAGGTAGG - Intronic
991391131 5:66144533-66144555 CCGGAGTAAGTGCTGGAGCTCGG + Exonic
993085387 5:83357506-83357528 ATACAGAAGGTACTGGGGCTGGG + Intergenic
993372066 5:87105090-87105112 CTACATACTGTGCTAGAGCTGGG + Intergenic
994515877 5:100772527-100772549 ATGCAGAAACTGGTGGAGCTAGG - Intergenic
994525710 5:100902984-100903006 CAAGAGAAGGTGCGGGAGCTGGG - Exonic
994681982 5:102899659-102899681 CACCAAAAAGTGCAGGAGCTGGG - Intronic
995437176 5:112149811-112149833 CCAAAGCAAGTTCTGGAGCTGGG + Intronic
995479793 5:112582536-112582558 CTACAGAAAGGGCTGAAGTTAGG + Intergenic
996212308 5:120826423-120826445 TTACAGAAAGTTTTGGAACTTGG - Intergenic
996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG + Intergenic
998798461 5:145843610-145843632 CTATAGAAATCCCTGGAGCTGGG + Intergenic
999300544 5:150487421-150487443 AGATAGAAAGTGGTGGAGCTTGG + Intronic
1000461687 5:161529460-161529482 AGCTAGAAAGTGCTGGAGCTGGG - Intronic
1000598224 5:163240851-163240873 CTACAGAATATTCTGTAGCTGGG - Intergenic
1001116725 5:168946588-168946610 CTGCAGAAGATGCTGGAGCCAGG - Intronic
1001447693 5:171798547-171798569 ACACAGTAAGTGCTGGAGCCAGG + Intergenic
1001956924 5:175854062-175854084 AGCCAGAAAGTGCTGGGGCTGGG + Intronic
1002440089 5:179259750-179259772 TGTCAGAAAGTGCTGGTGCTTGG + Intronic
1002783754 6:385793-385815 CTGCAGAAAGCTCTGGAGCTAGG - Intergenic
1004512589 6:16294913-16294935 CTACAGAAAGTGCTGGAGCTGGG + Intronic
1004820849 6:19366413-19366435 CCACAGAAAGTTGTGGAGATTGG - Intergenic
1005463659 6:26091544-26091566 CTGCAGCAGTTGCTGGAGCTGGG + Exonic
1005885307 6:30092870-30092892 TTACAGAACGGGCTGGACCTGGG + Intergenic
1006810707 6:36818687-36818709 CTCCAGAAAGGGCTGGAGCCAGG + Intronic
1006941837 6:37756736-37756758 GTCCTGTAAGTGCTGGAGCTGGG - Intergenic
1009541766 6:64968959-64968981 CCACAGAAAGTGCTTGAGCTGGG - Intronic
1011314590 6:86017407-86017429 CCAGAGAAAGTGGTGAAGCTGGG - Intergenic
1013040605 6:106429676-106429698 CCACAGGAAGTTGTGGAGCTGGG - Intergenic
1014550549 6:122785416-122785438 CTTCCCAAAGTGCTGGTGCTGGG - Intergenic
1014745765 6:125198569-125198591 AGACAGAAAGTGGTTGAGCTGGG - Intronic
1014791276 6:125675197-125675219 CTATGGGGAGTGCTGGAGCTGGG - Intergenic
1015782205 6:136880452-136880474 GTACAGAGAGGGCAGGAGCTAGG - Intronic
1017121547 6:151028701-151028723 ATACAGAGAGTTCTGGAGGTTGG + Intronic
1017526503 6:155245710-155245732 GTACAGAAGGTTCTGGAGCGAGG + Exonic
1018513062 6:164547205-164547227 CTCAATAAAGTGCTGGAGATAGG - Intergenic
1018637995 6:165881693-165881715 CTAAAGAAATTGCTTGGGCTGGG - Intronic
1018742797 6:166743515-166743537 CAGCAGAAAGTGCTGGTCCTTGG + Intronic
1019053884 6:169206030-169206052 CAGCAGAAGGGGCTGGAGCTGGG - Intergenic
1022274784 7:28844404-28844426 CAGCAGAAAGTCCTGCAGCTGGG - Intergenic
1022643937 7:32213487-32213509 CTACAAAAAGTGCTGTCGCCCGG + Intronic
1022685618 7:32593614-32593636 ATAAAGAAAGTGATGGGGCTGGG + Intergenic
1024119691 7:46224183-46224205 CTGCAGAAAATGTTGGAGTTGGG - Intergenic
1024924476 7:54598760-54598782 CTGCAGAGAGGGCTGGAGCCTGG - Intergenic
1025030457 7:55552598-55552620 CAAAAGAAAGTGCTGGAACCAGG + Intronic
1027293431 7:76741069-76741091 CCACAGAAACTGGTGGGGCTGGG - Intergenic
1028364491 7:90011678-90011700 ATACAGTAAATGATGGAGCTGGG + Intergenic
1031478296 7:122248860-122248882 CTACAGGGAGCTCTGGAGCTGGG + Intergenic
1032978190 7:137249981-137250003 CTGCAGAAGGTGATGGAGATTGG - Intronic
1034433908 7:151054084-151054106 CTTCAGAAGGTTCTGGAGATGGG + Exonic
1034577546 7:152014012-152014034 CTACAGGAATTGCTGGATGTAGG - Intronic
1035901526 8:3462285-3462307 CTACAGGGAGGTCTGGAGCTAGG - Intronic
1035992889 8:4511621-4511643 CTACAGAAAGTGATGGTACCAGG + Intronic
1037386467 8:18347818-18347840 CTCCAGAAAGTGCAGGAGAGAGG + Intergenic
1038270038 8:26067636-26067658 CTTCAAGGAGTGCTGGAGCTGGG + Intergenic
1040887564 8:52282549-52282571 CTACATACAGTGATGGAGGTTGG - Intronic
1043159685 8:76830076-76830098 CCATAGCAAGTGATGGAGCTGGG - Intronic
1043655371 8:82658498-82658520 CTACAGGAAGTGCTGATGTTAGG - Intergenic
1044256837 8:90073450-90073472 CTACAGTGAGTTCTGAAGCTGGG - Intronic
1045812290 8:106236618-106236640 CTCCAAAAAGTGCTGAAGTTAGG + Intergenic
1045949549 8:107836191-107836213 AAACAAAAAGTGCTGCAGCTAGG + Intergenic
1046662703 8:116965637-116965659 ATTCAGAAGATGCTGGAGCTTGG - Intronic
1047335972 8:123936733-123936755 CTTCAGAAAGTTTTGAAGCTGGG - Intronic
1047891945 8:129322334-129322356 CTGCAGAAACTGCAGGAACTAGG + Intergenic
1052431460 9:28371928-28371950 AAGCAGAAAGTGCTGGAGCAAGG + Intronic
1053198582 9:36137613-36137635 CTACAGGAAGGGCTGCAGCGAGG - Intronic
1055668071 9:78572010-78572032 ACACAGAAAGTGATGGAGCTGGG + Intergenic
1057064819 9:92038742-92038764 CAGCAGGCAGTGCTGGAGCTGGG - Intronic
1057254023 9:93528786-93528808 CTACAGAGAATGCTTGAGTTTGG + Intronic
1058835274 9:108854676-108854698 CTACAGCAAGTGCTGAGCCTCGG - Exonic
1061314836 9:129788441-129788463 AAAAAGAAAGTGCTGGAGCCAGG - Intergenic
1061411223 9:130422786-130422808 CTCCAGAACATGCTGGACCTAGG + Intronic
1186532959 X:10316000-10316022 TTACACAAAGTTCTGAAGCTTGG + Intergenic
1189972070 X:46428065-46428087 CTACAGAGAGCTCTGGAGCTGGG - Intergenic
1190426911 X:50342051-50342073 ATACAGAAACTGCTTCAGCTAGG - Intronic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1192001510 X:67156824-67156846 CTCTAGGAAGTGATGGAGCTAGG - Intergenic
1192005466 X:67207336-67207358 CTAAAGAAAGTGATGGAGAGGGG - Intergenic
1195475340 X:105278752-105278774 CCATAGTAAGTGATGGAGCTAGG + Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1198147526 X:133872463-133872485 CAACAAACAGTGCTGGAGCTTGG + Intronic