ID: 1004513507

View in Genome Browser
Species Human (GRCh38)
Location 6:16302395-16302417
Sequence TAACTCACCCAGTTTAGTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004513507 Original CRISPR TAACTCACCCAGTTTAGTTT GGG (reversed) Exonic
906570356 1:46832675-46832697 TAACTCCCCCACTTTAGGTGTGG - Intergenic
906984485 1:50668536-50668558 TTACACACCTAGTTAAGTTTAGG + Intronic
915882851 1:159690984-159691006 TAACTTACTTAGTTTAGGTTTGG - Intergenic
917021672 1:170594987-170595009 TAACTCACCAAGTTCATTATAGG - Intergenic
917407568 1:174723487-174723509 TTATTCTCCCAGTTTAGATTAGG - Intronic
921985363 1:221306431-221306453 TAATTCAAACAGTTTATTTTCGG + Intergenic
924201834 1:241668413-241668435 TTTCTCACCCAGTTTAGAATTGG - Intronic
1077953124 11:6983734-6983756 TATTTCTCCCAGTTTATTTTTGG - Intronic
1079680193 11:23286645-23286667 TTACAAAGCCAGTTTAGTTTTGG - Intergenic
1086460084 11:86997361-86997383 AAGCTCTCCCAGTTTTGTTTGGG - Intergenic
1090303743 11:125672240-125672262 CAATGCACCCAGTTTAGTGTCGG + Exonic
1090347956 11:126086159-126086181 TAACCCATCCATTTTAGTTTGGG + Intergenic
1094253654 12:28396517-28396539 TTACCCACACACTTTAGTTTGGG - Intronic
1097275589 12:57811270-57811292 TCACTCACCCAGTCTACTTGTGG - Intronic
1098081256 12:66787826-66787848 TAACTCATACAGTTTGCTTTTGG - Intronic
1099044585 12:77699972-77699994 TGACCCAGCCAGTTTTGTTTTGG + Intergenic
1101031612 12:100666301-100666323 TAACTCTCTCAGTAAAGTTTTGG + Intergenic
1107794387 13:44034967-44034989 TAGGTCACACAGTATAGTTTAGG + Intergenic
1112691460 13:101900424-101900446 TATCTCATGCAGTTTCGTTTGGG - Intronic
1113920329 13:113904405-113904427 TAAATTACCCAGTCTCGTTTAGG + Intergenic
1115981808 14:39060486-39060508 AAACTTACCCAGTTTAGTCATGG - Intronic
1117867941 14:60168907-60168929 TAACTAACCCATTGAAGTTTTGG + Intronic
1120101089 14:80446404-80446426 AAACTGACCCTGTTTAGCTTAGG - Intergenic
1121523025 14:94599405-94599427 TGACTCACACAGTTTTGTCTGGG + Intronic
1121562479 14:94885556-94885578 CACCTCACCCAGCCTAGTTTGGG - Intergenic
1121999306 14:98633458-98633480 TAGCGCATCCAGTTTAGTCTAGG + Intergenic
1124416078 15:29474191-29474213 TAAATCACCAAGTTTAGAGTTGG + Intronic
1125147600 15:36490389-36490411 TAAGTCATCAAGTTTTGTTTTGG - Intergenic
1126675587 15:51157215-51157237 TAAGCCACCCAGTTGTGTTTGGG + Intergenic
1129157832 15:73729840-73729862 GCACTCACCCAGTTTTGTTTTGG - Intergenic
1132913561 16:2328913-2328935 TAAATGACCCATTTTACTTTTGG + Intronic
1137896792 16:52221466-52221488 TCACTCACCCATTTTATATTGGG + Intergenic
1140244894 16:73239097-73239119 TTAAGCACCCAGTTTATTTTGGG - Intergenic
1141761413 16:86031060-86031082 TAACTCACTCTGATTGGTTTAGG + Intergenic
1142859674 17:2753744-2753766 TGACTTTCTCAGTTTAGTTTGGG + Intergenic
1147050884 17:37794079-37794101 TAACTCACCCACTTTTTTCTAGG - Intergenic
1147416698 17:40296483-40296505 GAAATAACCCAGTTTTGTTTGGG + Intronic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1148593200 17:48831673-48831695 CCACTGACCCAGCTTAGTTTGGG + Intronic
1150947347 17:69762355-69762377 TAAAAGACTCAGTTTAGTTTTGG + Intergenic
1154081981 18:11266603-11266625 AAACTTACCCTGTTGAGTTTAGG + Intergenic
1155997634 18:32347591-32347613 TAATTGACCCAGTTTGCTTTAGG - Intronic
1159857026 18:73600789-73600811 TAATTCAGTCAGTTTATTTTTGG - Intergenic
1163985937 19:20951436-20951458 TAATCCACCAAATTTAGTTTTGG - Intergenic
1165367183 19:35375139-35375161 TAAATCACCCAGTGTTGGTTGGG + Intergenic
925365443 2:3308191-3308213 TCAGTCACCCTGTTTAGGTTTGG - Intronic
928846397 2:35678540-35678562 TAGCTTTCCCAGTTTTGTTTGGG + Intergenic
931566020 2:63616358-63616380 TAATTCCCCCAGTTTGTTTTAGG - Intronic
932546630 2:72718331-72718353 TAGCTCACTCAGTTTTCTTTAGG + Intronic
933915911 2:86993341-86993363 TAACAGACCAAGTTTAGTTTCGG - Intronic
933933758 2:87182373-87182395 CTACTCAGCCAGTTTATTTTGGG + Intergenic
934007082 2:87776561-87776583 TAACAGACCAAGTTTAGTTTCGG + Intronic
934609577 2:95724774-95724796 TTATTCACCCAGTTTAGGTCAGG + Intergenic
934877448 2:97937919-97937941 TCACTTACGAAGTTTAGTTTGGG - Intronic
935770725 2:106417468-106417490 TAACAGACCAAGTTTAGTTTCGG + Intronic
935909361 2:107878471-107878493 TAACAGACCAAGTTTAGTTTCGG - Intronic
935967492 2:108495471-108495493 TAACATACCAAGTTTAGTTTCGG - Exonic
936131137 2:109843606-109843628 TAACAGACCAAGTTTAGTTTCGG - Intronic
936213560 2:110527879-110527901 TAACAGACCAAGTTTAGTTTCGG + Intronic
936359352 2:111783071-111783093 CTACTCAGCCAGTTTATTTTGGG - Intronic
936422697 2:112382439-112382461 TAACAGACCAAGTTTAGTTTCGG + Intronic
936542893 2:113366352-113366374 TTATTCACCCAGTTTAGATCAGG + Intergenic
940595064 2:155780721-155780743 TAACTGACCCAGTGTAATTGAGG + Intergenic
943554171 2:189381022-189381044 TAATTCCCACGGTTTAGTTTTGG - Intergenic
1170229692 20:14031036-14031058 TAACACTCCTAATTTAGTTTTGG + Intronic
1170352105 20:15453023-15453045 TGACACACTCAGTTTAGTTCTGG - Intronic
1170915728 20:20623304-20623326 TAACTCTACCAGTTTTCTTTTGG - Intronic
1171723418 20:28591044-28591066 AAATGCACCCAGGTTAGTTTTGG + Intergenic
1171754645 20:29092047-29092069 AAATGCACCCAGGTTAGTTTTGG - Intergenic
1171788012 20:29490495-29490517 AAATGCACCCAGGTTAGTTTTGG + Intergenic
1171859926 20:30388906-30388928 AAATGCACCCAGGTTAGTTTTGG - Intronic
1178482906 21:32995674-32995696 TAACACATCTAGTTCAGTTTAGG - Intergenic
1180296973 22:10949700-10949722 AAATGCACCCAGGTTAGTTTTGG + Intergenic
1180411640 22:12615860-12615882 AAATGCACCCAGGTTAGTTTTGG - Intergenic
1183370793 22:37431015-37431037 TAGCTCAGCCAGCTCAGTTTAGG - Intergenic
949958419 3:9289810-9289832 AAACTCACCCAGTTCAGGCTGGG + Intronic
952097693 3:29973469-29973491 TAACTCAACCAGTTTTTTCTGGG + Intronic
952173736 3:30838693-30838715 TAAGGCACCCATTTTAGGTTAGG - Intronic
953314479 3:41913614-41913636 TAACTGACACATTTAAGTTTTGG + Intronic
956265861 3:67394914-67394936 TCACTTATGCAGTTTAGTTTGGG - Intronic
963550756 3:146719443-146719465 TCACTCACCCATATTACTTTGGG + Intergenic
965158380 3:165096273-165096295 TATCTGACCCATTTTTGTTTGGG - Intergenic
965791031 3:172388019-172388041 TAATTCACCTAGTTGAGTCTTGG + Intronic
970059525 4:12016005-12016027 TAACTCACCCAGGGTGGTTGGGG + Intergenic
970986912 4:22169659-22169681 TTACTCACCCAGTCTATTATAGG - Intergenic
972221846 4:36965014-36965036 TAATTTACCCAGTTCATTTTAGG + Intergenic
972339641 4:38140305-38140327 TAAGCCGCCCTGTTTAGTTTTGG + Intergenic
978147554 4:105393734-105393756 TTTCTCACTCAGTTCAGTTTAGG - Intronic
978818288 4:112934103-112934125 AAATTCACCTAGTGTAGTTTCGG + Intronic
979165889 4:117530757-117530779 TATCTAACCAAGTTTTGTTTAGG + Intergenic
980745366 4:137005557-137005579 TCAATCACCCTGTTTAATTTTGG - Intergenic
980844552 4:138308460-138308482 CAAATCACCAAGTTTATTTTGGG - Intergenic
981631104 4:146819301-146819323 TAACTCAAGCAGTGTGGTTTTGG + Intronic
984360936 4:178730964-178730986 TAACATATCCAGTTTGGTTTAGG - Intergenic
985438089 4:189952615-189952637 AAACGCACCCAGGTTAGTTTTGG - Intronic
985548166 5:520321-520343 TAACTCCCCCAGTTCCCTTTTGG + Intronic
986424640 5:7618512-7618534 TGACTTACGCAGCTTAGTTTAGG - Intronic
992268123 5:75038159-75038181 TTACAGACCCAGTTTAGGTTAGG - Intergenic
996591877 5:125157431-125157453 TAAGTCATTCAGTTTAGTTGGGG + Intergenic
1001266358 5:170277350-170277372 TAACTTAGCAAGTTTATTTTAGG - Intronic
1004513507 6:16302395-16302417 TAACTCACCCAGTTTAGTTTGGG - Exonic
1005782079 6:29202646-29202668 TAACTCACCTAACTTAGTGTGGG + Intergenic
1011004565 6:82629595-82629617 TAAGACACCCAGTTTGGGTTAGG - Intergenic
1012704658 6:102506457-102506479 TATTTAACCCAGTTAAGTTTAGG - Intergenic
1012843474 6:104360533-104360555 TAACTCACCTAGTTTGGTTTAGG + Intergenic
1012881464 6:104795914-104795936 AAAATCACCAAGTATAGTTTTGG + Intronic
1013742759 6:113307241-113307263 TGACTCACGAAGTTTAATTTTGG + Intergenic
1013851839 6:114525518-114525540 TAACAAACCCAGTTCAGTTGTGG + Intergenic
1014608355 6:123507695-123507717 CAAATCACCCAGTTTTATTTAGG + Intronic
1017559712 6:155614399-155614421 TAAACCAGCCAGTTTAGGTTTGG + Intergenic
1033457829 7:141518447-141518469 TACCACACCCAGCTCAGTTTTGG - Intergenic
1035244369 7:157552686-157552708 TAACTCACCTTTTTTGGTTTTGG - Intronic
1038600241 8:28933427-28933449 TAACTCCCTCTGTTTACTTTGGG - Intronic
1039844997 8:41319867-41319889 TAACTCATCCAGATTCTTTTTGG + Intergenic
1040309238 8:46228114-46228136 TAGCCCACCCAGGATAGTTTGGG - Intergenic
1042891888 8:73621404-73621426 TAAATCACCCAGTTCAGTCTCGG + Intronic
1046534985 8:115497627-115497649 TAATTCTACCAGTTTTGTTTAGG + Intronic
1051653922 9:19359718-19359740 TAACTCACAAAGTCTAGGTTGGG + Intronic
1051919310 9:22245977-22245999 TAACTTTCCCAGTTAAGGTTTGG - Intergenic
1052774735 9:32722048-32722070 TAAGTCACCCAGATTAGGTAAGG + Intergenic
1053726685 9:41009334-41009356 AAATGCACCCAGGTTAGTTTTGG - Intergenic
1055490366 9:76798796-76798818 CAACTCACACCGTTTAGTATAGG - Intronic
1056083166 9:83118393-83118415 TAAATAATCCAGTTTAATTTTGG + Intergenic
1056514530 9:87337573-87337595 TCCCTGACCCAGTTTAGTGTGGG + Intergenic
1059554564 9:115266432-115266454 TAACTCATACATCTTAGTTTGGG + Intronic
1202803824 9_KI270720v1_random:30899-30921 AAAAGCACCCAGGTTAGTTTTGG + Intergenic
1203448627 Un_GL000219v1:87946-87968 AAATGCACCCAGGTTAGTTTTGG + Intergenic
1186658489 X:11642850-11642872 TAATTCACCCATTTAATTTTAGG - Intronic
1186922270 X:14295087-14295109 TAACTCACCTATTTTGTTTTAGG + Intergenic
1188308106 X:28583950-28583972 TAGCTCACTCAGTTTATTTTGGG + Intergenic
1197310066 X:124893921-124893943 TAATTAACTCAGTATAGTTTAGG - Intronic
1199380757 X:147169569-147169591 CCAGTCACCCAGTTTAGGTTTGG + Intergenic
1200748153 Y:6920867-6920889 TAAGTTACACATTTTAGTTTAGG + Intronic