ID: 1004513844

View in Genome Browser
Species Human (GRCh38)
Location 6:16305558-16305580
Sequence GCGATGTCACCAGGGTGTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004513844_1004513847 15 Left 1004513844 6:16305558-16305580 CCACAACACCCTGGTGACATCGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1004513847 6:16305596-16305618 CAGAAATGAAATCCCGCATGTGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004513844 Original CRISPR GCGATGTCACCAGGGTGTTG TGG (reversed) Exonic
906748832 1:48240858-48240880 GCGATTTCAGCAGAATGTTGGGG - Intronic
912257698 1:108078147-108078169 GTGATGTCTCCAGGAAGTTGTGG - Intergenic
916569436 1:166012309-166012331 GCTCTGTCTCCAGGCTGTTGGGG - Intergenic
923778651 1:237001869-237001891 GCGAGCTCACGAGGGAGTTGGGG + Intergenic
1067795510 10:49318617-49318639 GCTAACTCACCAGAGTGTTGTGG + Intronic
1068945913 10:62728656-62728678 GCTATGTCTCCAGTGTTTTGTGG + Intergenic
1070901166 10:80030224-80030246 GAGATGTCACTGGGGAGTTGCGG + Intergenic
1077119898 11:902292-902314 ACGATGTCACCAAGGTCTTTGGG - Exonic
1077693229 11:4368369-4368391 GCGATGTCACCAGGAGCTTATGG + Exonic
1083902410 11:65650052-65650074 GTGAGGCCACCAGGGTGCTGCGG + Intronic
1089400666 11:118162572-118162594 GCGGAGTCCCCAGGGGGTTGGGG + Exonic
1097154788 12:57004807-57004829 GCGACGTCACCATTGTGGTGGGG - Exonic
1101798864 12:108003098-108003120 GGGATGTCACTAGGGTGTGCGGG + Intergenic
1102522977 12:113490754-113490776 GCGAGGCCACCATGCTGTTGAGG + Intergenic
1106814613 13:33393387-33393409 GCAATGTCAGCATGGTGTAGTGG + Intergenic
1109612813 13:64788963-64788985 GCCATGTCACCAGGCTGGTCTGG + Intergenic
1114148076 14:20001933-20001955 GCCATGTCATCAGTGTCTTGAGG + Intergenic
1121992087 14:98568103-98568125 GCACTGTCACCATTGTGTTGGGG - Intergenic
1122718668 14:103709949-103709971 GCCCTGTCACCAGGCTGCTGCGG + Intronic
1125001109 15:34770764-34770786 GGGATATGACCAGGGTGCTGAGG - Intergenic
1125605907 15:40939798-40939820 CAGATGTCACCAGGGTGCAGAGG - Intergenic
1126049796 15:44675476-44675498 GCCATGGTACCTGGGTGTTGTGG + Exonic
1128355419 15:66923161-66923183 GTGATGTCACCAGCATATTGGGG - Intergenic
1129799005 15:78399470-78399492 GCGGGGCCACCAGGCTGTTGAGG + Intergenic
1133792657 16:9021134-9021156 GCAATGTTACCAGGGTGAGGTGG - Intergenic
1136270273 16:29144372-29144394 GCGCTGACTCCAGGGTGTGGGGG - Intergenic
1136384119 16:29911998-29912020 GAGATGTCACCATGGGGATGAGG + Exonic
1137512907 16:49117012-49117034 GTTAAGTCACCACGGTGTTGTGG - Intergenic
1141510545 16:84509296-84509318 GCGATGTCTCCAGGCTGCTGTGG - Intronic
1142073863 16:88106206-88106228 GCGCTGACTCCAGGGTGTGGGGG - Intronic
1143337546 17:6184450-6184472 GCTATGTCACCAGGCTATTCTGG - Intergenic
1143926968 17:10379798-10379820 GCAATGTCAGCAGGATGGTGGGG + Intergenic
1144286997 17:13786466-13786488 GTGATGTGGCCAGGGGGTTGTGG + Intergenic
1146055251 17:29577701-29577723 GCTCTGTCACCAGAGTGCTGTGG + Exonic
1152794772 17:82301562-82301584 GCTTTCTCATCAGGGTGTTGAGG + Intergenic
1158111026 18:53941769-53941791 GAGATGGTATCAGGGTGTTGGGG + Intergenic
1161038757 19:2099098-2099120 GGGATGTCAGCAGGGTGTGCAGG - Intronic
1163034367 19:14562723-14562745 GCCATGTCCCCTGGGTGTGGCGG + Intronic
1168166591 19:54552913-54552935 GCCATGTCACCGTGTTGTTGGGG + Intergenic
1168403347 19:56098525-56098547 GTGATGCCACCAGGGTGATATGG + Intronic
1168403379 19:56098649-56098671 GTGATGCCACCAGGGTGATATGG + Intronic
927918229 2:26950179-26950201 GGGAAGTCACCTGGGTGCTGGGG - Exonic
931444319 2:62314074-62314096 GAGGTTTCACCAGGGTGTAGGGG + Intergenic
932418990 2:71590399-71590421 GTGCTGTCACCAGGGTCCTGTGG + Intronic
935068831 2:99676104-99676126 GGGGTGTAACCAGGGTGCTGTGG - Intronic
940884707 2:158978831-158978853 GACATGTCTCCAGGGTTTTGAGG + Intronic
944825463 2:203478678-203478700 GGGATGTCACCATGATGGTGAGG + Intronic
946162228 2:217842171-217842193 GCAATGTCACCGAGGGGTTGAGG - Intronic
948368159 2:237472040-237472062 GGGATGTCCCCAGGGTGAGGTGG + Intergenic
948907592 2:240987111-240987133 GCCATGGAGCCAGGGTGTTGGGG + Intronic
1169248752 20:4044602-4044624 GTAATCTCACCAGGGTGCTGAGG - Intergenic
1172137326 20:32695912-32695934 GCTCTGTCACCAGGCTGATGTGG - Intergenic
1180968527 22:19802921-19802943 GCTGTGTCCCCAGGGTGATGCGG - Intronic
1184130919 22:42515944-42515966 GCACTGTCCCCAGTGTGTTGGGG - Intronic
950539383 3:13600974-13600996 GTGATCACATCAGGGTGTTGAGG + Intronic
954778375 3:53040842-53040864 GCTATGTCACCAGGCTGAAGGGG + Intronic
961384061 3:126514803-126514825 ACAATGACACCAGGGGGTTGTGG - Intronic
970018545 4:11540268-11540290 GAGATGTGCCCAGGGTGTTATGG + Intergenic
977096689 4:92754540-92754562 CCGATCTCACCGTGGTGTTGTGG + Intronic
981896914 4:149812839-149812861 GCATTGTCACCTGGGTGTAGGGG - Intergenic
985720254 5:1485190-1485212 GAGAGGTCCCCAGGGTGTTGAGG - Intronic
987875375 5:23674704-23674726 GAGAGGTCAGGAGGGTGTTGAGG + Intergenic
988909175 5:35822651-35822673 GAGATGCCACCAGAGTCTTGTGG + Intergenic
988935118 5:36074035-36074057 GGTATATCACCGGGGTGTTGTGG - Intergenic
995791290 5:115891098-115891120 ACCATGTCACCAGGGCCTTGAGG + Intronic
1001843903 5:174904089-174904111 CCCATGCCACCAGGGTCTTGGGG + Intergenic
1004513844 6:16305558-16305580 GCGATGTCACCAGGGTGTTGTGG - Exonic
1005994842 6:30924709-30924731 GCGATGACCCTAGGGTCTTGAGG + Intronic
1006096107 6:31657800-31657822 GTGATGTCACCAGAGGGATGTGG + Intronic
1006379085 6:33687440-33687462 GCACAGTCACCAGGGTGTGGTGG - Intronic
1007415442 6:41688801-41688823 GCGATGTCACCAGGGCAGTGGGG + Intronic
1007520365 6:42447385-42447407 GCGTTGCCACAAGGGTGCTGTGG - Intronic
1013188944 6:107785649-107785671 GCAAGGTCACCGGGGTGCTGTGG + Intronic
1016868856 6:148797122-148797144 GCACTGTCAGCTGGGTGTTGTGG + Intronic
1021328930 7:19310644-19310666 GCGATGTAACCAAGGTGTCAGGG - Intergenic
1022216210 7:28264284-28264306 TCTATTTCACAAGGGTGTTGTGG + Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1032903657 7:136339362-136339384 GCAATGTCACCACTGTGATGGGG - Intergenic
1036209862 8:6833327-6833349 GGAATGTCACCAGGGTGGTCAGG - Intronic
1036280281 8:7394242-7394264 GCGATGACACCAAGGTGTAGCGG + Intergenic
1036341246 8:7917641-7917663 GCGATGACACCAAGGTGTAGCGG - Intergenic
1042841575 8:73129604-73129626 GTGATGTCAGGAGGGTTTTGTGG + Intergenic
1049018764 8:139939710-139939732 CAGATGTGACCAGGCTGTTGTGG - Intronic
1049200440 8:141337401-141337423 GTGACATCACCAGGGTGTTGGGG + Intergenic
1049463500 8:142740667-142740689 GCGATGTCTCCAGGGTTTACAGG + Intergenic
1061224642 9:129273738-129273760 GCGAACTCAGCAGGGTGTGGAGG - Intergenic
1062532316 9:137007332-137007354 GCGATGGCAGCTGGGGGTTGGGG + Exonic
1185570995 X:1134715-1134737 GCTCTGTCACCAGGGCGTGGTGG - Intergenic
1194346706 X:92773918-92773940 ATGATGTTAACAGGGTGTTGGGG - Intergenic
1200655039 Y:5890562-5890584 ATGATGTTAACAGGGTGTTGGGG - Intergenic