ID: 1004516368

View in Genome Browser
Species Human (GRCh38)
Location 6:16325534-16325556
Sequence CTCCCATGAAACCACAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004516364_1004516368 -10 Left 1004516364 6:16325521-16325543 CCGTTTACCCTGCCTCCCATGAA 0: 1
1: 0
2: 3
3: 25
4: 263
Right 1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG 0: 1
1: 0
2: 5
3: 24
4: 152
1004516363_1004516368 -9 Left 1004516363 6:16325520-16325542 CCCGTTTACCCTGCCTCCCATGA 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG 0: 1
1: 0
2: 5
3: 24
4: 152
1004516362_1004516368 -3 Left 1004516362 6:16325514-16325536 CCTAAACCCGTTTACCCTGCCTC 0: 1
1: 1
2: 9
3: 56
4: 178
Right 1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG 0: 1
1: 0
2: 5
3: 24
4: 152
1004516360_1004516368 11 Left 1004516360 6:16325500-16325522 CCACTCTAACCAATCCTAAACCC 0: 1
1: 0
2: 1
3: 7
4: 155
Right 1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG 0: 1
1: 0
2: 5
3: 24
4: 152
1004516361_1004516368 2 Left 1004516361 6:16325509-16325531 CCAATCCTAAACCCGTTTACCCT 0: 1
1: 2
2: 27
3: 68
4: 182
Right 1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG 0: 1
1: 0
2: 5
3: 24
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004516368 Original CRISPR CTCCCATGAAACCACAATAA AGG Intronic
902032822 1:13435261-13435283 CTCTGATGACACCACAATATAGG - Intergenic
906145136 1:43555910-43555932 CTTCCATGAACCTAGAATAAGGG - Intronic
908697047 1:66855246-66855268 TTCCCTAGTAACCACAATAAAGG + Intronic
912297220 1:108481792-108481814 TGACCATGAAACAACAATAAAGG + Intergenic
913266010 1:117045264-117045286 CACCCATGAAACCACAACCTAGG - Intergenic
913393450 1:118340177-118340199 CTTCAATCAAACCACAAAAAAGG + Intergenic
916213956 1:162380395-162380417 CACCACTGAAACCACAAGAAAGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918842617 1:189561922-189561944 CTCTCATGAAACAACACAAAGGG + Intergenic
922197977 1:223376219-223376241 TTCCCATGAAAGTACAATAAAGG + Intergenic
1063876310 10:10482967-10482989 TTCCCATGAAAACACAATAAAGG + Intergenic
1064389206 10:14926983-14927005 CTAGCATGAAACCACTCTAATGG + Intronic
1064897982 10:20260976-20260998 CTCCAATGAAGTCACAAAAATGG - Intronic
1065122016 10:22539376-22539398 CTCCCATCAAGCAACATTAACGG + Intronic
1065361638 10:24894657-24894679 CTTCCATAAAACCTCAAAAATGG - Intronic
1066671124 10:37840897-37840919 CTCAAATGAAAACACAATAGTGG + Intronic
1067704079 10:48594271-48594293 CTCCCATGGGACCACCATCAGGG + Intronic
1068142467 10:53025629-53025651 CGCCCCTGAAACTAAAATAAAGG - Intergenic
1070908052 10:80091877-80091899 CACCAACGAAACCACAAAAAAGG - Exonic
1076889303 10:133276133-133276155 CTCCCATTAAAACACAATAGTGG + Intronic
1080850917 11:36069220-36069242 CTGCCTTGGGACCACAATAAAGG + Intronic
1081134909 11:39428617-39428639 CTCTCATGAAGCCAAAATCAAGG + Intergenic
1081192416 11:40120002-40120024 TTCCCATAAAACCACAATAAAGG + Intronic
1081917578 11:46742758-46742780 CTCCCATGTTCCCACTATAAAGG + Intergenic
1085703497 11:78765506-78765528 TTCCCATGAAAAAACAATCATGG - Intronic
1085806766 11:79643568-79643590 CTCCCATGAAGCCACACAAAGGG - Intergenic
1086609228 11:88734198-88734220 CTCCAAAGAAAGCACACTAATGG + Intronic
1086781956 11:90918080-90918102 CTCCTATGAAACCCCTATATAGG + Intergenic
1093838771 12:23870023-23870045 CTCCCATGTCACTACATTAAAGG + Intronic
1096001127 12:48131479-48131501 TTCCCATGAAACCACATGACAGG - Intronic
1096108135 12:49010796-49010818 CTCCCCTAAAACCACCATAAAGG - Intronic
1098221231 12:68271961-68271983 GTCACAGGAAACCAAAATAATGG + Intergenic
1098310636 12:69145609-69145631 CTCCAAGGAAACCAAAATCATGG + Intergenic
1098543733 12:71687804-71687826 CTCCTATGAAAACAAAATACTGG + Intronic
1099823448 12:87745011-87745033 CTGGCATGAAAACACAAAAAAGG + Intergenic
1099917047 12:88907742-88907764 TGCCCATGGAACCATAATAAAGG - Intergenic
1101129167 12:101671402-101671424 CTCCCATGAAACCAAACTAAAGG + Intronic
1101930061 12:109006558-109006580 TTCCTGGGAAACCACAATAAAGG - Intronic
1102616461 12:114158790-114158812 CTCCCAGGAAGCCACAATAGTGG + Intergenic
1106785750 13:33106620-33106642 CACCTATGAAAGCACACTAATGG + Intronic
1107981426 13:45737708-45737730 CCCCACAGAAACCACAATAAAGG - Intergenic
1108059971 13:46523038-46523060 CTCACATAAAAACACAATTACGG - Intergenic
1108511865 13:51163596-51163618 CTCCCTTTAACCCACAATAAAGG + Intergenic
1108758533 13:53533501-53533523 ATACAATGAAAGCACAATAACGG - Intergenic
1117873599 14:60226317-60226339 CTCTCATGAAACTACAGTCAAGG + Intergenic
1118600374 14:67467836-67467858 CTCCCATAAAACAGAAATAATGG + Intronic
1120253501 14:82089216-82089238 CCTCAAAGAAACCACAATAAAGG + Intergenic
1121659956 14:95627438-95627460 CTCCCATGGGAACACATTAATGG + Intergenic
1124092989 15:26623800-26623822 CTTCCCAGCAACCACAATAAAGG + Intronic
1125267427 15:37899292-37899314 CTACCAAGAAACCAGAATAAAGG + Intergenic
1125573586 15:40739634-40739656 CTCACATGAGACCACAAAAAGGG + Intronic
1126077871 15:44931060-44931082 CACGCATGAAGGCACAATAATGG + Intergenic
1126267279 15:46769240-46769262 TTCCAATGAAACCAAAATCATGG - Intergenic
1126749738 15:51864635-51864657 TTCCCATTGAACCACAATAAAGG - Intronic
1127253017 15:57261939-57261961 CTCCCCAAAAACCAGAATAATGG + Intronic
1130531522 15:84750410-84750432 CTCCCAGGAAAGCACCACAAGGG - Intronic
1130617640 15:85427317-85427339 TTCCCATGAAAGCAGAATACAGG - Intronic
1132075132 15:98813474-98813496 TCCCAAGGAAACCACAATAAAGG + Intronic
1132201224 15:99956091-99956113 TTCCCATGGAACCACAGTAGAGG - Intergenic
1140658919 16:77168477-77168499 TCCCCATGAAACCAAAATGATGG - Intergenic
1143934098 17:10464019-10464041 ATCCCCTGAATCCAAAATAAAGG - Intronic
1144278115 17:13696641-13696663 CTCACATGAAACCAAAAAAGAGG + Intergenic
1146823158 17:36000763-36000785 CCCCCGAGAAACCCCAATAAAGG + Intronic
1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG + Intergenic
1148651190 17:49251265-49251287 CTCCCAAGAATAAACAATAAAGG - Intergenic
1149300072 17:55297075-55297097 CTCCCAATTAACCACATTAAAGG - Intronic
1151131534 17:71902409-71902431 CTCACAAGAAACCAAAAAAATGG + Intergenic
1151467816 17:74299081-74299103 TTCCCATGAATGCACAATGAGGG - Intronic
1151667085 17:75551152-75551174 CTCCCCTAAAACCAAAATAAGGG - Intronic
1152140228 17:78532185-78532207 TTCCCTGGAAGCCACAATAAAGG + Intronic
1155315680 18:24568134-24568156 TTCCACAGAAACCACAATAAGGG - Intergenic
1155535605 18:26813292-26813314 CTCCATTGTATCCACAATAAAGG - Intergenic
1156423270 18:36979529-36979551 CTGCCATAAAAACAGAATAAAGG + Intronic
1156621625 18:38858114-38858136 CTCCACTGATACCACAATAAAGG - Intergenic
1159874854 18:73799419-73799441 GTCCCATCACAGCACAATAATGG - Intergenic
926216606 2:10909490-10909512 CCCCCAGGAAACCCCAATAGAGG + Intergenic
928379432 2:30804853-30804875 CTCCCATGAGAAAACCATAAAGG - Intronic
928655981 2:33452514-33452536 CTCCCATGAACCCAGAATCGAGG - Intronic
928717470 2:34078182-34078204 CTTCCAAGAAATCAGAATAAAGG - Intergenic
930849962 2:55950194-55950216 CTCCCATGAAACTAAAAGGAGGG - Intergenic
933204589 2:79491018-79491040 TTCCCATCAAAGCACAGTAATGG + Intronic
933975656 2:87507168-87507190 CCCCCATGAAAGCACATAAAAGG + Intergenic
935621493 2:105134304-105134326 CTCCCAAGAGACCAGAATCAAGG + Intergenic
936318168 2:111443645-111443667 CCCCCATGAAAGCACATAAAAGG - Intergenic
936587976 2:113775457-113775479 ATCCCTTGAAAGCACAATAAAGG + Intergenic
938053888 2:128198982-128199004 TTCCTGGGAAACCACAATAAGGG + Intergenic
939505233 2:143037911-143037933 CTCCATTACAACCACAATAAGGG - Intronic
941790172 2:169543567-169543589 CTCCTATGTAACTACAATACTGG - Intronic
942395791 2:175548122-175548144 CTTCCAGGGAACCACAAGAAAGG + Intergenic
946162507 2:217844358-217844380 CCCCCATGAAACCACAGGAATGG + Intronic
1175588449 20:60166730-60166752 CACCTCTGAAACCACAATATGGG + Intergenic
1175613681 20:60373946-60373968 TTCCCATGAAAACACAGTGAAGG - Intergenic
1179885023 21:44310193-44310215 CTCCCCTCAAACAACAAGAAAGG + Intronic
1184387581 22:44185177-44185199 CTCTCATGTGACCCCAATAAAGG - Intronic
1185179338 22:49350186-49350208 CTTCCATGGAGCCACAGTAAAGG - Intergenic
949903286 3:8837677-8837699 TTCCCAGGAAACCAAAATAGAGG - Intronic
951808663 3:26675790-26675812 TTCCCAAGAAACAACAATTAAGG - Intronic
952884712 3:38005422-38005444 CTCTCATGAAAGCTCTATAAGGG + Intronic
954047343 3:47943857-47943879 CTACCCTGAGACCACAATACAGG + Intronic
956631298 3:71319250-71319272 CCCCCATACCACCACAATAAGGG + Intronic
956857140 3:73286455-73286477 CTCCCACCAAACCCCCATAAAGG - Intergenic
956992767 3:74787321-74787343 CTGACATGAAAAAACAATAAGGG + Intergenic
957306139 3:78461085-78461107 TTCCCATGGATCCCCAATAAAGG - Intergenic
960023348 3:112980465-112980487 TTCCCAAGAAACCAAATTAATGG + Intergenic
960963878 3:123091155-123091177 CTCCCAGGAAACCACAGCCAGGG - Intronic
961006077 3:123406261-123406283 TTCCCTGGAAACCACAATAAAGG + Intronic
962079620 3:132123841-132123863 CTCTCATTAAACCAATATAATGG - Intronic
964531009 3:157668062-157668084 CTCCCATACAACCACAAAAAAGG + Intronic
965737696 3:171839084-171839106 CTCCCGTGCAAACACAATATAGG - Intergenic
966343049 3:178946663-178946685 CGCCCATGGAACTCCAATAAAGG + Intergenic
967349302 3:188494364-188494386 CACCGATGAAAACACAATGAGGG - Intronic
969163958 4:5288447-5288469 TTAACACGAAACCACAATAAGGG - Intronic
969400998 4:6955402-6955424 CTCCCATGACCCTACAAGAAAGG - Intronic
969849874 4:9947831-9947853 CTGCCATGGGGCCACAATAAAGG + Intronic
970036207 4:11738504-11738526 CCCCCATGCAACCTCAATATTGG - Intergenic
972009209 4:34154727-34154749 ATTCCATGAAACCTCAAAAAAGG - Intergenic
972846493 4:42997774-42997796 TTCCATGGAAACCACAATAAAGG + Intronic
973943480 4:55933589-55933611 CTCCCCTAAAACTACAATAAAGG - Intergenic
975571054 4:75818219-75818241 CTCTCATAAAACTACAATCAAGG - Intergenic
980177000 4:129357999-129358021 CTCCCATTAAAGCACAATTTAGG - Intergenic
981354789 4:143776317-143776339 CATCCATGAACCCACAATAAAGG + Intergenic
981811800 4:148783886-148783908 ATCAAATGAAACCAAAATAAGGG + Intergenic
983726706 4:170937916-170937938 CTCCCATTCAACCAAAACAAAGG - Intergenic
984673035 4:182513978-182514000 TCCCAAGGAAACCACAATAAAGG + Intronic
984744590 4:183202054-183202076 TCCCCAGGAAACCACAATACAGG - Intronic
987484233 5:18503423-18503445 TTCCCCTGAAACGACAATAAAGG - Intergenic
988768778 5:34410066-34410088 GTCCCATGATAGCTCAATAAAGG + Intergenic
991220908 5:64215056-64215078 CTCCTACGAAATTACAATAAGGG - Intronic
992347465 5:75894555-75894577 CTTCCATGAAACCACCAGACAGG - Intergenic
994328263 5:98474938-98474960 CTCCCATGATTGCACAATACTGG + Intergenic
996020851 5:118589325-118589347 TTCCACAGAAACCACAATAATGG + Intergenic
996521465 5:124431113-124431135 ATCCCATCAAAGCACAAGAATGG + Intergenic
1000450948 5:161386252-161386274 GTGCCATTAAATCACAATAAGGG - Intronic
1001106726 5:168860822-168860844 TTCCTATGAAACCCCAATAAGGG + Intronic
1003506848 6:6746692-6746714 CTCCCACAGAACCACAAAAAGGG - Intergenic
1003699696 6:8448125-8448147 GTCCCATAAAACCAGAATCAAGG + Intergenic
1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG + Intronic
1004572593 6:16862300-16862322 CTTCCCTCAAAGCACAATAAAGG - Intergenic
1005977462 6:30811014-30811036 TGCCTGTGAAACCACAATAAAGG + Intergenic
1009804687 6:68588401-68588423 CACCCAGGAACCTACAATAAAGG - Intergenic
1011846616 6:91571471-91571493 CTCCCATGAAACTGCAATGTAGG - Intergenic
1012076738 6:94697096-94697118 CTTCTATGAAACCACAAGACAGG + Intergenic
1015982407 6:138852471-138852493 CTCCCCTCATCCCACAATAATGG - Intronic
1018291445 6:162295998-162296020 ATCCCATGAAACTACAATTTTGG + Intronic
1021403868 7:20241286-20241308 CTCTCAGGAAACAATAATAATGG - Intergenic
1021478406 7:21088702-21088724 CTCCTATGACAGCACAATTAAGG - Intergenic
1021560212 7:21961998-21962020 CTACCATGAAACAACATTAATGG + Intergenic
1021695310 7:23270525-23270547 CTCCAATGAAACAACAACAAAGG + Intronic
1024053140 7:45642198-45642220 TTACCCTGAAACCACAATGAAGG - Intronic
1030690782 7:112530556-112530578 CTCCCCTGAAGCCATAATAAGGG - Intergenic
1032183998 7:129707555-129707577 CTCCCAAGAAATTAGAATAAAGG + Intronic
1032817677 7:135493814-135493836 CTCCCCTTAAACCTTAATAATGG + Intronic
1032955564 7:136967793-136967815 CTCCACTGAAACTACAATTAGGG + Intronic
1033614292 7:142997631-142997653 TTCCTATGTAACCACAAGAAAGG + Intergenic
1038321187 8:26528806-26528828 CTTCCCTGAAACCACAATAAAGG - Intronic
1039562411 8:38523270-38523292 CTCCCATGAAAAAAAAAAAATGG - Intronic
1041827403 8:62111299-62111321 CACCAATGAAACAACAAAAAAGG - Intergenic
1042161629 8:65903009-65903031 CTTCCATGAAACAACTATAGCGG + Intergenic
1042933356 8:74034646-74034668 CTCCAAGGAAACCAGAATCATGG + Intergenic
1045987250 8:108262951-108262973 CTCCCAGGAATCCAAAATCAAGG + Intronic
1047130919 8:122018571-122018593 CTCCCTTGAAGCCATAATTAGGG - Intergenic
1047190784 8:122677415-122677437 CTCTGATGAAACCACAATGGTGG + Intergenic
1048062496 8:130934921-130934943 CTCCCATAAAGCCAAAAAAATGG - Intronic
1048109672 8:131454077-131454099 CTCCCATGCAGCCACCATCATGG + Intergenic
1048728019 8:137408745-137408767 CTCCAAGGATACCACAAAAATGG + Intergenic
1048839722 8:138554441-138554463 CTCTCATTAAACCACATAAAAGG + Intergenic
1050647735 9:7739720-7739742 CTCCTATGAAATCACAGTAAGGG + Intergenic
1055836560 9:80449591-80449613 TCCCGAGGAAACCACAATAAAGG - Intergenic
1055950749 9:81727675-81727697 ATCCCATGAAACCACAATATAGG - Intergenic
1056526475 9:87447282-87447304 CTCCCAAGTAACTAGAATAACGG - Intergenic
1056572835 9:87830828-87830850 ATCCCTTGAAACCACACTACAGG + Intergenic
1056686998 9:88775099-88775121 CTCCCATGTAGACACACTAAAGG - Intergenic
1059015353 9:110509954-110509976 CTAACTTGGAACCACAATAAAGG - Intronic
1059041158 9:110816875-110816897 CACCCATGAAAAAAAAATAAAGG - Intergenic
1060459604 9:123837912-123837934 CTCCTATGAAACCTCTATGATGG + Intronic
1060466629 9:123912697-123912719 CTCCACTGAAACCACACTGATGG - Intronic
1185930333 X:4195792-4195814 CTCCCCTGAATCCCGAATAAAGG - Intergenic
1188075178 X:25767177-25767199 CTCCCATGGAAACATAATAGGGG + Intergenic
1188423518 X:30017875-30017897 CACCCAAGAAAACACAATGAAGG - Intergenic
1188571317 X:31588532-31588554 TTCCTTGGAAACCACAATAAAGG + Intronic
1191803382 X:65105734-65105756 CTCACATGACACCACATGAATGG - Intergenic
1195088132 X:101432285-101432307 CTCACATGAAACCACTATTAAGG - Intronic