ID: 1004516649

View in Genome Browser
Species Human (GRCh38)
Location 6:16327122-16327144
Sequence CACGCCCGCAGCTGACCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004516649_1004516653 -8 Left 1004516649 6:16327122-16327144 CCTCCAGGTCAGCTGCGGGCGTG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1004516653 6:16327137-16327159 CGGGCGTGTTGCTGTTGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 85
1004516649_1004516654 5 Left 1004516649 6:16327122-16327144 CCTCCAGGTCAGCTGCGGGCGTG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1004516654 6:16327150-16327172 GTTGGGCAGGACCATCACAGAGG 0: 1
1: 1
2: 1
3: 12
4: 163
1004516649_1004516657 21 Left 1004516649 6:16327122-16327144 CCTCCAGGTCAGCTGCGGGCGTG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1004516657 6:16327166-16327188 ACAGAGGCCCGGACCCCCGAAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1004516649_1004516655 10 Left 1004516649 6:16327122-16327144 CCTCCAGGTCAGCTGCGGGCGTG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1004516655 6:16327155-16327177 GCAGGACCATCACAGAGGCCCGG 0: 1
1: 0
2: 2
3: 48
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004516649 Original CRISPR CACGCCCGCAGCTGACCTGG AGG (reversed) Exonic
900095634 1:939029-939051 CCCTCCCGCAGGTGACCTGTTGG + Exonic
900316765 1:2060872-2060894 CACCTACGCAGCTGCCCTGGTGG + Intronic
904000510 1:27335980-27336002 CCTGCCGGCAGCTGCCCTGGGGG + Exonic
908385224 1:63634944-63634966 CACCTATGCAGCTGACCTGGTGG + Exonic
908695965 1:66842136-66842158 CAAGCCAGAAGCAGACCTGGAGG - Intronic
916664767 1:166956769-166956791 CACCACCCCAGATGACCTGGAGG - Exonic
919778290 1:201207874-201207896 CACTCCCGCAGGTGCCCTAGGGG - Exonic
920296503 1:204960570-204960592 CACGCCCAGAACTGACCTCGTGG - Intronic
1063127372 10:3147595-3147617 CACGCCCGCAGGGGACCTGCAGG - Exonic
1063135035 10:3208821-3208843 CACCTCTGCAGCTGACCTCGGGG - Intergenic
1073289387 10:102405838-102405860 CAGGCCCGGGGCTGTCCTGGTGG - Intronic
1076061877 10:127419403-127419425 GAAGGCCACAGCTGACCTGGTGG - Intronic
1076355110 10:129846972-129846994 CAGGCCCCCAGCCGCCCTGGGGG + Intronic
1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG + Exonic
1077240249 11:1507026-1507048 CTCTGCCACAGCTGACCTGGAGG + Intergenic
1079031129 11:16987260-16987282 CACACCCCCCACTGACCTGGTGG + Intronic
1084550814 11:69840680-69840702 CACGCCCCCAGCAGCCCTCGCGG + Intergenic
1085702462 11:78757010-78757032 CACTCCTGCAGATGGCCTGGTGG - Exonic
1086460463 11:87000559-87000581 TAAGCCCTCAGCTGACCTGTGGG - Intergenic
1087396867 11:97610599-97610621 CACGCCTGCAGCTGTCACGGTGG + Intergenic
1089671282 11:120058618-120058640 CACGCATGCTGCAGACCTGGGGG + Intergenic
1103147281 12:118606029-118606051 CAGACCCACAGCTGCCCTGGGGG + Intergenic
1104447080 12:128843347-128843369 CAAGGCAGCAGCAGACCTGGGGG + Intergenic
1104686255 12:130787139-130787161 CAGGCCAGCAGCAGGCCTGGAGG - Intergenic
1104755336 12:131265629-131265651 CACGCCTGCAGCAGACCTCGGGG - Intergenic
1104869153 12:131982207-131982229 CACTGCCGCAGCTGCCCGGGAGG + Exonic
1105472240 13:20704285-20704307 CGCGCCCGCGGCTCACCTGTAGG - Exonic
1108595647 13:51946352-51946374 CACGCCCACGGCTGTCATGGTGG - Exonic
1117184536 14:53227001-53227023 CACCTGCTCAGCTGACCTGGGGG + Intergenic
1117546560 14:56798299-56798321 CCGGCCCGCGGCCGACCTGGAGG + Intergenic
1128126508 15:65197180-65197202 CTCGACGGCAGCTGCCCTGGGGG + Exonic
1132845856 16:2000499-2000521 CACACCCTGACCTGACCTGGGGG - Intronic
1140801113 16:78489295-78489317 AGCGACCTCAGCTGACCTGGGGG - Intronic
1141731438 16:85825536-85825558 CACGCCCACCCCTGGCCTGGGGG - Intergenic
1143510973 17:7394773-7394795 CACGCACGCCGCCGGCCTGGCGG - Exonic
1143583875 17:7841904-7841926 CACGCTCGCTTCTTACCTGGGGG - Intronic
1144608267 17:16686905-16686927 CACGCCAGCGGATGGCCTGGGGG - Intergenic
1144761455 17:17709772-17709794 CCCGCACGGAGCTGATCTGGGGG - Intronic
1146280476 17:31541226-31541248 CACCCCGGCTGCTGACCTGATGG - Intergenic
1148496127 17:48054537-48054559 CAGCCCAGCTGCTGACCTGGGGG + Intronic
1150587145 17:66529324-66529346 TCCACCAGCAGCTGACCTGGTGG + Intronic
1150784578 17:68152223-68152245 TACTCCCTCTGCTGACCTGGAGG - Intergenic
1151231174 17:72686243-72686265 CATGCCAGCAACAGACCTGGGGG - Intronic
1158217376 18:55113994-55114016 CATTCCCACAGCTGACCTCGGGG - Intergenic
1160060317 18:75524002-75524024 CACAACCACAGCTGACCAGGAGG + Intergenic
1161520755 19:4722519-4722541 CACGCCTGCAGCTGGAATGGAGG - Exonic
1161989877 19:7678647-7678669 AATGCCCGGAGCTGAGCTGGGGG + Intronic
1162489929 19:10986002-10986024 CAGCCCAGCAGCCGACCTGGTGG - Intronic
1163556710 19:17997420-17997442 CATGCCCAGAGCTGCCCTGGGGG - Intronic
1165484918 19:36089786-36089808 AAAGCCCTCTGCTGACCTGGAGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167383345 19:49150726-49150748 CCCGCCCGCAGATGACCCGGGGG - Exonic
925969842 2:9098611-9098633 CACACCTGCAGCTGACCAGGGGG + Intergenic
927980393 2:27371023-27371045 CTAGGCCGCAGCTGCCCTGGTGG + Intronic
937329703 2:121018938-121018960 CACGCCCGCAGCAGCCCCTGAGG + Intergenic
938554969 2:132416277-132416299 CACGTCCACCGCTGCCCTGGGGG - Intergenic
946303252 2:218838946-218838968 CATTCCCGCAGCTAACCTGCTGG + Intergenic
947713209 2:232327346-232327368 CAAGCCTGCAGCTGGGCTGGAGG + Intronic
948140625 2:235669980-235670002 CACGCCCCCCGCTGACCGCGAGG - Intronic
948259750 2:236594831-236594853 CACCCCCGCAGGTGGGCTGGTGG - Intergenic
948355101 2:237371716-237371738 GACGCCCCCATCTCACCTGGAGG + Exonic
948836912 2:240630338-240630360 CACGGCCGCAGCCTGCCTGGGGG - Exonic
948990485 2:241551574-241551596 CACTGCCGCAGATGACTTGGGGG + Intergenic
1168789760 20:568299-568321 CAGGCCCCCAGCTGCCCTGATGG + Intergenic
1169948003 20:11010130-11010152 CCCGCCCACAGCTTTCCTGGGGG + Intergenic
1170999066 20:21396036-21396058 GACGCCAGCACCTGAGCTGGAGG - Exonic
1172695811 20:36822165-36822187 CACGGCAGCAGCTGGCCAGGTGG + Intronic
1173175474 20:40761840-40761862 CATGCCCTCACCTGACCTCGGGG + Intergenic
1175838236 20:62010201-62010223 CACGCCACCAGCTGACGAGGGGG + Intronic
1179826595 21:43969421-43969443 CACGCCTGCAGCTCAGATGGGGG - Intronic
1180122541 21:45763596-45763618 CACGGCCGCATCTCATCTGGGGG - Intronic
1184418023 22:44363455-44363477 CACGCAGGCTGCTGAGCTGGGGG - Intergenic
1185272043 22:49934281-49934303 CATGTCCTCAGCTGACCTGGGGG + Intergenic
1185281482 22:49971809-49971831 TGCGCCCGCAGGTGCCCTGGTGG - Intergenic
950160515 3:10757221-10757243 CACCCCCTGAGCTGACATGGTGG - Intergenic
950196841 3:11015429-11015451 CACGCCCACAGCTGTCCCGAGGG + Intronic
956855813 3:73273922-73273944 CATGCACACAGTTGACCTGGGGG - Intergenic
958004319 3:87792882-87792904 CACGCCCGCAGCTGGCGCGCAGG + Intergenic
961654379 3:128433195-128433217 CGCTCGGGCAGCTGACCTGGGGG + Intergenic
968459692 4:718335-718357 CAGGCCTGCAGCTGTCCAGGAGG - Intronic
969597161 4:8156087-8156109 CAGGCCAGCAGCTGCCCAGGAGG + Intronic
981081639 4:140643690-140643712 CACGGCCGCATTGGACCTGGGGG - Intronic
984298637 4:177886758-177886780 CAGCCACACAGCTGACCTGGTGG + Intronic
984448623 4:179870284-179870306 AACTCCAGCAGCTGACCTGGTGG + Intergenic
992356352 5:75988453-75988475 TAGGACCTCAGCTGACCTGGAGG + Intergenic
997384797 5:133464237-133464259 CACTGCCGCACCTGGCCTGGTGG - Intronic
1002000496 5:176194094-176194116 CACTCCAGCAGCAGAGCTGGAGG + Intergenic
1002253840 5:177944887-177944909 CACTCCAGCAGCAGAGCTGGAGG - Intergenic
1002533730 5:179864690-179864712 CACTCCCCCAGCAGGCCTGGAGG - Intronic
1004516649 6:16327122-16327144 CACGCCCGCAGCTGACCTGGAGG - Exonic
1007473297 6:42104447-42104469 CGGGCCCGCAGCTCACCTGCCGG + Exonic
1019283510 7:211935-211957 AACGCCCTAACCTGACCTGGGGG - Intronic
1024212634 7:47218764-47218786 CACTCCCACAGCTTACCTGGAGG + Intergenic
1031025239 7:116672383-116672405 CCCGGCCGCAGGTGACCCGGAGG + Exonic
1048968954 8:139633809-139633831 CACGCTCGCAGCAGGCCTCGGGG - Intronic
1048998902 8:139812008-139812030 CAGCCCTGCAGCAGACCTGGAGG + Intronic
1051170793 9:14316078-14316100 CCCTCCCCCAGCGGACCTGGAGG + Intronic
1051418935 9:16871298-16871320 CACGCCCGCAGCTCCCCGGGGGG - Intergenic
1056845408 9:90033138-90033160 CATGCCCGCAGCTTACCTCCTGG + Intergenic
1058396283 9:104557527-104557549 CACGCCAGCACCTGCACTGGTGG - Intergenic
1062431264 9:136527800-136527822 CCCGCCCGCCGCTCACCTGCGGG - Intronic
1191137724 X:57083416-57083438 CATGCCAGCAGCAGTCCTGGAGG - Intergenic
1191869359 X:65732850-65732872 AATGCTGGCAGCTGACCTGGTGG + Intronic
1199715223 X:150503315-150503337 GTCGCCCGAGGCTGACCTGGGGG - Intronic
1199861494 X:151804388-151804410 CACAACCACAGATGACCTGGAGG - Intergenic