ID: 1004516715

View in Genome Browser
Species Human (GRCh38)
Location 6:16327398-16327420
Sequence CAGCCACTTTGTCCCTCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004516715_1004516727 15 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516727 6:16327436-16327458 TGCATGACGACCTGGGAGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
1004516715_1004516725 13 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516725 6:16327434-16327456 ATTGCATGACGACCTGGGAGGGG 0: 1
1: 0
2: 1
3: 2
4: 87
1004516715_1004516722 8 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516722 6:16327429-16327451 GGCGTATTGCATGACGACCTGGG 0: 1
1: 0
2: 0
3: 0
4: 16
1004516715_1004516728 22 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516728 6:16327443-16327465 CGACCTGGGAGGGGGGCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 310
1004516715_1004516721 7 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516721 6:16327428-16327450 CGGCGTATTGCATGACGACCTGG 0: 1
1: 0
2: 0
3: 0
4: 15
1004516715_1004516724 12 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516724 6:16327433-16327455 TATTGCATGACGACCTGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 47
1004516715_1004516726 14 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516726 6:16327435-16327457 TTGCATGACGACCTGGGAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 153
1004516715_1004516729 23 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516729 6:16327444-16327466 GACCTGGGAGGGGGGCCCCAGGG 0: 1
1: 0
2: 3
3: 28
4: 442
1004516715_1004516723 11 Left 1004516715 6:16327398-16327420 CCTCCCGAGGGACAAAGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1004516723 6:16327432-16327454 GTATTGCATGACGACCTGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004516715 Original CRISPR CAGCCACTTTGTCCCTCGGG AGG (reversed) Exonic
900958429 1:5903436-5903458 CTGCCACTTTCTACCTCGAGAGG + Intronic
901674076 1:10872789-10872811 CAGCCACTTATTCCCTGGAGAGG - Intergenic
902205197 1:14863342-14863364 CAGACACTCTGTCCCTCCGGGGG + Intronic
902978921 1:20109372-20109394 CTGTCACTTTGTCCCTGGGCTGG + Intergenic
905256674 1:36689189-36689211 CAGCTTCTTTGACCCTCAGGTGG - Intergenic
912133405 1:106629657-106629679 GAACAACTTTGTCCCTTGGGTGG - Intergenic
916879960 1:169011011-169011033 GATCCACTTTGTTCCTCAGGAGG + Intergenic
919264253 1:195240168-195240190 CAGACACTGTCTTCCTCGGGGGG - Intergenic
920096162 1:203487807-203487829 CAGCCATTTCCACCCTCGGGAGG + Exonic
1065951872 10:30659722-30659744 ACACCCCTTTGTCCCTCGGGAGG + Intergenic
1075703591 10:124484874-124484896 CAGCCCCTTTGACCCTCAGTGGG + Intronic
1076138951 10:128064487-128064509 CAGCCTCCTTTTCCCTCGCGTGG - Intronic
1076271027 10:129152390-129152412 CAGCCACTTTGTGCATTGTGAGG - Intergenic
1078068434 11:8093174-8093196 CAGGCACAGCGTCCCTCGGGAGG + Intronic
1080418911 11:32093089-32093111 CAGCCACATTGTCACTGGAGAGG + Intronic
1082726456 11:56742944-56742966 CAGCTACTTTGTCCCTCTCTAGG + Exonic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084509498 11:69594428-69594450 CAGCCACTTTACCTCTCTGGTGG - Intergenic
1085808952 11:79663044-79663066 CAGCCCTTTTATCCCTAGGGTGG + Intergenic
1086436153 11:86782854-86782876 CACCTACTCTGTCCCTGGGGGGG - Intergenic
1094476082 12:30841782-30841804 CATCCTCCTTGTGCCTCGGGAGG - Intergenic
1094843582 12:34351927-34351949 CAGCCTCTTTGCCCCCCGTGGGG + Intergenic
1094850596 12:34380646-34380668 GAGACACTTTCTCCCTTGGGGGG + Intergenic
1101646058 12:106631894-106631916 CAGGCACATGGTCCCTCTGGAGG + Intronic
1102036945 12:109776092-109776114 CAGCCACTTTGTGCCCCTGAGGG - Intergenic
1104487182 12:129161846-129161868 CTGCCACTTTGTTGCTGGGGAGG + Intronic
1105223753 13:18408661-18408683 CAGCCATTTTCTCCCTGGAGAGG + Intergenic
1105888108 13:24659874-24659896 CAGCAGCTTTGTCCCTCTAGGGG + Intergenic
1119526345 14:75325426-75325448 TAGCCACTTTTTCCCTCTTGGGG + Intergenic
1122236242 14:100332165-100332187 CAGCCAGTGTGACCCTGGGGAGG + Intergenic
1122929578 14:104927203-104927225 CAGCCTCTCTGTCCCACGGGCGG - Exonic
1123990889 15:25682528-25682550 CAGCGTCTTTGTCCCACAGGTGG + Intronic
1125538231 15:40454964-40454986 CTGCAACTTTTTCCCTGGGGTGG - Intronic
1127700208 15:61492193-61492215 CCCCCACTTTGTCCTTAGGGCGG + Intergenic
1128537104 15:68499927-68499949 CAGCCTCTCTTTCCCTTGGGAGG - Intergenic
1131352770 15:91716981-91717003 CACCCGCTCTGTCCCTCGTGGGG + Intergenic
1134280635 16:12813854-12813876 CAGCCCCCTTGTCACTTGGGAGG - Intergenic
1135491690 16:22914995-22915017 CAGCTACTTTGTCACTCAAGAGG + Exonic
1138460418 16:57144405-57144427 AAGCCACTTGTTCCCTGGGGAGG - Intronic
1140017498 16:71201668-71201690 CAGCCATTTTGCCCCTAGGAGGG + Intronic
1142703000 17:1675809-1675831 CAGCCTCCTTGTCCCACAGGTGG - Exonic
1144727996 17:17511407-17511429 ATGCCACTTCCTCCCTCGGGGGG + Intronic
1147502459 17:40978755-40978777 CAGCCTCTTTGTGACTCTGGGGG + Intronic
1148076816 17:44941888-44941910 CAGCCACACTGGCCCTCAGGAGG - Intronic
1153084734 18:1271422-1271444 CAGCCCCTTTGTCCTTGTGGGGG - Intergenic
1155444232 18:25894079-25894101 CAGCTACTTTGTCCCTTGGCAGG - Intergenic
1158897318 18:61927299-61927321 CAGCTCCCTTGTCCCTCAGGTGG - Intergenic
1161320474 19:3638514-3638536 CAGACTCTTGGCCCCTCGGGAGG - Intronic
1162756650 19:12864969-12864991 CACTCCCTCTGTCCCTCGGGAGG + Intronic
1164995688 19:32719564-32719586 CGGCCCCTCTGTCCCTCCGGGGG + Intergenic
1165157521 19:33797093-33797115 CGGCCGCTTTGTCCCTCTGCTGG + Intronic
1166089970 19:40502459-40502481 TCGCCTCTTTGTGCCTCGGGAGG + Exonic
1166963465 19:46513809-46513831 CCACCCCCTTGTCCCTCGGGCGG - Intronic
930800465 2:55438135-55438157 CAGGCACTTTGTTCCTGTGGGGG - Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
934721795 2:96583396-96583418 CAGAGACTTTTTCCGTCGGGGGG - Intergenic
935941494 2:108243819-108243841 AAGCCAGTTTGTCAATCGGGTGG - Intergenic
941718282 2:168786675-168786697 CAGCCACTTGATCCCTCAAGTGG + Intronic
942948068 2:181691187-181691209 CAGCCACATTGTCTCTATGGTGG - Intergenic
946134725 2:217636410-217636432 CAGCCTCTTTGCCCCTCAGTGGG + Intronic
946884567 2:224210340-224210362 CAGACACTTTGTGCCCCAGGAGG + Intergenic
947322218 2:228933045-228933067 CAGCCCCTTTGTACCTCTGGTGG + Intronic
1171077807 20:22146940-22146962 CAGCTTCTTTGTCCCTTGGGTGG - Intergenic
1171322912 20:24262232-24262254 CAGCCCCTTCATCCCTCAGGAGG + Intergenic
1175403826 20:58714824-58714846 CAGCCACTCTGTTCCCAGGGAGG - Intronic
1176767855 21:13038039-13038061 CAGCCATTTTCTCCCTGGAGAGG + Intergenic
1178400100 21:32278490-32278512 CCTCCACTTTGGCTCTCGGGCGG - Intronic
1181512117 22:23393774-23393796 CAGCCACGTTGTCCCACGCCTGG - Intergenic
1183474513 22:38028681-38028703 TAGCCACTGTGTCCCTCTGTGGG + Intronic
1183540324 22:38426174-38426196 CAGCCACCTTGGCCCTTGGATGG - Intergenic
949121669 3:392034-392056 CAGCTACTTTCTCCCTGGAGTGG + Intronic
950791490 3:15475618-15475640 CACCCACTTTCTCCCTCCTGAGG + Intronic
954150559 3:48655147-48655169 CAGCCACCTTGTCCTTGGAGGGG + Exonic
961574443 3:127823203-127823225 CCGCCACTTTATCCCTGGGCCGG + Intronic
961792300 3:129384906-129384928 AAGCCAGTTTGACCCTCGGCGGG - Intergenic
963264695 3:143228640-143228662 GTGCCACTTCCTCCCTCGGGGGG - Intergenic
994240760 5:97418109-97418131 CAGCCACCTTGTCCTTTGGGAGG + Intergenic
1002388705 5:178892123-178892145 CTGCCAGTTTTTCCCTCAGGAGG + Intergenic
1004516715 6:16327398-16327420 CAGCCACTTTGTCCCTCGGGAGG - Exonic
1007725498 6:43913444-43913466 CAGCCCCTCTGACCCTCTGGGGG - Intergenic
1010732337 6:79404445-79404467 CAGCCACTTCTTCCCTCTGCTGG - Intergenic
1017777281 6:157690041-157690063 CAGCCACTTTTGCCCTGGGATGG - Intergenic
1019475869 7:1243981-1244003 AAGCCCCTGTGTCCCTCTGGGGG - Intergenic
1033152127 7:138924686-138924708 CAGCCGCTTTGTCCCTCCTGGGG - Intronic
1033677412 7:143556634-143556656 CAACCCCTTTGTACCTTGGGTGG - Intergenic
1033694422 7:143772802-143772824 CAACCCCTTTGTACCTTGGGTGG + Intergenic
1034119070 7:148610829-148610851 CAGACACTTTGTCCTTTTGGTGG - Intronic
1037692361 8:21192887-21192909 GAGCCACATTGTCCCTTGTGGGG - Intergenic
1040300130 8:46183652-46183674 CTGCCTCTATGTCCCTCTGGTGG + Intergenic
1042687813 8:71461782-71461804 CAGCCAGGGTGTCCCTCAGGGGG + Intronic
1049707122 8:144048136-144048158 CAGCCTCTTAGTCCCTGGGAAGG + Intergenic
1049724441 8:144138968-144138990 GAGCCACTGTGTCCCTGGGCTGG - Intronic
1050616200 9:7404137-7404159 CAGCTTCCTTGTCCCTTGGGAGG + Intergenic
1057498473 9:95578440-95578462 CAGCACCCTTGCCCCTCGGGTGG + Intergenic
1058423772 9:104858572-104858594 CAGCCAGTTTCTCCCTTGGTAGG + Exonic
1058613431 9:106800088-106800110 CAAGCACTTTGGCTCTCGGGAGG + Intergenic
1062082033 9:134629394-134629416 CCGCCTCTGTGCCCCTCGGGTGG + Intergenic
1190753819 X:53383507-53383529 CAACCGCTTTGTCTCTCAGGAGG + Intronic
1197876322 X:131112164-131112186 CAGCCACTTTGTCTTTTGGTTGG + Intergenic