ID: 1004518241

View in Genome Browser
Species Human (GRCh38)
Location 6:16338904-16338926
Sequence ATGCACACCAACAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004518235_1004518241 -5 Left 1004518235 6:16338886-16338908 CCCAATGTGCAGACCCCTATGCA 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1004518241 6:16338904-16338926 ATGCACACCAACAAGAAGGAAGG No data
1004518236_1004518241 -6 Left 1004518236 6:16338887-16338909 CCAATGTGCAGACCCCTATGCAC 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1004518241 6:16338904-16338926 ATGCACACCAACAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004518241 Original CRISPR ATGCACACCAACAAGAAGGA AGG Intronic
No off target data available for this crispr