ID: 1004520875

View in Genome Browser
Species Human (GRCh38)
Location 6:16359432-16359454
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 13, 2: 63, 3: 162, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004520864_1004520875 30 Left 1004520864 6:16359379-16359401 CCACAGCAGGCAGGAGGATGGCC 0: 1
1: 0
2: 5
3: 53
4: 392
Right 1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG 0: 1
1: 13
2: 63
3: 162
4: 437
1004520871_1004520875 9 Left 1004520871 6:16359400-16359422 CCAGGGACAAAGGGGGCAGAGAG 0: 1
1: 0
2: 2
3: 30
4: 468
Right 1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG 0: 1
1: 13
2: 63
3: 162
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
901957714 1:12798323-12798345 CAGGAAGACCAGTGGCAGAGAGG + Intergenic
901965707 1:12864075-12864097 TAGGAAGACCAGTGGCAGAGAGG + Intronic
901981106 1:13034453-13034475 TAGGAAGACCAGTGGCAGAGAGG + Intronic
902000981 1:13194477-13194499 TAGGAAGACCAGTGGCAGAGAGG - Intergenic
902020211 1:13340181-13340203 TAGGAAGACCAGTGGCAGAGAGG - Intergenic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903337492 1:22634905-22634927 TTGGATGACCAGCTGCCGAGAGG - Intergenic
903672122 1:25042784-25042806 TAGGATGACCAGCTGTAGAGAGG - Intergenic
903785812 1:25860516-25860538 CTGGCTGACCTGCTGCAGACTGG - Intergenic
904042916 1:27594465-27594487 CAGGATGACCAGGTGCCAAGGGG + Intronic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
904370118 1:30042904-30042926 TGGGATGACCAGCTGCAGACAGG + Intergenic
904885825 1:33737598-33737620 TTGGATGATAAGTTGCAGGGTGG + Intronic
905001326 1:34672007-34672029 CAGGATGACTGGCTGCAGAGAGG + Intergenic
905001336 1:34672075-34672097 TGGGATGACCACCTGCAGAGAGG + Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
905546106 1:38801660-38801682 CGGGACTACCAGTTGCAGAGAGG + Intergenic
906132407 1:43468579-43468601 CCCAATGACCAGCTGCAGAGAGG - Intergenic
906225140 1:44115750-44115772 CTGGATGACCATTTACATAAGGG + Intergenic
906854795 1:49292552-49292574 GGGGATGACTAGCTGCAGAGAGG + Intronic
906854811 1:49292690-49292712 CAGGATTACCTGCTGCAGAGAGG + Intronic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907369612 1:53992482-53992504 TGGGATGACCAGTTGAAGAGAGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
909151355 1:72010074-72010096 CTGGCTGGACAGTGGCAGAGGGG - Intronic
909238272 1:73180639-73180661 TGGGAGGAGCAGTTGCAGAGAGG - Intergenic
909282340 1:73771036-73771058 TGGGATAACCAGCTGCAGAGAGG + Intergenic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
911118623 1:94272447-94272469 CTGGATAACCAGGTGCAAGGAGG + Intronic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
912077557 1:105894590-105894612 CTGGATCTCCAGATTCAGAGAGG - Intergenic
912740180 1:112187204-112187226 CTTGAAGACCAACTGCAGAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
915511670 1:156390123-156390145 CTGGATGAGGAGCTGCAGAAAGG - Intergenic
916204673 1:162304222-162304244 CTGGACATCCATTTGCAGAGAGG - Intronic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
917817632 1:178725943-178725965 CAGGGTGACCTGTTGCAGAGCGG + Intronic
919083224 1:192891301-192891323 TGGGATGATCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919313954 1:195948184-195948206 CAGGACGACGAGTTGCAGAGAGG - Intergenic
920647084 1:207811700-207811722 CTTGATGACCTGTCTCAGAGCGG - Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921274932 1:213510086-213510108 CTGGAGGACTAATTGCTGAGGGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922132774 1:222795661-222795683 TGGGATGAACAGCTGCAGAGAGG + Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923550498 1:234959382-234959404 CTGGATGAGCAGTAGCAAGGAGG - Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
1063077081 10:2728106-2728128 GTACATGACCATTTGCAGAGAGG - Intergenic
1065976582 10:30847333-30847355 TGGGACGACCAGTGGCAGAGAGG + Intronic
1067018079 10:42772315-42772337 CATGATGACCAGCTGCAGGGAGG + Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068279866 10:54854667-54854689 CCTGATGATCAGCTGCAGAGAGG - Intronic
1068348499 10:55814011-55814033 CGGGATGCCCAGCTGCAGAATGG + Intergenic
1069156293 10:65034808-65034830 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1069156301 10:65034876-65034898 TGGGATGACCAGGTACAGAGAGG + Intergenic
1069684517 10:70309134-70309156 CTGGGTGATCAGGGGCAGAGGGG - Intronic
1070730953 10:78828000-78828022 CTGGATCACCTGTTGCCCAGTGG - Intergenic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071060863 10:81570197-81570219 TGGGATGACCAGCTGCAGAAAGG - Intergenic
1071828358 10:89348082-89348104 CTGGATGGAAAGTTCCAGAGTGG + Intronic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1072335525 10:94395094-94395116 CAAGATGACCAGCTTCAGAGAGG - Intergenic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1072753363 10:97999965-97999987 TGGAATGACCAGCTGCAGAGAGG + Intronic
1073079119 10:100846521-100846543 CTGGAGGATCACTTGAAGAGAGG - Intergenic
1073260681 10:102188201-102188223 CAAGATGACCAGTAGCAGACAGG - Intergenic
1074028794 10:109663913-109663935 TGGGATGACCAGCTACAGAGAGG + Intergenic
1074247910 10:111713477-111713499 CAGGATGACCAGCTCCAGAGAGG - Intergenic
1074247921 10:111713591-111713613 TGGGATGACCAGCTGTAGAGAGG - Intergenic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1074991520 10:118712754-118712776 TGAGATGACCAGCTGCAGAGAGG - Intronic
1075007827 10:118842996-118843018 TGGGATGACCAGCTGCAGGGAGG + Intergenic
1075007837 10:118843066-118843088 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076655119 10:132018974-132018996 TGGGATGAGCAGTTACAGAGAGG - Intergenic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1077844674 11:6012385-6012407 TGGGATGACCAGGTGCAGAGAGG - Intergenic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078042755 11:7883909-7883931 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1079710672 11:23679698-23679720 AGGGATGACCAGCTGCGGAGAGG - Intergenic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1084469457 11:69348590-69348612 CAGGATGACCAGCTGCAGCTGGG - Intronic
1084483554 11:69435352-69435374 CTGGATGCCCAGGCTCAGAGAGG - Intergenic
1084991159 11:72926378-72926400 TGGCATGACCAGTTGCAGAGAGG + Intronic
1084991165 11:72926431-72926453 TGGGATGGCCAGCTGCAGAGAGG + Intronic
1086085068 11:82945502-82945524 CAGGATGACTAGTCGTAGAGAGG - Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086989631 11:93288846-93288868 CTTGATCACCAGTCCCAGAGGGG - Intergenic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1088704254 11:112447754-112447776 CCTAATGACCAGCTGCAGAGAGG - Intergenic
1089398009 11:118148424-118148446 CAGGATGACCAAGTCCAGAGAGG + Intronic
1089813310 11:121149237-121149259 CTGGTTGACCAGGCTCAGAGAGG - Intronic
1089823201 11:121246798-121246820 TGGGATGACCCGCTGCAGAGAGG + Intergenic
1090124869 11:124075343-124075365 TGGGATGACCTGCTGCAGAGAGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1090137010 11:124209581-124209603 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1091274089 11:134338413-134338435 CTGGCTGTCAAGTTTCAGAGGGG - Intronic
1091703329 12:2678152-2678174 CTGCATTAGAAGTTGCAGAGTGG + Intronic
1091981346 12:4866622-4866644 CTGCCTGTCCAGGTGCAGAGTGG + Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092447070 12:8567850-8567872 CTGGACAACCAGCTGCAAAGAGG - Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092501450 12:9051393-9051415 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1093281833 12:17204343-17204365 TGGGATGACCAGCTACAGAGGGG + Intergenic
1094018115 12:25885136-25885158 CGGGATTACCAGCTGCAGAAAGG + Intergenic
1094144506 12:27214421-27214443 CAGGAGGACTAGCTGCAGAGAGG + Intergenic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602157 12:52737021-52737043 AAGGAGGACCAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1096944667 12:55391869-55391891 CTAGAGGACCAGCTGAAGAGAGG - Intergenic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097298971 12:57998031-57998053 CAGGAGGACCAGCTTCAGAGTGG - Intergenic
1097491967 12:60282325-60282347 CAGGATGATCAGCTGCGGAGAGG - Intergenic
1097670701 12:62534038-62534060 CTGTGTGACCAGTTGGAGTGAGG - Intronic
1098143858 12:67478280-67478302 CTGAATAACCAGCTGAAGAGGGG - Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1099132930 12:78859026-78859048 CTGGATGGCTTTTTGCAGAGCGG - Intergenic
1099550956 12:84043123-84043145 CTGGAAGACTTGTTCCAGAGGGG + Intergenic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1101632262 12:106506469-106506491 CTGGGTAACCAGTGGCGGAGAGG - Intronic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1102328513 12:112010559-112010581 TAGGACGATCAGTTGCAGAGAGG - Intronic
1102992903 12:117327615-117327637 TTGGATGTCCATTTCCAGAGTGG - Intronic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107749778 13:43552573-43552595 GGGGAAGAACAGTTGCAGAGAGG - Intronic
1107853482 13:44592297-44592319 CAGGAGGACCAGCTGCAAAGAGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109525274 13:63566709-63566731 CCAGACGACCAGCTGCAGAGAGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1109982307 13:69924425-69924447 TTGGATGGCCAGCTGCAGAAAGG + Intronic
1110286843 13:73759659-73759681 CTGGATGAACAGGCACAGAGAGG + Intronic
1111333569 13:86792396-86792418 CTGGGCGAGCAGCTGCAGAGGGG + Intergenic
1111337226 13:86840056-86840078 CATGATGACCAGCTGTAGAGAGG - Intergenic
1111512646 13:89287156-89287178 TGGGATGAGCAGCTGCAGAGAGG - Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116054426 14:39845668-39845690 CTGTATGTCCAGTTATAGAGAGG + Intergenic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1118213508 14:63787650-63787672 TGGGACTACCAGTTGCAGAGAGG - Intergenic
1118410063 14:65469762-65469784 CCAGATGACTAGCTGCAGAGAGG - Intronic
1118946990 14:70398115-70398137 TGGGATGACCAGCTCCAGAGAGG - Intronic
1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG + Intronic
1119485061 14:74981598-74981620 CTGGAGGGCCACGTGCAGAGGGG - Intergenic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120745529 14:88147631-88147653 GAGGAGGACCAGCTGCAGAGAGG + Intergenic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1122087575 14:99318210-99318232 CTGGATGATCATTTACAGATTGG - Intergenic
1122604041 14:102936574-102936596 CTGGCTGCCCAGGTGCTGAGGGG + Intronic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1124650206 15:31468890-31468912 TGGGATGACCAACTGCAGAGAGG - Intergenic
1124651361 15:31476633-31476655 CTGGCTGGACAGCTGCAGAGAGG + Exonic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1124820913 15:33044773-33044795 CAGGATGACCAGCTGTACAGAGG + Intronic
1125238859 15:37550246-37550268 TGAGATGACTAGTTGCAGAGAGG - Intergenic
1125381551 15:39092188-39092210 TGGGATTACCAGCTGCAGAGAGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125436081 15:39646169-39646191 TGGGAAGACCAGCTGCAGAGAGG + Intronic
1125752398 15:42037370-42037392 CAGGATGACCAGCTGCTGAGAGG + Intronic
1125756961 15:42070915-42070937 ATGGATGACCTGTGGCAGGGTGG - Intronic
1126156856 15:45574042-45574064 CAGGATGGCCAGCTGCATAGAGG - Intergenic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1127918724 15:63476524-63476546 CTGGAAGACCAGGAGCAGGGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128847887 15:70917506-70917528 TGGGATGACCATCTGCAGAGAGG + Intronic
1128847894 15:70917576-70917598 TGGGATGACCAGTTGCAAAGAGG + Intronic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1130183193 15:81651906-81651928 CAGGATGACCTGCTGCAGAAAGG + Intergenic
1130646305 15:85730187-85730209 CTGGGAAAGCAGTTGCAGAGTGG + Intronic
1131192005 15:90324389-90324411 CTGCAGGAGCAGTTACAGAGCGG - Intergenic
1133885868 16:9827209-9827231 CTGGCTGGCGAGTGGCAGAGAGG + Intronic
1134414003 16:14028364-14028386 CTGGATGGGCAGGTGCAGAAAGG + Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1138033513 16:53579988-53580010 TGGGATGACCAGCTACAGAGAGG - Intergenic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1139625805 16:68187679-68187701 CAGGATGACCAGCTGTGGAGAGG - Intronic
1142198907 16:88751826-88751848 CTGGCTGGACAGGTGCAGAGGGG - Intronic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1144511885 17:15884125-15884147 CTGGAGGAACAGTTTCAGTGTGG - Intergenic
1146093524 17:29905872-29905894 CTGGATGACTAACTGCAGAAAGG + Intronic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1146626135 17:34436933-34436955 CTGAGTGCCCAGTTGAAGAGAGG + Intergenic
1146807749 17:35878788-35878810 ATGGATAAACAGTGGCAGAGTGG + Intronic
1148386252 17:47237256-47237278 GGAGATGACCAGCTGCAGAGAGG - Intergenic
1148386269 17:47237336-47237358 GGTGATGACCAGCTGCAGAGAGG - Intergenic
1148640390 17:49183403-49183425 CAGGACGAACAGCTGCAGAGAGG - Intergenic
1148975635 17:51525893-51525915 CTGGATGGTCAGATGCATAGAGG + Intergenic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1150951010 17:69802083-69802105 TGGGATGACCAGCTGGAGAGAGG + Intergenic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151010036 17:70483797-70483819 CTGGACGACCAGCTGCAAAGAGG - Intergenic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1153139324 18:1954321-1954343 TGGGATGACCACTTGCAGAGAGG - Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155120660 18:22816187-22816209 TGGGATGACCAGTTGCAGAGAGG - Intronic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1157016351 18:43719707-43719729 CTGGCTGCCCATTGGCAGAGTGG - Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157674488 18:49559047-49559069 CTGGCTGTCCATTGGCAGAGTGG + Intergenic
1158230687 18:55251104-55251126 CTGGAAGACTTGTTGCAGATTGG + Intronic
1159832240 18:73291257-73291279 CTGAAGGACCAGTGGAAGAGTGG + Intergenic
1160140961 18:76322524-76322546 CTAGGTGACCAGTTAAAGAGGGG + Intergenic
1160264743 18:77331888-77331910 CTGGCTGACCAGTTACCTAGGGG + Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160313845 18:77822016-77822038 CTGGGGGCCCAGCTGCAGAGAGG - Intergenic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1161998646 19:7730008-7730030 CTGGATGAGCAGGTGCGCAGGGG - Exonic
1164006053 19:21150479-21150501 CTGGATTACTAGTTTCAGCGTGG + Intronic
1164334723 19:24303222-24303244 CTGAATGTCCATTTGCAGAATGG - Intergenic
1164812010 19:31164811-31164833 TTTGATGTCCTGTTGCAGAGAGG - Intergenic
1165022656 19:32936643-32936665 TGAGATGACCAGCTGCAGAGAGG + Intronic
1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG + Intergenic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
1168303470 19:55420077-55420099 TAGGATGACCAGTTGTAGGGAGG + Intergenic
924963907 2:58157-58179 TGGGATGACCAGCTGCAGGGAGG + Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925917159 2:8614959-8614981 CTGGATGACCAGGTGAATGGTGG + Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
927072942 2:19548717-19548739 TGGGATGACCAGCTGCAGAAAGG + Intergenic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927357764 2:22192984-22193006 CTGGATGATCAGTTCCAAATCGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927613538 2:24566298-24566320 TGGGATGACCAGCTGCGGAGAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930592700 2:53348182-53348204 CTGGATGTCCATATGCAGAAGGG - Intergenic
930612046 2:53554404-53554426 TGGGATGACCAGCTGCAAAGAGG + Intronic
930612060 2:53554518-53554540 TGGGATGACCAGCTGCAGAAAGG + Intronic
930957289 2:57217698-57217720 CAGGATGACCAGCTGTGGAGAGG + Intergenic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
933093325 2:78146924-78146946 TGGGATGACTAGCTGCAGAGAGG + Intergenic
933383759 2:81583871-81583893 CGGGAAGGCCAGATGCAGAGAGG + Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
936039469 2:109138906-109138928 CTGAATGGTCAGTTGCAGAAAGG - Intronic
937077585 2:119118141-119118163 CTGGATGTTCAGTAGCAAAGGGG - Intergenic
937152743 2:119697043-119697065 CTGGCTGACCAGCTGCAGGCTGG + Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
938180631 2:129179088-129179110 CAGGATGACCAGCTTCAGAGGGG - Intergenic
938700605 2:133875832-133875854 TTGGATGACTGGTTTCAGAGTGG + Intergenic
940223937 2:151382505-151382527 CTGGATGGGCAGTTTCAGTGGGG + Intergenic
940396247 2:153195931-153195953 TGGGATGATCAGATGCAGAGAGG - Intergenic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943426968 2:187749729-187749751 CAGGATGACCAGATGTGGAGAGG - Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946197422 2:218043503-218043525 TGGGTTGACCAGCTGCAGAGAGG - Intronic
946197432 2:218043571-218043593 GGGGATGACCAGTTGCAGAAAGG - Intronic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948575368 2:238946522-238946544 ATGGATGACTAGCTGCAAAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
948729739 2:239955486-239955508 CAGAATGACCAGTTGCTCAGTGG + Intronic
948923844 2:241081576-241081598 CTTGATGACCTGATGCAGGGTGG - Intronic
1169224550 20:3847794-3847816 GTGTATGACCAGTTGCAGTGAGG + Intronic
1169626598 20:7578310-7578332 CTGTGTGACCAGTTACAGAAAGG - Intergenic
1170495046 20:16915732-16915754 CTGGACAACCAGCTACAGAGAGG + Intergenic
1170495062 20:16915866-16915888 GGGGAAGACCAGTAGCAGAGAGG + Intergenic
1170792966 20:19522726-19522748 CAGCAACACCAGTTGCAGAGAGG - Intronic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1172940966 20:38654413-38654435 CTGGATGACAGGATGCAGTGTGG + Intergenic
1173269252 20:41516962-41516984 CTGGATGACCTGGCTCAGAGGGG + Intronic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1174304094 20:49602968-49602990 CTGGATGACCCCTTGCAGGAAGG - Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1176976543 21:15327434-15327456 TGGGATGATCAGCTGCAGAGAGG + Intergenic
1177396067 21:20537985-20538007 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1178244423 21:30936896-30936918 CGGGATGACCAATGGCAGAGAGG + Intergenic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1182035712 22:27196709-27196731 CTGGCTCCTCAGTTGCAGAGAGG - Intergenic
1182667625 22:31971011-31971033 CAGGATGACCAGCTGCACTGGGG - Intergenic
1183739339 22:39661451-39661473 CTGGGTGCCCAGTGCCAGAGTGG + Intronic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184613632 22:45622671-45622693 CAGGATGACCAGTTACAGAGAGG + Intergenic
1184826666 22:46957183-46957205 CTGTATGCCCAGGTGAAGAGGGG - Intronic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
949507101 3:4738516-4738538 CGGGATGACCAGGTGCACAAAGG + Intronic
950433315 3:12964144-12964166 CTGCATGAGCTGCTGCAGAGAGG - Intronic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951136205 3:19107182-19107204 CAGGATGACCACCTGTAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
952016154 3:28959286-28959308 CAGGATGTCCAACTGCAGAGAGG + Intergenic
952016162 3:28959340-28959362 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
952626046 3:35404711-35404733 CTGGATTAACAGTTTCACAGAGG + Intergenic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
953054228 3:39374962-39374984 CTGGATGTCGTGCTGCAGAGAGG + Intergenic
954035687 3:47849798-47849820 CCGGAGGAGCAGCTGCAGAGCGG - Intronic
954099334 3:48357515-48357537 CAGGATGACTAGCTGCAGATTGG - Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954498065 3:50983484-50983506 TGGGATGACCAGTTGCAGAGAGG + Intronic
955241469 3:57182407-57182429 TGGGACAACCAGTTGCAGAGAGG - Intergenic
955241490 3:57182578-57182600 AGGAATGACCAGCTGCAGAGAGG - Intergenic
955498732 3:59563199-59563221 ATGGATGACTGGTTGCTGAGTGG - Intergenic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956592102 3:70925804-70925826 ATGGGTGTCCAGATGCAGAGAGG + Intergenic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957678787 3:83404565-83404587 CGGAACAACCAGTTGCAGAGAGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959444985 3:106427773-106427795 CTGGAAGTCCAGAGGCAGAGTGG - Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
960690624 3:120342406-120342428 TGGGGTGACCAGCTGCAGAGAGG + Intronic
961041905 3:123683632-123683654 CTGGATTACCCATAGCAGAGAGG - Intronic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
961942942 3:130656443-130656465 CCAGTTGACCAGCTGCAGAGAGG - Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
963805187 3:149714920-149714942 GGTGATGACCAGCTGCAGAGAGG + Intronic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964590666 3:158360034-158360056 TGGGATGACCAATAGCAGAGAGG - Intronic
964791779 3:160460030-160460052 TGGGACAACCAGTTGCAGAGAGG - Intronic
964996792 3:162891871-162891893 CTGGACAACCAGTTACAAAGAGG + Intergenic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966151964 3:176875364-176875386 CTGGAAGCCCAGTTACAGGGAGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966840179 3:184081713-184081735 CAGAATGACCGGCTGCAGAGAGG + Intergenic
966840189 3:184081781-184081803 CAGGACGACCAGCTGCATAGAGG + Intergenic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
968044447 3:195616197-195616219 CTGGATGCCCAGAAGCACAGTGG - Intergenic
968060237 3:195722248-195722270 CTGGATGCCCAGAAGCACAGTGG - Intronic
968067501 3:195766835-195766857 CTGGTTGACCAGCTGCTGACCGG - Intronic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
971342357 4:25782201-25782223 GTGACTGACTAGTTGCAGAGTGG + Intronic
971938779 4:33188547-33188569 TGGGATGACTAGCTGCAGAGAGG - Intergenic
972072596 4:35039181-35039203 CCGGACGACCAGCTGCAGAAAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972931029 4:44071908-44071930 TGGGAAGACCAGCTGCAGAGAGG - Intergenic
974278461 4:59759059-59759081 AGGGATGATCAGTTGCACAGAGG - Intergenic
974308582 4:60174500-60174522 TGGGAAGACTAGTTGCAGAGAGG - Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
974972983 4:68853963-68853985 CAATATGACCAGCTGCAGAGAGG - Intergenic
974974665 4:68875207-68875229 CTGGATGACCAGAGGCTAAGTGG + Intergenic
975112826 4:70645932-70645954 CTGGATGTGCAGTCTCAGAGCGG - Exonic
975253795 4:72211902-72211924 TTTGAAGACCAGCTGCAGAGAGG - Intergenic
975254329 4:72216111-72216133 CAAGATGACCAGCTGCAGGGAGG - Intergenic
975321365 4:73012334-73012356 AGGGATGACCAACTGCAGAGAGG + Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976390716 4:84501323-84501345 CTGGAGGGCCAGGCGCAGAGTGG - Intergenic
976643667 4:87364847-87364869 TTGGATGACAGGTTTCAGAGTGG - Intronic
976679887 4:87745248-87745270 CCAGACGACCAGTAGCAGAGAGG - Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976775997 4:88706794-88706816 CTGGATGACAATCTGCAGACTGG - Exonic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978219705 4:106256030-106256052 ATGGATGGCCAGCTGTAGAGAGG - Intronic
978229865 4:106385594-106385616 TGGGATAACCAGCTGCAGAGAGG - Intergenic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
979145397 4:117240119-117240141 CTGGAAGACCAGCTGCTGAGAGG + Intergenic
979145405 4:117240172-117240194 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
979448179 4:120839492-120839514 TGGAATGACCAGCTGCAGAGAGG - Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
980007624 4:127559582-127559604 TGGGGTGACCAGCTGCAGAGAGG + Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980306239 4:131064787-131064809 TGGGATGATCAGCTGCAGAGAGG - Intergenic
980629784 4:135416282-135416304 CTACGTGACCAGTTGCAGAAAGG + Intergenic
980729790 4:136811471-136811493 GGGGATGGCCAGTTGTAGAGAGG - Intergenic
982032807 4:151317520-151317542 CTGGATGACTAGTGTGAGAGAGG + Intronic
982148239 4:152422233-152422255 CTGAATTACCAGTTGCACACTGG + Intronic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982435817 4:155383037-155383059 CTGCCTGAACAGCTGCAGAGAGG - Intergenic
983737482 4:171080272-171080294 CTAGATGACCAGTTTAAGAAAGG + Intergenic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
983820966 4:172193150-172193172 CTGGCTGCCCATTGGCAGAGAGG - Intronic
984325235 4:178242244-178242266 CAAGATGACCATTTGCAGAGAGG + Intergenic
986791771 5:11168292-11168314 CTGCATTGCCAGTTGCAGATAGG - Intronic
987431927 5:17845194-17845216 CTGGATAGGCAGTGGCAGAGAGG + Intergenic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
987898216 5:23977362-23977384 CAGGAAGGGCAGTTGCAGAGTGG - Intronic
987999627 5:25331340-25331362 TGGGATGACCAGCTGCAGAAAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988699872 5:33662733-33662755 CTGGATGAACACTTGCTGAATGG + Intronic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
989279149 5:39621717-39621739 TGGGATGGCCAGCTGCAGAGAGG - Intergenic
989520696 5:42396773-42396795 CGGGATGACCAGCTACAGAGAGG + Intergenic
990923450 5:60993702-60993724 CGGGGTGATCAGCTGCAGAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
992748479 5:79841134-79841156 CAGGAAGACCAGTTGCATAGTGG + Intergenic
993203670 5:84849556-84849578 CCGCGTGACCAGTTGCAGAGAGG + Intergenic
994449922 5:99929317-99929339 TGGGATGACCAGCCGCAGAGGGG - Intergenic
994641030 5:102410241-102410263 GGGGATGACCAGTTGCAGAGAGG - Intronic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
994998318 5:107094329-107094351 CTGCAGGACCACTTGCAAAGGGG + Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995744941 5:115393532-115393554 CAGGACGACCAGCTGCAGATAGG - Intergenic
997170321 5:131712875-131712897 CTAGATGAGCAGTTTCAGTGGGG - Intronic
997812641 5:136987076-136987098 CTGGATGACCATCTCCAGGGAGG + Intronic
999714834 5:154352322-154352344 CTTTATGTCCACTTGCAGAGGGG - Intronic
999859951 5:155634040-155634062 TGGGATGACCAGCCGCAGAGAGG + Intergenic
999859966 5:155634152-155634174 TGGGATGAACAGTTGCAGAGAGG + Intergenic
999875507 5:155801291-155801313 GTGGAAGACCAGATGCAGAGGGG - Intergenic
1001917099 5:175570914-175570936 CTGGATGACCAGTTTAGAAGTGG + Intergenic
1002689074 5:181037709-181037731 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1002986247 6:2192043-2192065 TGAGATGACCAGATGCAGAGAGG + Intronic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005021433 6:21423172-21423194 AAGGATGACTAGCTGCAGAGAGG - Intergenic
1005043451 6:21620309-21620331 TAGGATGACCAGCTACAGAGAGG - Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1008188289 6:48422764-48422786 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1009196751 6:60695573-60695595 CCTGATGACCAGCTGCAGAAAGG + Intergenic
1009530177 6:64803311-64803333 CTGGATGACCAGCTGTGGAAAGG - Intronic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009846878 6:69145845-69145867 CGGGATGAACAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011069373 6:83363664-83363686 CCACATGACCAGTTGCAGAAAGG + Intronic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013086340 6:106861148-106861170 CAGGTTGACCAGCTGCAGAAAGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1013375564 6:109510374-109510396 CAGGACGACCAACTGCAGAGAGG + Intronic
1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG + Intronic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1013403014 6:109817035-109817057 ATGGATGACCAGTTGTGCAGAGG + Intronic
1013693099 6:112668209-112668231 TAGGATGACCAGTTGCAGATAGG + Intergenic
1013693130 6:112668350-112668372 TGGGATGACCAGTTACAGAGAGG + Intergenic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1014289317 6:119539977-119539999 CTGGACTACCAACTGCAGAGAGG + Intergenic
1015143326 6:129959007-129959029 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1015143336 6:129959077-129959099 CAGAATGACCAGCTGCAGATGGG + Intergenic
1015407893 6:132857692-132857714 GTGGCTGACCAGGTCCAGAGAGG - Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1016620302 6:146101586-146101608 CTGGCAGAGCAGTTGCAGTGTGG - Intronic
1016758831 6:147715846-147715868 ATGGATGACCAGCTGTGGAGAGG - Intronic
1016986365 6:149898635-149898657 CTGGTCTTCCAGTTGCAGAGGGG - Intergenic
1017740959 6:157406225-157406247 CTGGAGGACCGGGTGCTGAGAGG + Intronic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018659933 6:166076640-166076662 GGGAATGACCAGCTGCAGAGAGG - Intergenic
1019634840 7:2070013-2070035 CTTGGTGCCCAGTGGCAGAGGGG - Intronic
1020041804 7:5009247-5009269 CTGGAGGACCATCTTCAGAGAGG - Intronic
1020649299 7:10855189-10855211 AGGGATGACCAGGGGCAGAGAGG + Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1021540358 7:21750711-21750733 CAGGATGACCAGCTCCAGTGAGG - Intronic
1021561366 7:21971899-21971921 TGGGATGACCAGCTACAGAGAGG - Intergenic
1023789159 7:43737931-43737953 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1023790412 7:43749533-43749555 CAGGACGATCAGCTGCAGAGAGG - Intergenic
1023864309 7:44231692-44231714 CTGGACGTCCAGTCCCAGAGGGG - Intronic
1026359573 7:69591302-69591324 TGGGGTGACCAGTTGCAGACAGG - Intergenic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029245326 7:99195290-99195312 TTCAATGACCAGTTTCAGAGGGG + Exonic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1030514027 7:110519198-110519220 TCAGATGACCAGCTGCAGAGAGG - Intergenic
1030538312 7:110796299-110796321 CTGGATGCCAAGCTTCAGAGAGG + Intronic
1030570325 7:111213722-111213744 CAGTATGACCAGTTGTGGAGAGG + Intronic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031786618 7:126041139-126041161 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1031836498 7:126686113-126686135 TGGGATGACCAAATGCAGAGAGG + Intronic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034481251 7:151321581-151321603 TGGGATGACCAGCTGCAAAGAGG + Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1034796513 7:154018421-154018443 CTGGGAGACTAGTTGCAGAGTGG - Intronic
1034982751 7:155489233-155489255 CTGCTTGAGAAGTTGCAGAGGGG - Intronic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035663516 8:1364158-1364180 CTGGATGACATGTTGCATCGAGG + Intergenic
1036706200 8:11048932-11048954 CTGGCTGCCCAGGTGCACAGTGG + Intronic
1037766635 8:21776199-21776221 CTGGGTGACCACATGCAGTGGGG - Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037890055 8:22619318-22619340 CTGGATCTCCAGCTGCAGGGGGG - Exonic
1039182293 8:34880328-34880350 TGGGTTGACCAGCTGCAGAGAGG - Intergenic
1039372925 8:37004859-37004881 CTTGATGACCTGGTGCAGATGGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041260481 8:56017152-56017174 CTGGATGTCCAGGTGCTGAGCGG + Intergenic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1042196806 8:66238118-66238140 CCAGATGACCAGTAGCAGAGGGG - Intergenic
1043087146 8:75849332-75849354 CAGGATGACCAGGTACAGAGAGG - Intergenic
1043403687 8:79908961-79908983 CTGGATGACCACTTGAGAAGAGG - Intergenic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043745594 8:83869785-83869807 TGGGATGACCAGCTGCAGTGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044858911 8:96502559-96502581 CTGGATCTCCATTTCCAGAGTGG + Intronic
1044953333 8:97454686-97454708 CTGGATGACAATTCCCAGAGAGG - Intergenic
1044962379 8:97543151-97543173 CAGGTGGACCAGCTGCAGAGAGG + Intergenic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1046459705 8:114517982-114518004 GGGGATGACCGGTTGCAGAGAGG - Intergenic
1047027679 8:120842420-120842442 CTGGATGACAACTGGCAAAGGGG - Intergenic
1047052299 8:121126335-121126357 CTGGAAATCCAGTAGCAGAGTGG + Intergenic
1049695746 8:143983606-143983628 GTGGAGGGCCAGCTGCAGAGCGG + Exonic
1049824044 8:144655471-144655493 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050483998 9:6114773-6114795 CAGGATGACTGGTTGCAGAGAGG + Intergenic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1052561301 9:30087985-30088007 CCGTGTGACCAGTTGCAGAAAGG - Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052652358 9:31321212-31321234 CAGGATGACCAGTTGTAGAGAGG - Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1053019877 9:34687449-34687471 CTGGATCTCCGGGTGCAGAGTGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057531222 9:95847928-95847950 CCGGAAGACCAGTTGCAGAGAGG + Intergenic
1057568463 9:96185299-96185321 CTGAGAGACCAGTGGCAGAGGGG - Intergenic
1058037520 9:100269210-100269232 ATGGATGAACAGCTCCAGAGAGG - Intronic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1058510789 9:105713882-105713904 TTGACTGGCCAGTTGCAGAGAGG + Intronic
1058510804 9:105713948-105713970 GGGGATGACCAGCTGCAGGGAGG + Intronic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1059566359 9:115386073-115386095 GGAGATGACCAGCTGCAGAGAGG + Intronic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1061709648 9:132478844-132478866 ATGAATGACAAGCTGCAGAGCGG - Intronic
1061866436 9:133493927-133493949 AGGGCTGACCAGTTCCAGAGGGG + Intergenic
1061912276 9:133731542-133731564 GTGGATGCCCAGTTGGGGAGGGG - Intronic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1186805870 X:13139600-13139622 CAGGATGACCAGCTGCATAGAGG + Intergenic
1187158873 X:16746023-16746045 CTGGAAGAACACTTCCAGAGTGG - Intronic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189360220 X:40344123-40344145 CAGGAGGATCAGCTGCAGAGAGG + Intergenic
1189536590 X:41941315-41941337 CTTGCTGTCCAGTTGCAGGGAGG + Intergenic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190444843 X:50514513-50514535 TGGGATGACCAGATGCAGAGAGG - Intergenic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190620659 X:52284422-52284444 CAGGACGACCAGTTGCAGAGGGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1194379399 X:93175464-93175486 TGGGATGACCAGTTGCAGCAAGG + Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195173000 X:102286852-102286874 ATGGCTGACCAGATGCAGACAGG - Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195179045 X:102339338-102339360 CAGGCTGAACAGCTGCAGAGAGG - Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195185866 X:102400243-102400265 ATGGCTGACCAGATGCAGACAGG + Intronic
1195454240 X:105050906-105050928 CTGGATGACCAGCTGCACAAAGG - Intronic
1197134138 X:123041431-123041453 AAGGATCAGCAGTTGCAGAGGGG + Intergenic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1197378446 X:125710117-125710139 ATGGATGACCAGCTGTGGAGAGG + Intergenic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1197744555 X:129922952-129922974 CTAGATGGCCAGTTGTTGAGGGG - Intronic
1197795959 X:130299228-130299250 TGGAATGACCAGTGGCAGAGAGG - Intergenic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1198699439 X:139381995-139382017 GGGGATGACCAGCTACAGAGAGG - Intergenic
1198699450 X:139382068-139382090 GGGGATGACCAGCTGTAGAGAGG - Intergenic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199858855 X:151781605-151781627 CAGGGAGACCAGTTACAGAGTGG - Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1199946097 X:152669419-152669441 GTGGATGACAAGTTGTACAGTGG - Intergenic
1201935381 Y:19406314-19406336 CCACATGACCAGCTGCAGAGAGG - Intergenic