ID: 1004536677

View in Genome Browser
Species Human (GRCh38)
Location 6:16509868-16509890
Sequence GGCCACCCGTATGCCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004536677_1004536682 24 Left 1004536677 6:16509868-16509890 CCATCACAGGCATACGGGTGGCC 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1004536682 6:16509915-16509937 CTTTCCAGAATCTGCGTCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004536677 Original CRISPR GGCCACCCGTATGCCTGTGA TGG (reversed) Intronic
900753125 1:4412450-4412472 GGCCACCTGTCTCCATGTGAAGG + Intergenic
901217085 1:7560982-7561004 GGTGACTCGTATGACTGTGAAGG + Intronic
904946306 1:34201082-34201104 AGCCACCCTGAAGCCTGTGAGGG - Intronic
908501084 1:64744831-64744853 CGCCACCCGGACACCTGTGAGGG - Intergenic
918299393 1:183188868-183188890 AGCCACCAATATGCTTGTGAAGG + Intronic
918446650 1:184623607-184623629 GGACTCCAGTGTGCCTGTGAGGG + Exonic
922766993 1:228161249-228161271 TGCCTCCAGTCTGCCTGTGATGG - Intergenic
923433695 1:233948931-233948953 GGCCCCCTGTAAGGCTGTGAGGG - Intronic
924432299 1:244007508-244007530 GACCACCTGCATGACTGTGAGGG + Intergenic
1069636146 10:69926065-69926087 GGCCACCTGGATGCCAGTAATGG - Intronic
1074186367 10:111102482-111102504 GGCCACCTGAATGCCTGGCAGGG - Intergenic
1076292724 10:129360234-129360256 AGCCACCCGAACCCCTGTGAGGG + Intergenic
1076503734 10:130957663-130957685 GGCCACCCGAATGTCTGGGCAGG - Intergenic
1077471281 11:2761834-2761856 GGCCGGCTGTTTGCCTGTGAAGG + Intronic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1088598606 11:111457205-111457227 GGGCACCTTGATGCCTGTGACGG - Intronic
1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG + Intronic
1102219058 12:111182135-111182157 GCCCTCCCGAATGACTGTGATGG + Intronic
1109191362 13:59327781-59327803 GGCCACCATTATGACTGTGATGG + Intergenic
1109209127 13:59514363-59514385 TGCCTCCCATATGCCTCTGAAGG - Intergenic
1118998604 14:70860500-70860522 GGGCAACCTTATGCCTTTGATGG - Intergenic
1126174938 15:45727526-45727548 GGCCACAGGTTTACCTGTGATGG - Intergenic
1126962913 15:54018093-54018115 TGCCACCCATATGCCTCTGAAGG + Intronic
1129327664 15:74809690-74809712 GTCCACCAGTGTGGCTGTGAAGG + Intergenic
1132808686 16:1787527-1787549 GGCCTCCCGAGAGCCTGTGATGG + Intronic
1132859730 16:2064250-2064272 GGCCTCCCTTGTGCCTGTGCAGG + Exonic
1133989484 16:10693533-10693555 GGGCACCTGTATGTCTGTGTGGG - Intronic
1137665372 16:50246296-50246318 GGCCACCCGCCCGCCTGTGTGGG - Intronic
1150294646 17:64001418-64001440 GGCCACCCCTGGGCCTCTGATGG + Intronic
1153354677 18:4122125-4122147 GGCAAACCCTATGCCTGTGATGG + Intronic
1160388215 18:78510821-78510843 GACTCCCCGCATGCCTGTGAGGG - Intergenic
1163129802 19:15265353-15265375 GGCCACCCCACAGCCTGTGAAGG - Exonic
1163758744 19:19121575-19121597 GGCCAGCCGCAGGCCTGGGAAGG + Exonic
1165161673 19:33820309-33820331 GGCTCCCCGGAGGCCTGTGATGG - Intergenic
1166887575 19:45971527-45971549 GACCCCCTGGATGCCTGTGAGGG - Intronic
926039866 2:9664355-9664377 GACCCCCCGTATCCCTGTCAAGG - Intergenic
927653951 2:24929663-24929685 GGCAACCCATATGTCTGTGATGG - Intergenic
1173392603 20:42648383-42648405 GGCCAACTGTGTTCCTGTGATGG - Intronic
1175419694 20:58823457-58823479 GGCCATCTGTATGCCTGTGACGG + Intergenic
1176139854 20:63540194-63540216 GGCCGCCAGTGTGTCTGTGAGGG + Intergenic
1176244314 20:64090213-64090235 GTTCACCCGTATGCCTGTCTGGG + Intronic
1182071193 22:27464926-27464948 TGCCACCTGAATGCCTGTGGTGG - Intergenic
1184889679 22:47372094-47372116 GGCCACCCACATGCCTGTTTGGG - Intergenic
950481059 3:13244044-13244066 GGCCACCCCTCTGCCTGAAATGG - Intergenic
951422844 3:22508534-22508556 GGCCACACTTCTGTCTGTGAGGG + Intergenic
952852217 3:37738739-37738761 GGCAGCCTGTATGCCTGGGAAGG + Intronic
957397247 3:79658221-79658243 GCCCACCCGTATGTCAGTGGTGG + Intronic
957866989 3:86038561-86038583 GGCCATGCACATGCCTGTGAGGG - Intronic
967086504 3:186099498-186099520 GGGCAGCCGTATGCCCGAGAGGG + Intronic
973636424 4:52865481-52865503 GGGCACCCGGCTGCCTGTGGTGG + Exonic
977753466 4:100636149-100636171 GGCCACCACTATGACTGTGCTGG - Intronic
979348639 4:119620008-119620030 GGCCACCCCCATCCATGTGATGG - Intronic
985923429 5:2997090-2997112 GGTCAACAGAATGCCTGTGAGGG - Intergenic
987148615 5:15016975-15016997 GGACACCTGGGTGCCTGTGAAGG - Intergenic
999017168 5:148119611-148119633 GGCCACCCTTAAGCCAGTGATGG + Intronic
1001851944 5:174975562-174975584 GGCCAACCATATTCCTGTAAAGG - Intergenic
1004536677 6:16509868-16509890 GGCCACCCGTATGCCTGTGATGG - Intronic
1007662709 6:43496427-43496449 GCCCACCCGGATTCCTGTGCAGG + Intronic
1019932760 7:4234614-4234636 AGCCCCCCATGTGCCTGTGAGGG + Intronic
1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG + Intergenic
1030895834 7:115058781-115058803 GGACCCCCTTAAGCCTGTGAGGG + Intergenic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1050296975 9:4215278-4215300 GGCCACAGTTTTGCCTGTGAGGG + Intronic
1051710252 9:19924095-19924117 TGCCACCGTCATGCCTGTGAGGG + Intergenic
1053489567 9:38488666-38488688 GGGCACCTCTCTGCCTGTGAGGG - Intergenic
1057293909 9:93824538-93824560 GGCCACCCACCTGCCGGTGAGGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1193649174 X:84109301-84109323 AGCCCCCCATAGGCCTGTGATGG + Intronic
1200039717 X:153356153-153356175 GGCCACCCAGAGGCCTGGGAGGG - Intronic
1200235976 X:154467882-154467904 GGCCACCAGCACGGCTGTGATGG - Exonic