ID: 1004540386

View in Genome Browser
Species Human (GRCh38)
Location 6:16544249-16544271
Sequence CTGTGGGAACAATGCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004540386_1004540398 24 Left 1004540386 6:16544249-16544271 CCTTCCTTGCATTGTTCCCACAG 0: 1
1: 0
2: 3
3: 18
4: 228
Right 1004540398 6:16544296-16544318 GGCTGGCCAAGTTGTGGCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 129
1004540386_1004540393 7 Left 1004540386 6:16544249-16544271 CCTTCCTTGCATTGTTCCCACAG 0: 1
1: 0
2: 3
3: 18
4: 228
Right 1004540393 6:16544279-16544301 AGCCAGCTGTCCAGGCCGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 247
1004540386_1004540392 3 Left 1004540386 6:16544249-16544271 CCTTCCTTGCATTGTTCCCACAG 0: 1
1: 0
2: 3
3: 18
4: 228
Right 1004540392 6:16544275-16544297 CCAGAGCCAGCTGTCCAGGCCGG 0: 1
1: 1
2: 2
3: 41
4: 558
1004540386_1004540390 -1 Left 1004540386 6:16544249-16544271 CCTTCCTTGCATTGTTCCCACAG 0: 1
1: 0
2: 3
3: 18
4: 228
Right 1004540390 6:16544271-16544293 GTAACCAGAGCCAGCTGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 159
1004540386_1004540396 18 Left 1004540386 6:16544249-16544271 CCTTCCTTGCATTGTTCCCACAG 0: 1
1: 0
2: 3
3: 18
4: 228
Right 1004540396 6:16544290-16544312 CAGGCCGGCTGGCCAAGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004540386 Original CRISPR CTGTGGGAACAATGCAAGGA AGG (reversed) Intronic
900387569 1:2417510-2417532 CTGTGGGTACTAGGCAAGGCCGG + Intergenic
900549797 1:3248718-3248740 CTGTTTGGACAATGCAAGGCTGG - Intronic
900587040 1:3437648-3437670 TTCTAGGAAGAATGCAAGGATGG - Exonic
902689573 1:18101809-18101831 CTGTTGGATAAATGCAAGGAAGG - Intergenic
905834477 1:41105795-41105817 TTTTGGCAACAATGAAAGGACGG - Intronic
906463258 1:46053952-46053974 CTTTGTAAACAAGGCAAGGAGGG - Intronic
906717218 1:47979176-47979198 ATGTGGGAACAATGCGGGAAGGG + Intronic
907167528 1:52427684-52427706 CTTTTGGAACAATGCAAGTAAGG - Intronic
907391392 1:54160650-54160672 CAGTGGGAAGAAAGTAAGGAGGG + Intronic
907878873 1:58523949-58523971 CTTTAGGAACAAAGCATGGATGG + Intronic
911260323 1:95678250-95678272 CTGTGGATGCAATGAAAGGATGG - Intergenic
911362667 1:96898393-96898415 CTCTGGGAAACATGCAAGGCTGG - Intergenic
914418023 1:147502568-147502590 CTATGGGAATAAGGTAAGGAAGG + Intergenic
915267860 1:154731689-154731711 CTGAGGGATCACTGCAAGGAAGG + Intronic
916122648 1:161542530-161542552 CAGTGGGACCAATGAAAGCATGG - Exonic
916132547 1:161623968-161623990 CAGTGGGACCAATGAAAGCATGG - Exonic
917502441 1:175598118-175598140 CTGTTTGACTAATGCAAGGACGG - Intronic
918091628 1:181300144-181300166 CTAAGGGAACAGTGCAGGGATGG + Intergenic
919233952 1:194813566-194813588 CTGTCAGAACAATGTAAAGAAGG + Intergenic
920296287 1:204959209-204959231 GTGTGGGGACACTGCAAGGCAGG - Intronic
920404282 1:205697381-205697403 GAGTGGGAACAAGGAAAGGAGGG + Intergenic
920738764 1:208560232-208560254 CTGTGGGAAGGAGGCAGGGAGGG - Intergenic
922890174 1:229055784-229055806 CTGTAGGAACCATGCTTGGAAGG - Intergenic
923217274 1:231859902-231859924 CTGCTGGAACAATACATGGATGG - Intronic
923288790 1:232524032-232524054 ATATGGGAACAGTGCAAAGATGG - Intronic
1063900786 10:10730572-10730594 ATGTGGGAACATTGCACAGATGG + Intergenic
1064821715 10:19343303-19343325 CTGAGGGAAAAATGCATGAAGGG - Intronic
1064961404 10:20968601-20968623 CAGTGAGAACTATGCAAGGACGG + Intronic
1065229769 10:23585840-23585862 ATGTGTGAACAATCCAATGATGG + Intergenic
1067831322 10:49612634-49612656 CACTGGGAGCAATGGAAGGAAGG - Exonic
1069733602 10:70635973-70635995 CTTTGGAAAGGATGCAAGGATGG + Intergenic
1070663925 10:78330132-78330154 CTTTGGGAAAAAAGCCAGGAGGG - Intergenic
1071003061 10:80853036-80853058 CTGTGGGAATTGGGCAAGGATGG - Intergenic
1071329182 10:84543543-84543565 TTGTGGGAGCAGGGCAAGGAGGG - Intergenic
1072198773 10:93140203-93140225 CGGGGGGAACAATGGCAGGATGG - Intergenic
1072953667 10:99870291-99870313 CTGTGGGTACAACCCATGGAGGG - Intergenic
1073669641 10:105573558-105573580 CAATGGGAACAATACAATGAGGG + Intergenic
1073680242 10:105695406-105695428 CTATGAGAAAAATGAAAGGATGG + Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1075442911 10:122493887-122493909 CTGTGGGAAGCAACCAAGGAAGG - Intronic
1075815430 10:125261265-125261287 GTGTGTGAACAAAGCCAGGAAGG + Intergenic
1075843079 10:125521122-125521144 ATGTGGGAAAATTCCAAGGAAGG - Intergenic
1075900870 10:126041936-126041958 CTGCAGAAACAGTGCAAGGAAGG - Intronic
1076521674 10:131085120-131085142 CTGTGGGGACACAGCCAGGAGGG + Intergenic
1076662356 10:132064299-132064321 CTGGGGAAACAACACAAGGATGG - Intergenic
1076865170 10:133163007-133163029 CTGTGGGGGTGATGCAAGGAGGG + Intronic
1078993997 11:16678604-16678626 CAGTGGGTACAACCCAAGGATGG + Intronic
1079372957 11:19867675-19867697 CTATGCTAAAAATGCAAGGATGG + Intronic
1081041547 11:38220644-38220666 TTGTGGGAACCATGTGAGGATGG - Intergenic
1083620893 11:64048878-64048900 CTGTGGGGACAGGGCAAGGGCGG - Intronic
1083767681 11:64849689-64849711 TTGTTGGAACACTGCAGGGAAGG - Intergenic
1085313303 11:75528752-75528774 CGGTGAGAAGAATGTAAGGAAGG - Intergenic
1086547274 11:88012417-88012439 CGGTGGGAACCAAGCACGGAAGG + Intergenic
1086864105 11:91959409-91959431 CTGTGGGATAAAGCCAAGGATGG - Intergenic
1087211329 11:95448383-95448405 CTCTGCCAACAATCCAAGGAAGG + Intergenic
1088511662 11:110581901-110581923 CTGAGGGACCAGTACAAGGAAGG + Intronic
1089828515 11:121302349-121302371 TTGTGCGAACAATGCAATGAGGG + Intronic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090390853 11:126386361-126386383 CTGTGGGCCGAATGCAAGCAGGG - Intronic
1091875843 12:3932072-3932094 GTGGGGGAACAAGGGAAGGAGGG + Intergenic
1092219243 12:6701335-6701357 CTGTGGGGATAATCCAAAGATGG - Intergenic
1094002985 12:25716272-25716294 CTGTGGGAGGAATGAAAGGCAGG + Intergenic
1095127110 12:38492832-38492854 CTATGGGAAAAATGTAGGGAAGG + Intergenic
1095631676 12:44384156-44384178 GTGTGGGAAAAATGGAAAGATGG + Intronic
1096421661 12:51463942-51463964 CAGAGGGAACAATGGTAGGAAGG - Intronic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097906346 12:64923366-64923388 ATGGGAGAAGAATGCAAGGAAGG - Intergenic
1098701112 12:73628005-73628027 CTATGGGAAAAATGACAGGATGG - Intergenic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1100103037 12:91133199-91133221 CAGTGGGAAGTATGCATGGAAGG + Intergenic
1100490962 12:95077462-95077484 CTGTGTGAACAAAGAAAGGTTGG + Exonic
1101576908 12:106006275-106006297 TTGTGGGAAAAAAGCAAGGCTGG - Intergenic
1102587479 12:113933326-113933348 CTTCAGGAACAATGCAAAGAGGG + Intronic
1106118644 13:26838776-26838798 CTCTGGGAACACAGCAAGCAGGG - Intergenic
1106619101 13:31356659-31356681 CTGTGGGCCCAATGCAACAACGG - Intergenic
1108401766 13:50052138-50052160 CTTTGGGAACAAAGCATTGATGG - Intergenic
1109486831 13:63034742-63034764 CTTTGGGTACAATTTAAGGAGGG + Intergenic
1110158229 13:72343758-72343780 CTGAAGGAACAAAGCAAGCAGGG - Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1111720175 13:91933662-91933684 GTGTGCAAACAATGAAAGGAAGG - Intronic
1112169634 13:96957545-96957567 CTGTGGGAAGAATGGAAGTCAGG - Intergenic
1112844873 13:103629096-103629118 CTGTGGCAATAATCCAAGGAGGG - Intergenic
1113120971 13:106923649-106923671 CTGTAGGAAGAATGCATGGGAGG + Intergenic
1117072380 14:52068732-52068754 CTGCGGGAAAAGTGCCAGGAGGG + Intronic
1117482022 14:56156428-56156450 TTGTTGGAATAATGCCAGGAGGG - Intronic
1120076928 14:80169509-80169531 GTGGGGGAACAATGCCAGAATGG - Intergenic
1121827571 14:97022937-97022959 CTGTGGCCACAAGCCAAGGAGGG - Intergenic
1121990914 14:98556355-98556377 CTGTTTGTACAATGCAAAGATGG - Intergenic
1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG + Intronic
1126228383 15:46297075-46297097 CTGTGGGAACATTGCAAGTTAGG - Intergenic
1128131280 15:65228649-65228671 CTGAGGGCACACTGAAAGGAGGG + Intergenic
1128725872 15:69988292-69988314 CTGTGAGAACACTTCAAAGATGG - Intergenic
1128890737 15:71329727-71329749 CTGTGGTAACAATAAAATGAAGG + Intronic
1129862732 15:78875225-78875247 CTGTGGGAACAACCTAAGGATGG + Intronic
1129904854 15:79179283-79179305 CTGAGGGAACAAGGCCCGGAGGG - Intergenic
1130144798 15:81265797-81265819 CTGCGGTAAGAATGGAAGGAGGG + Exonic
1130196108 15:81781730-81781752 CTTTGGGAGCTTTGCAAGGATGG + Intergenic
1130369076 15:83268147-83268169 CAGTGTGACCAATGCAAGCATGG - Exonic
1132136587 15:99347144-99347166 ATGTGGGAAGAAGGTAAGGATGG - Intronic
1134080268 16:11319989-11320011 CTGTGGGGGCAGTGCAAGGAGGG + Intronic
1134636332 16:15794735-15794757 CTGTGGGAAGGATGGAGGGAAGG + Intronic
1134832031 16:17331435-17331457 CTGTGGAAACAGTACATGGAAGG + Intronic
1136342713 16:29655421-29655443 CTATGGGGAGAAAGCAAGGAGGG + Intergenic
1137433008 16:48433617-48433639 CTGTGTGGACAACGCAAGGAAGG - Intronic
1137789306 16:51161494-51161516 ATGTGGGAACAAAGCTAGGGTGG + Intergenic
1138373706 16:56547875-56547897 CTCTGTGAACAATGCAGGGATGG - Intergenic
1139374421 16:66487846-66487868 CTTTGGGAACAGTGCAGGCAGGG - Intronic
1141402915 16:83766483-83766505 CTGTGTGAACAATGAAATGTAGG - Intronic
1141530351 16:84642174-84642196 CTGCGGCAACAATGCTGGGAGGG + Intergenic
1142908791 17:3069419-3069441 CTGGGGGAATATTCCAAGGATGG - Intergenic
1142925776 17:3234826-3234848 CTGGGGGAATATTCCAAGGATGG + Intergenic
1143680393 17:8471923-8471945 CTCTGGGAGGAATGCAAGAAAGG - Intronic
1145964242 17:28905678-28905700 GGGTGGGAACCATGGAAGGAAGG + Exonic
1147043050 17:37732511-37732533 CTGTGGGAAGAATGCAGCCAGGG - Intronic
1147121320 17:38336968-38336990 CCGCCGGAACAAGGCAAGGAAGG - Exonic
1147726656 17:42569786-42569808 CTGTTGGATTAATGTAAGGAAGG + Intronic
1147895349 17:43747350-43747372 CTTTGGAAACAATCCATGGAGGG + Intergenic
1148385462 17:47231289-47231311 CTGTGAGAACAAAGCCAAGAAGG + Intergenic
1149134885 17:53352628-53352650 CTTTGGGAAGAATTCAAGTAAGG - Intergenic
1149665729 17:58363688-58363710 CTGTGGGCATAATCCTAGGAAGG - Intronic
1149673989 17:58442400-58442422 GACTGGGAACAAGGCAAGGATGG - Intronic
1151961385 17:77407761-77407783 CTGTGGGAGGACAGCAAGGAGGG - Intronic
1152938877 17:83155272-83155294 GTGAGGGAACAATGGAAGGTTGG - Intergenic
1154177615 18:12094922-12094944 ATGTGGGTACGATGCAAGGGTGG + Intronic
1159503183 18:69299813-69299835 CTGTGAAAACAATGAAAGAAAGG - Intergenic
1159654981 18:71022558-71022580 AGGTTGGAACAATTCAAGGAAGG - Intergenic
1168330101 19:55563204-55563226 CTGTGGGCACAATTCTAAGAGGG - Intergenic
927852402 2:26508227-26508249 CTGTTTGAGCAATGCAAAGAAGG - Intronic
928229223 2:29482029-29482051 CTGTGGTCACAAGGCAAGAAGGG - Intronic
928457274 2:31433805-31433827 CTGAGGGACCAATGAGAGGAGGG + Intergenic
929108197 2:38384365-38384387 CTGTGGGGAAAATGAAAAGATGG - Intergenic
929533906 2:42768685-42768707 GTGTGGGAACAAGGCTGGGAGGG - Intronic
932465842 2:71923570-71923592 CAAAGGGAACAACGCAAGGAAGG - Intergenic
932944012 2:76205844-76205866 CTTTAGGGACAATACAAGGAGGG - Intergenic
935156285 2:100486401-100486423 ATGTGTGTTCAATGCAAGGAGGG + Intergenic
935965050 2:108464721-108464743 CTATGGGAAAAATGGAAGGATGG + Intronic
936060796 2:109294619-109294641 CAGATGGAAGAATGCAAGGATGG - Intronic
936096893 2:109537108-109537130 CTTTGGGAACAAGGCAAGGATGG - Intergenic
936224670 2:110637290-110637312 CTAAGGGAACAAGGGAAGGAGGG + Intergenic
942186486 2:173429251-173429273 ATGTGGGAACGAAGGAAGGAAGG - Intergenic
944937293 2:204582637-204582659 GAGTGGGAGAAATGCAAGGAGGG - Intronic
948015265 2:234684227-234684249 CTCTGGGAACAAAGAAAGGCAGG + Intergenic
1169273466 20:4217786-4217808 GTGTGGGAAGAAAGCAAGGTGGG + Intergenic
1170580813 20:17698249-17698271 GAGTGGGAACAAGGCAAGGGAGG - Intronic
1173028636 20:39333600-39333622 CTGTGGAATGAATGCAAAGATGG + Intergenic
1174357658 20:50009442-50009464 CGGGGGGAATAATGCAGGGAAGG - Intergenic
1174842373 20:53912245-53912267 CTGTGGCAACACTGCGAGGTTGG - Intergenic
1175057892 20:56214683-56214705 CTGTCGGAACAATGCTAGGATGG + Intergenic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1179403039 21:41102174-41102196 GTGTGGGATCAATGCAAAGGAGG + Intergenic
1180224160 21:46379813-46379835 CTGAGGGCACAATGCACGCAGGG - Intronic
1182115460 22:27753825-27753847 CGCTGGGAACAAGGCAAGCATGG - Intronic
1182868649 22:33627011-33627033 GTGAGGGAACAATGCCAAGAGGG + Intronic
1184291183 22:43498892-43498914 CTGTGGGAATGAGGAAAGGAAGG - Intronic
1185219773 22:49623500-49623522 CTGTGGGGAGAAGGCCAGGACGG - Intronic
949370895 3:3333752-3333774 CTGTGGGATCACTGCAGGCAGGG - Intergenic
949488709 3:4566718-4566740 GTATGGGAACAATGAAGGGAAGG - Intronic
951610735 3:24490448-24490470 CTGTTGGAAGAATGAATGGAAGG - Intronic
951832081 3:26942452-26942474 CAGTGGGTCCAATGCATGGAGGG + Intergenic
954715017 3:52522648-52522670 CTGAGGGAATGAAGCAAGGACGG - Exonic
957620460 3:82586116-82586138 CTGTGGGGAAAATGAAAAGATGG - Intergenic
960519362 3:118637332-118637354 CCCTGGGAAAAATGCAAGTAAGG - Intergenic
963108372 3:141665476-141665498 CTGTAGGAAGAAAGGAAGGAAGG + Intergenic
965232002 3:166066129-166066151 CTGTGGGGACAATGCATGAGAGG + Intergenic
967538336 3:190633931-190633953 ATTTGGAAACAATGCAAAGATGG - Intronic
968913978 4:3489211-3489233 CGGTGGGGACACTGCAAGGTGGG + Intronic
973993660 4:56435892-56435914 CTGGGGGAAGCATGCAGGGAAGG - Intronic
974095203 4:57356051-57356073 CTGTGGGAGGAAGGAAAGGAGGG - Intergenic
977641542 4:99362941-99362963 CTGTGAGAATAAGGCAAGGCTGG - Intergenic
979001283 4:115223466-115223488 CTGTGGGGATAATGCCATGAGGG + Intergenic
979101083 4:116615410-116615432 ATGAGGGAACAAAGGAAGGAAGG + Intergenic
981218712 4:142205363-142205385 CTGATGGAATAAGGCAAGGAGGG - Intronic
981601261 4:146491634-146491656 CTGTGTGAAGAAAGAAAGGAAGG + Intronic
984491146 4:180436634-180436656 CTCTGGGAACAATTTCAGGAAGG + Intergenic
985285464 4:188332335-188332357 ATGTGGGAACACAGCTAGGAGGG + Intergenic
987139877 5:14934220-14934242 CTGAGGGGAAAATGCAAAGAGGG - Intergenic
989106953 5:37871928-37871950 GTCTGGGAACAATGGGAGGAAGG - Intergenic
989704793 5:44316121-44316143 TACTGTGAACAATGCAAGGAAGG + Intronic
993841592 5:92886710-92886732 CAGTGGGAAGTATGCAGGGAAGG - Intergenic
995903303 5:117094205-117094227 CTGGGGGCACACTGCAGGGAAGG - Intergenic
999252171 5:150189272-150189294 CTGAGGCAACAATGCATGGGCGG + Intergenic
999319622 5:150605465-150605487 ATGTGGCAACAAGGCAGGGATGG + Intronic
1000871092 5:166578631-166578653 CTGGGGAAACAATGCCAGGGCGG + Intergenic
1001545811 5:172569977-172569999 CTGAGGGAACTATTCAAGGCAGG + Intergenic
1003162677 6:3649837-3649859 ATGTGCAAACAAAGCAAGGAAGG - Intergenic
1003455097 6:6274867-6274889 CTGAGGGAATAAGGAAAGGATGG + Intronic
1003699848 6:8450109-8450131 CATTGGAAACAATGCAAGCAAGG - Intergenic
1003811495 6:9787933-9787955 CTGTGGGAGATGTGCAAGGAAGG - Intronic
1004162404 6:13226265-13226287 CTTTGCAAACAATGGAAGGAAGG + Intronic
1004540386 6:16544249-16544271 CTGTGGGAACAATGCAAGGAAGG - Intronic
1006093366 6:31641229-31641251 CTGTGGGCAAAATACAAGGAGGG + Intronic
1006512321 6:34528409-34528431 CTGTGAGAAGAATGCAGCGAGGG + Intronic
1006707937 6:36038097-36038119 CTGTGGAGAAAATGCAAGAAGGG + Intronic
1008145355 6:47885226-47885248 CTGGGAGAAAAATTCAAGGAGGG + Intronic
1009950439 6:70389188-70389210 CTGTGGGAATAATAGAAGAAAGG + Intergenic
1010387006 6:75291613-75291635 TTGTGGGAATAAAGCAGGGAGGG + Intergenic
1012090330 6:94885669-94885691 GGGTGGGGACAAGGCAAGGATGG - Intergenic
1012193032 6:96303989-96304011 CTGTGAAAACACTGAAAGGAAGG + Intergenic
1012871968 6:104683293-104683315 CTCTGGGGACAATGAAGGGAGGG + Intergenic
1013857591 6:114592637-114592659 CTGTGTGAACAAGTCTAGGATGG + Intergenic
1015882001 6:137879165-137879187 CTGTGGCAAGAATGCGGGGAGGG - Exonic
1016045524 6:139476851-139476873 CTGGGGGAACAAAGCAAATAGGG + Intergenic
1017947215 6:159105305-159105327 CTGTGGGAACAAACAAAGCAGGG + Intergenic
1017953386 6:159157583-159157605 CACTGAGACCAATGCAAGGAAGG - Intergenic
1019565692 7:1677974-1677996 CTGTGGGGACAATGTAATGAAGG - Intergenic
1019981822 7:4627312-4627334 CTATGGGAACAAGGCACAGATGG + Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1021405769 7:20265677-20265699 TTGTGGGAGCGATGGAAGGAAGG + Intergenic
1022408907 7:30121049-30121071 CTGTGGGAAAAATGTAACAATGG + Intronic
1030301022 7:107975061-107975083 CTCTGGGAACAATTCCTGGAGGG - Exonic
1031241905 7:119256226-119256248 CTTTGGGAACAATGTAGTGATGG + Intergenic
1031769079 7:125820405-125820427 TTGTGGTAAGAAAGCAAGGAAGG + Intergenic
1032018244 7:128393029-128393051 CTGTGGGGACAAGGCAAGAGGGG + Intronic
1034516472 7:151584614-151584636 TTGAGGAAAGAATGCAAGGAAGG + Intronic
1036119901 8:6004492-6004514 CTTTGGGAAAGGTGCAAGGAAGG - Intergenic
1037945333 8:22986112-22986134 GGGAGGGAACACTGCAAGGACGG + Intronic
1037954479 8:23043244-23043266 CTGTGGGGACAAAGCAGGGATGG + Intronic
1037968655 8:23154980-23155002 CTGTGGGGACAAGGCAGAGATGG + Intronic
1038950409 8:32408293-32408315 CTGAGGGAACAGGGCAAAGAGGG - Intronic
1039327723 8:36503409-36503431 AGATGGGAACAAAGCAAGGATGG + Intergenic
1040567321 8:48579407-48579429 CTGTGAGAACATTGCATGAATGG + Intergenic
1042497860 8:69475447-69475469 CAGTGGGAATAAGGAAAGGATGG + Intronic
1043447984 8:80338117-80338139 ATTGGGGAACAAAGCAAGGAAGG + Intergenic
1045388826 8:101694973-101694995 CTGTGGGAGCAAAGCAAGCTGGG - Intronic
1046767476 8:118085254-118085276 CCATGGGAACAATGGGAGGAAGG + Intronic
1046823684 8:118663285-118663307 CTATCGGAACAAAGCCAGGAAGG + Intergenic
1047878971 8:129171467-129171489 CTGTGGCAAGAAGGCAGGGAGGG + Intergenic
1048538276 8:135317905-135317927 CTGTGAGAACAGTGGATGGAAGG - Intergenic
1048999064 8:139813304-139813326 GTGTGGGGACAGTGCAAGAAGGG + Intronic
1050130951 9:2411954-2411976 CTGTGGTGACAATGCAAAGATGG + Intergenic
1051070266 9:13157595-13157617 CTGTGGTAACAAGGCTATGAGGG + Intronic
1056485919 9:87058134-87058156 GTGTGGGAGCAATGCAGAGAGGG + Intergenic
1057320693 9:94010026-94010048 ATGTGGGCACAAAGCAAGGGTGG + Intergenic
1058905683 9:109480885-109480907 CTGTGGGATGAATGGATGGATGG + Intronic
1060473231 9:123965902-123965924 CTGTGGGACCAAGGCAAGGAAGG - Intergenic
1061227797 9:129290849-129290871 CTGTGCCAACATTCCAAGGAGGG - Intergenic
1061594832 9:131622054-131622076 CTGTGGGAAGAATGGGGGGAGGG - Intronic
1186320357 X:8417579-8417601 CTGTGGAAAGAATCCATGGAGGG + Intergenic
1186417932 X:9399783-9399805 TTGTGGGATTATTGCAAGGATGG + Intergenic
1187213685 X:17254150-17254172 CCCTGGGAACAGTGCAAAGAAGG + Intergenic
1187451456 X:19400437-19400459 CTCTGGGAACCATGCAGTGATGG + Intronic
1188206133 X:27360647-27360669 CTGGGGCAATAATGCAAGAATGG + Intergenic
1192338362 X:70240416-70240438 CTGTGGCAAGAAGGCAAAGAAGG - Exonic
1195900876 X:109796003-109796025 CTGAGGGAACATGACAAGGAAGG + Intergenic
1196554887 X:117074690-117074712 CTTTTGAAATAATGCAAGGAGGG - Intergenic
1197103357 X:122683738-122683760 ATGTTGGAATAATTCAAGGATGG - Intergenic
1199417252 X:147599522-147599544 CTGTGAGGACACTGCAAGAAGGG + Intergenic
1199725857 X:150580059-150580081 GAGTGGGAACAAGGCAAGGACGG - Intronic
1200214490 X:154361571-154361593 CTGTGGAAACGATGAAAGGAAGG + Intronic