ID: 1004543460

View in Genome Browser
Species Human (GRCh38)
Location 6:16573759-16573781
Sequence CAGGGACAAAAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 410}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004543460 Original CRISPR CAGGGACAAAAGCATGAGGA AGG (reversed) Intronic
900711878 1:4119590-4119612 CAGGGAGACAGGCAGGAGGAGGG + Intergenic
901049691 1:6420001-6420023 CAGGAACAAAGGCAGGAGGTGGG - Intronic
901674494 1:10875043-10875065 CAGGGACAAGAGCACAGGGAAGG - Intergenic
901747765 1:11385836-11385858 CAGAGCCAAAAGCTGGAGGAAGG - Intergenic
901759118 1:11459255-11459277 CATGGACACAGGCGTGAGGAAGG + Intergenic
901875201 1:12163568-12163590 CATGGACAAAAGCATGGAGGTGG + Intergenic
902091766 1:13909373-13909395 CAGGGGCAAGAGGGTGAGGAGGG + Intergenic
902412813 1:16221304-16221326 CATGGTTAAAAGCATGTGGATGG + Intergenic
902614507 1:17616444-17616466 CCGTGACAAAAGCAGGAGCAGGG - Intronic
904621301 1:31776902-31776924 GAGGGACAACAGCATGGGGAAGG + Intergenic
905610967 1:39351112-39351134 CATGCACAGAATCATGAGGAAGG + Intronic
905935123 1:41817377-41817399 CAGGGAAAAAAGGATGGGGCCGG + Intronic
906288088 1:44601440-44601462 GATGGAGGAAAGCATGAGGAAGG + Intronic
906733758 1:48104985-48105007 CAGGGAGAAAAGGAAGGGGAGGG + Intergenic
907062675 1:51446787-51446809 AATGGACAAAAGCTTGAGAATGG - Intronic
907309644 1:53531953-53531975 CAGGCACCAAAGCATGAAAAAGG + Intronic
907323914 1:53623555-53623577 AAAGGAAAAAAGCATGAAGATGG + Intronic
907572150 1:55493168-55493190 AAGGGAGGAAAGCAGGAGGAGGG - Intergenic
907574076 1:55510117-55510139 CAGGGACAGAAGGGTGGGGAAGG - Intergenic
908737772 1:67293695-67293717 CAGGCACAAAAGATTGTGGAAGG - Intergenic
909263662 1:73527760-73527782 CAGGGACTAAAGAAAGATGATGG + Intergenic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
910097678 1:83542249-83542271 CAGGAACAAAAGGAAGAGGTTGG + Intergenic
910673573 1:89796987-89797009 CAGGGACAAACCAATGAGGTAGG - Intronic
910705858 1:90128948-90128970 CAGGGACAGAAGAGTGAGAATGG - Intergenic
912336407 1:108866852-108866874 CAGGTAGAAAGGCAGGAGGAAGG - Intronic
912558814 1:110535543-110535565 CTGGGGCAAAAGGATGAGCAGGG + Intergenic
912841572 1:113043848-113043870 AAGGGACAAAGGCAAGAAGAAGG - Intergenic
913382149 1:118224170-118224192 CAAGGAGATAAGAATGAGGATGG + Intergenic
914266161 1:146040022-146040044 CAGGGAGAACAGCCTTAGGACGG + Intergenic
915399902 1:155614571-155614593 CAAGGACAAAGGCTGGAGGATGG - Exonic
915417060 1:155750435-155750457 CAAGGACAAAGGCTGGAGGATGG - Exonic
915880381 1:159664888-159664910 CAGGGACAAAGGGGTGAGGTAGG - Intergenic
916080532 1:161229319-161229341 CAGCCACAAGAGCATGGGGAAGG - Exonic
918619395 1:186584649-186584671 CAGGCAAGAAAGCATGTGGAGGG - Intergenic
919604936 1:199669969-199669991 CAGGGACAAGAACCAGAGGAAGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
920232689 1:204481053-204481075 CAGGGGGAAAAGTATGTGGAGGG - Intronic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
922533089 1:226359347-226359369 CAGGCACAAAGGCGGGAGGAGGG + Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
1063892015 10:10640324-10640346 CAGGAACAACAGCATGAAAAAGG - Intergenic
1066112097 10:32206700-32206722 CAAGGCCAAAAGCCAGAGGATGG - Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1068643514 10:59438381-59438403 CTGGGACTCAAGCAGGAGGAAGG + Intergenic
1070663025 10:78321302-78321324 CTAGGACAAAAGAATGGGGATGG + Intergenic
1071538446 10:86455526-86455548 CAGGGACACAAACACAAGGAAGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1073111404 10:101065087-101065109 TAGAGACAAAAGCTGGAGGAGGG + Exonic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1074307405 10:112291818-112291840 CAGAGACAAAAGCATTACCATGG - Intronic
1075417488 10:122275704-122275726 CAAGGAAAAAAGCACGAGGAGGG - Intronic
1076501992 10:130944428-130944450 GCGGGACAAAGGCATAAGGATGG - Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077047543 11:553063-553085 CAGGGACACAGGCATGAGTCCGG + Intronic
1077797863 11:5509830-5509852 CAGGGACAAAGGTAGAAGGAAGG + Intronic
1077805271 11:5584845-5584867 CAAGCACAAAAGCCTGAAGAAGG - Intronic
1078001374 11:7499361-7499383 CAGGAAGAAAAGGTTGAGGAAGG - Intronic
1078455279 11:11470090-11470112 CAGGGACACTTGGATGAGGATGG + Intronic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079500574 11:21097015-21097037 CAAGGTCAAGAGCATTAGGAAGG - Intronic
1079829159 11:25239719-25239741 CAGAGACAAAAGCATGGAGGTGG + Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080581935 11:33651473-33651495 GAGGCACAAAAGACTGAGGAGGG - Intronic
1080923995 11:36737276-36737298 CAGAGACAAAGGGAGGAGGAGGG - Intergenic
1081220567 11:40455319-40455341 CAGGGACACAGGAGTGAGGATGG - Intronic
1081305645 11:41508755-41508777 CAGGGAGAAGAGCACGAGAAAGG + Intergenic
1081618395 11:44603941-44603963 CAGGTGCAAAGGCCTGAGGAAGG - Intronic
1081738593 11:45422466-45422488 CAGGGCCAAAAGCCTGAGGGTGG + Intergenic
1081748786 11:45492611-45492633 CATGTACAAAGGCATGAGGTGGG + Intergenic
1082629847 11:55529103-55529125 CAAGGACAACAGCATGAGCAAGG - Intergenic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1083504850 11:63146816-63146838 CAGAGAAAAAAGCATTAGTAAGG + Intronic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083516974 11:63269034-63269056 CAGAGAAAAAAGCATTAGTAAGG + Intronic
1083706356 11:64518946-64518968 CAGGGACAACACCATAATGAGGG + Intergenic
1083872476 11:65497666-65497688 CAGGGACAAACGCCGGGGGAGGG - Intergenic
1085292819 11:75412112-75412134 CAGGTACAAAAGCACAAAGAGGG - Intronic
1085297816 11:75440929-75440951 CAGGGAGAAAAGCATCACTAAGG - Intronic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1087677649 11:101181206-101181228 CAGGAACATAAGAATGAAGAAGG + Intergenic
1089944521 11:122454445-122454467 CATGAACAAAAGCATGAAAATGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090997557 11:131880580-131880602 CAGGGACAGAAGCATGATAAAGG + Intronic
1093434898 12:19125653-19125675 AACGAACAAAAGCAGGAGGAAGG + Intergenic
1094267340 12:28574100-28574122 TAGGGATAAAAACTTGAGGAAGG + Intronic
1096272678 12:50178897-50178919 CAAGCACAAAAGCTTGATGATGG - Intronic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096908755 12:54961396-54961418 CAGGGACACAGTAATGAGGAAGG + Intronic
1097680795 12:62647259-62647281 CAGGGAGCACAGCATGAGAATGG + Exonic
1098442005 12:70528865-70528887 AAGGTGCAAAAGCAGGAGGAAGG + Intronic
1099113904 12:78599419-78599441 CAGGAACAAAAGCAGCATGAAGG - Intergenic
1099271072 12:80511951-80511973 CAGGGACAAAAGTGTTAGCAGGG + Intronic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1099833224 12:87872863-87872885 CAGAGACAAAAGCTTGAAAAGGG - Intergenic
1100043893 12:90355199-90355221 CAGGGAGAAAAGACTGAGAATGG + Intergenic
1101004399 12:100387543-100387565 CAGAGAGAAAGGCATGAGAAAGG + Intronic
1103430824 12:120884202-120884224 AGGGGACAGAGGCATGAGGAAGG + Intronic
1107739857 13:43438264-43438286 CAGGAAGACAAGCCTGAGGAGGG + Intronic
1107794254 13:44033875-44033897 CAGGAACCAAGGAATGAGGATGG + Intergenic
1108083333 13:46759905-46759927 CAGTCACAAAAGCCAGAGGAAGG + Intergenic
1108416420 13:50202225-50202247 CAAGGACAAAAGGATGAGTGAGG + Intronic
1109256521 13:60089895-60089917 CAGGCAAAAATGCATGTGGATGG + Intronic
1109955250 13:69557232-69557254 CAGAAACAAAAGCATGAAAATGG + Intergenic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111378088 13:87407491-87407513 CAGAGATAGAAGCATGAGAATGG - Intergenic
1112389829 13:98972849-98972871 CAGGCAGCAAGGCATGAGGAAGG - Intronic
1112843610 13:103610437-103610459 GAGGAACAAAAGGAGGAGGAAGG - Intergenic
1112899499 13:104341418-104341440 CAGGGACATAGGCATGGGCAAGG - Intergenic
1113074401 13:106453544-106453566 CGGGGAGAATAGCATGAGGGTGG + Intergenic
1113363400 13:109652772-109652794 CAGGGTTAAAAGCCTCAGGATGG + Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1114325901 14:21588362-21588384 CAGCGACAAAGGCAGGAGGTGGG + Intergenic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1115500921 14:34049077-34049099 TTGGGAGAAAAGCATCAGGATGG - Intronic
1115756976 14:36538250-36538272 CAGGGATCAAAGTTTGAGGAGGG - Intergenic
1115846429 14:37540617-37540639 TAAGGACAAAAGCAGAAGGAGGG - Intronic
1116416187 14:44680565-44680587 CAGAGACAGAAGGATGAGTAAGG - Intergenic
1117721583 14:58633963-58633985 AAGGGACAAAAGTCTGAGGCTGG + Intronic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1120183479 14:81368809-81368831 CTGGGACTAGAGAATGAGGAGGG - Intronic
1120483382 14:85080781-85080803 CAGGGACAAATACATGAAGTTGG - Intergenic
1120503878 14:85329785-85329807 CAGGAACAAGAGTGTGAGGAGGG + Intergenic
1122141198 14:99664101-99664123 CAAGGACAAAAGCAGGAGGCTGG - Intronic
1123951738 15:25285297-25285319 TAGGGAGAAAAGCATGGGAAGGG - Intergenic
1126790209 15:52214109-52214131 CAGTGACAGAAGCAGAAGGAGGG + Intronic
1127232114 15:57008063-57008085 AAGAGGCAAAAGCATGAGGATGG - Intronic
1127992789 15:64133151-64133173 CAGGCTCATAAGCATGAGGTAGG - Intronic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128235767 15:66066174-66066196 CAGGAACAAGATCATGAGCAGGG + Intronic
1128979399 15:72175546-72175568 CAGGTAGATAAGCATGAGAAGGG - Intronic
1129684410 15:77677041-77677063 CAAGCACAGAAGCATGAGGCAGG + Intronic
1129705378 15:77791230-77791252 GAGGGACAAGAGGATGAGGAGGG + Intronic
1129716630 15:77855876-77855898 CAGGGACCCAGGCATGTGGATGG - Intergenic
1129787339 15:78318649-78318671 AAGGGAGACTAGCATGAGGATGG + Intergenic
1131022745 15:89113208-89113230 CAGGGCCAAAAGCAAAAGGTAGG - Intronic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1131886130 15:96915122-96915144 CAGAGACTAAAGCGGGAGGATGG + Intergenic
1132725198 16:1335390-1335412 CTGGGACAGTAGCATGAGGCAGG - Intronic
1132903548 16:2271019-2271041 CTGGGACACAGGGATGAGGATGG + Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133284186 16:4682990-4683012 CAGCGACAGAAGCTGGAGGAGGG - Intronic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133958092 16:10464801-10464823 CAGCAACAAAAGAATGAGTAGGG - Intronic
1134182748 16:12061052-12061074 GAGGGACAAAGGCTTGGGGAAGG - Intronic
1134321236 16:13166308-13166330 CAGGCAAAAAAGCAAGAGAAAGG - Intronic
1135512525 16:23098895-23098917 TAGGGACATAGGCATGAGCAAGG + Intronic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1140350464 16:74257579-74257601 CAGAGACAACAGCATGAGCAAGG + Intergenic
1140724366 16:77798912-77798934 CAGGGACAAACTCATCATGATGG - Intronic
1140725076 16:77804639-77804661 CAGGGACAAACTCATCATGATGG - Intronic
1140854583 16:78967087-78967109 CAGGGACAGATGCATGACTATGG - Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1140989718 16:80198324-80198346 CAGGAACAAAAGAATGAGGCTGG - Intergenic
1141509084 16:84501135-84501157 CAGAGACAAGGGCATGGGGATGG + Intronic
1142393639 16:89818480-89818502 CAGAGAGAAAACCATGAAGATGG + Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143425853 17:6836970-6836992 AAGCTACAAAAGAATGAGGAAGG + Intergenic
1143580115 17:7820493-7820515 CATGAGCAAAAGCATGAGAAGGG - Intronic
1146065236 17:29629823-29629845 TGGGGACAACAGCATGGGGAAGG + Exonic
1146079551 17:29765727-29765749 CAGGGACAAAAGGCTGGGCATGG + Intronic
1147677493 17:42218343-42218365 CAGGGACAGATGCATGATGAGGG + Intronic
1151081151 17:71330349-71330371 CTAGGAAAAAAGTATGAGGAAGG + Intergenic
1151393365 17:73802750-73802772 AAGGCACAAAAGCATGAGATGGG - Intergenic
1151519187 17:74616228-74616250 TAGGGACAATGGCATGAGGATGG + Intronic
1152133183 17:78489584-78489606 CAGCAACAAAAGCTTCAGGAGGG - Intronic
1152822966 17:82446493-82446515 CAGGGACCAACGCTTCAGGACGG + Intronic
1203168922 17_GL000205v2_random:128709-128731 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1154375986 18:13810273-13810295 CAGGTGCTAAAGGATGAGGAGGG - Intergenic
1155220174 18:23678056-23678078 CAGGACCAAAAGCCTGAGAATGG + Intergenic
1155226591 18:23734711-23734733 CAGGCACAAAGGCCTAAGGATGG - Intronic
1155353503 18:24929126-24929148 CAGGGACAAAGGCGAGAGCAGGG - Intergenic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156542114 18:37924491-37924513 CAGGGAAAAAAACATGGGAAGGG - Intergenic
1156865128 18:41880513-41880535 CAGGAACAAAAGAATGAGAAAGG - Intergenic
1157092718 18:44654922-44654944 CAGAGACACAGGCATGATGAGGG - Intergenic
1157513084 18:48292490-48292512 CAGGGACAGGCGCAGGAGGAGGG - Intronic
1158880873 18:61778656-61778678 CAGGGAGATAAGGACGAGGAGGG + Intergenic
1158939768 18:62396541-62396563 AAGGGAAATAAGCATGGGGAAGG - Intergenic
1159103213 18:63977986-63978008 CAGAGACAGAGACATGAGGACGG - Intronic
1162097095 19:8316795-8316817 CAGGGACATATGCCTGGGGAGGG + Intronic
1162272686 19:9629300-9629322 CAGGGACAAATTCGTTAGGAAGG + Intronic
1162834752 19:13308916-13308938 GAGAGACCAAAGCAGGAGGATGG - Intronic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163741821 19:19018971-19018993 CAGTGAGAAGAGCATGAGGGTGG - Intronic
1164011184 19:21204711-21204733 ATGGGATAAAAGCAGGAGGAAGG - Intergenic
1164015836 19:21255250-21255272 ATGGGATAAAAGCAGGAGGAAGG + Intronic
1164675615 19:30098442-30098464 CAGTGACCAGAGCATGAGGGGGG - Intergenic
1164867493 19:31616978-31617000 CAGGGATGAAAAGATGAGGATGG - Intergenic
1165100266 19:33434934-33434956 CAGGTACAAACCCCTGAGGACGG + Intronic
1165769471 19:38370500-38370522 CAGGGAGCAAAGAATGAGTAAGG - Intronic
1166423755 19:42657712-42657734 CAGGTATGAAATCATGAGGATGG + Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167301772 19:48681868-48681890 CAGGGACACACCTATGAGGAGGG + Intergenic
1168078583 19:53993294-53993316 CAGGGACAAAAGCCTGAGCCCGG + Intronic
925287695 2:2726691-2726713 TGGGGAAAAAAGCAAGAGGAGGG - Intergenic
925861007 2:8174873-8174895 CAGTGACACATGCATGAGGGAGG - Intergenic
926725850 2:15997305-15997327 CAGGGCCACCAGCATCAGGAAGG - Intergenic
927194749 2:20539678-20539700 CAGGGACAAAGCCATGAGTGAGG - Intergenic
927983654 2:27392236-27392258 CAGGAACAACAACATGATGAAGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928353625 2:30586724-30586746 CAGGGACAAGATGTTGAGGATGG - Intronic
929901082 2:46004502-46004524 CAGGGACAGAGGCATCAGAAGGG - Intronic
931078504 2:58742953-58742975 CAGAGACAAAAGGATGAGCTTGG + Intergenic
931622903 2:64229046-64229068 CAGGAAAAAAACCATGAGGTAGG - Intergenic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933324892 2:80823110-80823132 CAGGGACAACACCAAGACGAAGG + Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
935945861 2:108286102-108286124 CAGGGAAAAATCCATGTGGATGG + Intergenic
936536609 2:113316637-113316659 AAGGGAGTAAAGCATGGGGAGGG + Intergenic
936855747 2:116955407-116955429 CAGGGACACACGCATGATGGAGG - Intergenic
937708735 2:124952643-124952665 GAGGGAGAAAAGCAAAAGGAAGG - Intergenic
938036617 2:128039985-128040007 CAGGGACAAATCTATTAGGAAGG + Intergenic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
940887028 2:158999079-158999101 CAGGAACCAAAGCCTGAGGCTGG + Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
943272735 2:185828164-185828186 CAGGAACAAAAGCCAGAGCATGG + Exonic
944091167 2:195913688-195913710 CAGCAACAAAAACATGTGGATGG - Intronic
945983770 2:216338547-216338569 GAGGGACAAAAGGAGGAGGTAGG - Intronic
947253109 2:228131333-228131355 CAGTGACAAAAGCATTAGATGGG + Intronic
947618597 2:231574359-231574381 CAGGGACACAAGGCTGAGGAGGG + Intergenic
947838482 2:233191737-233191759 GAGTGAACAAAGCATGAGGAGGG + Intronic
947873500 2:233453020-233453042 CAAGGAAAAAAGCCTCAGGAGGG - Intronic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
1168794897 20:604856-604878 TAGGGACAAAAGCAAGGGGCAGG + Intronic
1168831466 20:847374-847396 TGGGGAGACAAGCATGAGGAGGG + Intronic
1168966640 20:1902634-1902656 TGGGGAGAAAAGCAGGAGGAGGG + Intronic
1169016778 20:2298764-2298786 CAGACACAAAAATATGAGGAGGG - Intronic
1170226629 20:13997059-13997081 CACGAACAAAGGCGTGAGGAGGG + Intronic
1170915885 20:20625037-20625059 CAGGCAGAAAAGCAAGAGGGAGG - Intronic
1171431798 20:25087616-25087638 CAGGGACAAAAGGAGAGGGAGGG + Intergenic
1172125329 20:32622187-32622209 CAGGTGCAAAGGCATGAGGTGGG + Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173179795 20:40797178-40797200 CAGGGCTAAGAGCATGAGGGAGG + Intergenic
1174477246 20:50804333-50804355 GAGTGAAAAAAGCATGAGGCCGG - Intronic
1176402832 21:6330445-6330467 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1176434325 21:6658659-6658681 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1176458587 21:6985729-6985751 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1177234739 21:18373911-18373933 CAGAGATAAAAGAATGAGTAAGG + Intronic
1178009438 21:28266334-28266356 CAGGGACCAAAGTATGAGAGAGG - Intergenic
1179030824 21:37718179-37718201 AAGGGGCAAAGGCATAAGGAGGG - Intronic
1180174511 21:46081151-46081173 CGGGGACAACGGGATGAGGAGGG + Intergenic
1181384556 22:22534411-22534433 GAGGGACAAAACCTTGAGGACGG + Intergenic
1181542382 22:23580309-23580331 CAGGGACCAGAGGATGAGGATGG - Intergenic
1181666388 22:24401307-24401329 CACGGACAACAGGATGGGGAAGG - Intronic
1181673446 22:24436855-24436877 CTGGGACAAGACCCTGAGGAAGG + Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1183591938 22:38784259-38784281 TAGGGACAGAGGCATGAGGCTGG + Intronic
1184032718 22:41904484-41904506 CAGGGACAGAGGGGTGAGGAGGG - Intronic
1184321940 22:43748541-43748563 CAGGAACAATTGGATGAGGAAGG - Intronic
1184420533 22:44380374-44380396 CAGGGACAGAAGCCTCAGCAAGG - Intergenic
1184457761 22:44621160-44621182 CAGGGACACAACGATGGGGATGG + Intergenic
1185071593 22:48659597-48659619 CAGGGAGAAAAGCAGGACAAGGG - Intronic
949535655 3:4994565-4994587 AATGGACAGAGGCATGAGGAGGG + Intergenic
949856247 3:8463979-8464001 CAGGTACAACAGCATGTGCAAGG - Intergenic
949901707 3:8820409-8820431 CAGCCACAAATGCATGAGCAAGG + Intronic
950268923 3:11597621-11597643 CAAGGACACAATCATGATGAAGG - Intronic
950298393 3:11851912-11851934 CTGGGACTAAAGGATGAGGAAGG - Intergenic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
951686653 3:25351755-25351777 CAGTGACACAAGCATGAATATGG - Intronic
953233522 3:41085612-41085634 CAGGGGCATAGGCATGTGGATGG - Intergenic
953363838 3:42324969-42324991 CAGGGATAAAAGCATGTCCATGG + Intergenic
953731538 3:45453957-45453979 AAGAGACAAAAGCATGCTGATGG + Intronic
953774237 3:45801859-45801881 TAGGGAGAAAAGGATGAGTAAGG - Intergenic
956529528 3:70202394-70202416 GAGGGACAAAAGGAAGAGGTGGG + Intergenic
956754781 3:72373760-72373782 CAGGCACAAAAGCAAGCAGAGGG + Exonic
956971835 3:74535548-74535570 CAGATACAAAAGCATATGGAGGG + Intergenic
957469664 3:80642207-80642229 CTGGGACAAACGTGTGAGGAGGG + Intergenic
958056179 3:88415385-88415407 CAGGGTTAAAACAATGAGGATGG + Intergenic
958712868 3:97739446-97739468 AAGTGACAAAGGGATGAGGAAGG + Intronic
958754851 3:98238807-98238829 CATGGATTAAAGCATGAAGAAGG - Intergenic
958757287 3:98264788-98264810 CATGGATTAAAGCATGAAGAAGG - Exonic
958768267 3:98396496-98396518 CTGGGACAAAAGAATCTGGATGG + Intergenic
959692226 3:109210018-109210040 CAGAGACAAAATGATGAGAAAGG - Intergenic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
960390853 3:117075923-117075945 CAGGGAAAAAAACATGAGGATGG - Intronic
961066994 3:123884174-123884196 CCTGGACAAAAGCATGGGGCGGG + Intronic
961212286 3:125135025-125135047 CAGGGACCCAAGCATGGGGCAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
963826269 3:149957580-149957602 TTGGGACAAAAGCATAAGGTTGG + Intronic
964209847 3:154214547-154214569 CAGGGACAAGAGCGTGATGAAGG + Intronic
964531866 3:157677054-157677076 TACTGACAAAAGCAGGAGGAAGG + Intronic
964746199 3:160014913-160014935 CAGGGACAATGGCATGGGAAAGG - Intergenic
964812447 3:160680271-160680293 AAAGGAGTAAAGCATGAGGAGGG - Intergenic
965309372 3:167110342-167110364 TAGAGACAAAAGAATAAGGAAGG - Intergenic
965818474 3:172661040-172661062 CAGGGACATAGGCATGGGCAAGG - Intronic
966532030 3:180991760-180991782 TAGGGACAAAAGAATGAGAAAGG + Intergenic
966874172 3:184312593-184312615 GAGGGGCAAAAGCGTAAGGATGG - Intronic
967161413 3:186741873-186741895 CATGGACATAAGCATAAGCATGG + Exonic
968665003 4:1816172-1816194 CAGGGACGAGAGCATGAGCAGGG + Intronic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
974264399 4:59565609-59565631 CAGAGAGAAAAGCATGTGCAAGG - Intergenic
974896510 4:67946499-67946521 CAGGGACAACACAATGAGAACGG + Exonic
976775076 4:88698539-88698561 GAAGGACTAAAGCTTGAGGAGGG + Intronic
977862851 4:101987065-101987087 TAGAGACAAAAGTATGAGGCTGG + Intronic
978512934 4:109541333-109541355 GAGGGACCAAAGCAAGCGGATGG + Intergenic
979354798 4:119690738-119690760 CAGGGAGCAAAGGATGGGGAAGG + Intergenic
979450431 4:120864276-120864298 TAAGGAGAAAAGCATAAGGATGG + Intronic
981878537 4:149578931-149578953 GAGAGGCAAAAGCATGGGGAAGG - Intergenic
982154080 4:152498041-152498063 AAGGGAGAAAAGTATGGGGAGGG + Intronic
982731217 4:158957383-158957405 CAGAGAGAAAAGCATGAGCCAGG - Intronic
983434093 4:167689661-167689683 AAGTGACAAATCCATGAGGAAGG + Intergenic
985566354 5:620279-620301 CGGGGACAAAAGCATGAGCGTGG - Intronic
986002558 5:3641799-3641821 CAGGCTCAAAAGCTTCAGGAAGG - Intergenic
986482646 5:8204309-8204331 GAGTGACAAGAGCAAGAGGAGGG - Intergenic
988166216 5:27593016-27593038 TAGGGGCAAAAATATGAGGAAGG - Intergenic
988291905 5:29297971-29297993 CAGAGACAAGAGCATGGGAATGG + Intergenic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
989098894 5:37806553-37806575 CAGGGGCAAAAGCAGAAGCATGG - Intergenic
991175673 5:63685155-63685177 GAGGGAGAAAAGGAAGAGGAAGG - Intergenic
992332827 5:75735089-75735111 CAGTGACACAAGAATGAGGACGG - Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993996088 5:94724823-94724845 CTGGGACAAAAGCCTGAGATGGG - Intronic
994280317 5:97893993-97894015 CACGGATAAAAGAATGAGAAAGG - Intergenic
994729595 5:103476230-103476252 TAGGGACACAAGCATTAGGAAGG + Intergenic
995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG + Intergenic
996068242 5:119104389-119104411 CAGGTTCAAAAGCTTCAGGATGG - Intronic
996491122 5:124098591-124098613 AAAGGACAAAAACAAGAGGAAGG - Intergenic
996681726 5:126234863-126234885 GAGGAACAAAAGCAGAAGGAAGG + Intergenic
998169257 5:139862766-139862788 CAAGCACAAACGCATGAGCATGG - Intronic
998187448 5:139992446-139992468 GAGAGACAAAAGAATGAGAAGGG - Intronic
998406984 5:141879481-141879503 CTAGGTCAAAAGAATGAGGAAGG + Intergenic
998835323 5:146197586-146197608 CAGGGAGAAAAGGTTGAGAATGG - Intergenic
999374039 5:151074306-151074328 CAGAGACAGACGCAGGAGGATGG + Intronic
999833321 5:155341598-155341620 CAGAGAGAGAAGGATGAGGAAGG + Intergenic
1003115609 6:3281858-3281880 CAGGCACAAAAGCATCACCAAGG + Intronic
1003253848 6:4457367-4457389 CAGGGACCAGAGCATGAGCCAGG + Intergenic
1003766430 6:9242275-9242297 CATGAACAAAAGCATGAGGCAGG + Intergenic
1004472615 6:15942635-15942657 CAGGCGCAAGAGCATGAGGGAGG + Intergenic
1004543460 6:16573759-16573781 CAGGGACAAAAGCATGAGGAAGG - Intronic
1007321015 6:41028698-41028720 CAAGGACAAAAGCTACAGGATGG - Intronic
1007554970 6:42758153-42758175 CAGGGAGAAGAAGATGAGGAAGG - Intronic
1008028227 6:46663179-46663201 AAGGGACAAAATCATGCAGATGG + Intronic
1008087473 6:47259814-47259836 CCTGGAGAAAAGCATGAGGATGG + Intronic
1008113269 6:47517131-47517153 CAGGAACAAGAGAAAGAGGAGGG - Intronic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1010258747 6:73790716-73790738 AATAGACAAAAGCTTGAGGAAGG - Intronic
1011026539 6:82875536-82875558 CAGGCAGAAAAACATGAAGAGGG - Intergenic
1011231087 6:85163052-85163074 CAAAGACGAAAGAATGAGGAGGG - Intergenic
1011783692 6:90819503-90819525 CTGGGACGACAGCATGAGGCTGG - Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012306602 6:97666518-97666540 CATGTACAAAAGAATGTGGATGG - Intergenic
1012869271 6:104655182-104655204 CAGGGACAAAAAAATCAGTAAGG - Intergenic
1015786127 6:136922694-136922716 CAGGGACCAGAGCGTGAGGCTGG - Exonic
1015799120 6:137043338-137043360 CAGAGACATAGGCAGGAGGATGG - Intronic
1016010129 6:139130678-139130700 CTGGGACAATAGTATGAGCAAGG + Intergenic
1016683964 6:146860776-146860798 CAGGGACAGAAGCCAGTGGAGGG - Intergenic
1017664566 6:156707107-156707129 CAGAGACAGAGGCATGAGGCAGG - Intergenic
1018713195 6:166512490-166512512 CAGGGACCCAGGAATGAGGAAGG - Intronic
1019278985 7:190965-190987 CAGGGACAGAAGCCTGTGGCAGG - Intergenic
1019546891 7:1582217-1582239 CAGGAACAAAGGCAAGAGCAGGG - Intergenic
1019805121 7:3117929-3117951 AAGGGACAAATGCAGGAGGGTGG - Intergenic
1020243292 7:6411689-6411711 TAGGAACAAAACCATGAGAAAGG + Intronic
1021422275 7:20459327-20459349 CAGGGACAAAAGGAATAGAAAGG + Intergenic
1021806081 7:24357419-24357441 CAGGTACAAAAGCCTGAGCTGGG - Intergenic
1021901653 7:25291420-25291442 CAGGCACAACAGCATGTGCAGGG - Intergenic
1021918608 7:25460584-25460606 CAGGGACAGAAGCACAAGGAAGG + Intergenic
1022459112 7:30587230-30587252 CTGGTACAGAAGCATCAGGAGGG - Intergenic
1023908721 7:44539445-44539467 CAGGGACAAAAGCAAGATGGTGG - Exonic
1024158653 7:46651730-46651752 CAGGGACTGATTCATGAGGAAGG + Intergenic
1024474384 7:49794801-49794823 CATAGACAAGAGGATGAGGATGG - Intronic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1024684795 7:51733711-51733733 CAGGGAAGAGAGCATGTGGAGGG + Intergenic
1025030807 7:55555213-55555235 CAGGGACCAAAGCCTGAAGGGGG + Intronic
1025106849 7:56178110-56178132 CAGGAATAACATCATGAGGAAGG - Intergenic
1026311420 7:69188094-69188116 CAGGAATAATATCATGAGGAAGG + Intergenic
1027504154 7:78994459-78994481 CAGGGAAAAAATCATGAAAATGG - Intronic
1027771371 7:82410697-82410719 AAGCGACAAAAGCACGGGGAAGG + Intronic
1028931204 7:96415009-96415031 CAGGGAGAAAAGCATGAAAGAGG - Intergenic
1029473666 7:100770070-100770092 CAGATGGAAAAGCATGAGGAAGG + Intronic
1029935647 7:104421673-104421695 CAGAAACAATAACATGAGGAAGG + Intronic
1030154789 7:106443314-106443336 CAGAGACTACAGTATGAGGAAGG + Intergenic
1031617887 7:123902873-123902895 CAAGGACAGAACCAAGAGGATGG + Intergenic
1032839113 7:135700156-135700178 CAAGGAGAAAAGAATGAGGAAGG - Intronic
1033240415 7:139674517-139674539 CAGGAAGAAAGGCATGAGGATGG + Intronic
1033258892 7:139825284-139825306 CTGGGACAGTAGCATGATGAAGG - Intronic
1033582102 7:142747629-142747651 CAGGAAGAAAAGCACCAGGAAGG + Intergenic
1033583628 7:142758428-142758450 CAGGAAGAAAAGCACCAGGAAGG + Intronic
1033585112 7:142769003-142769025 CAGGAAGAAAAGCACCAGGAAGG + Intergenic
1033953759 7:146817650-146817672 CAGGAACAAGAGCAAGAGGAAGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035485080 7:159216966-159216988 CAGGCACCATAGCAAGAGGAAGG + Intergenic
1035557834 8:579670-579692 CAGGGACTGAGACATGAGGAGGG - Intergenic
1036277366 8:7367216-7367238 CAGGTAGAAGAGCATGAGCAGGG + Intronic
1036343964 8:7943119-7943141 CAGGTAGAAGAGCATGAGCAGGG - Intronic
1036685222 8:10904967-10904989 GAGGGACCTAAGCATGAGGCAGG + Intronic
1036839306 8:12103886-12103908 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1036861095 8:12350129-12350151 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1037400811 8:18493682-18493704 CAGGGACACAGCCATGAGAATGG + Intergenic
1037489524 8:19385105-19385127 CTGGGACCAAAGCACGAGGAGGG - Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1038255481 8:25947279-25947301 CAGGGAAGAAAGCATGTGCAGGG - Intronic
1039479885 8:37864624-37864646 TAGGAACAAAAGCAAGATGATGG + Intronic
1040895595 8:52365160-52365182 CATGCACAAAAACATGATGATGG + Intronic
1041487045 8:58390895-58390917 CAGGGAGAAAGGGATAAGGAAGG + Intergenic
1041684000 8:60625713-60625735 CATGGGCAAAAGCCTGAGAAAGG + Intergenic
1042886449 8:73557826-73557848 CAGGGACAAAAGATAGATGATGG - Intronic
1043638262 8:82414076-82414098 CAGGCAAGAAAGCATGAGCAGGG + Intergenic
1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG + Intergenic
1044655832 8:94547443-94547465 CAGGGATAGAAGAATAAGGAAGG - Intronic
1045327201 8:101126339-101126361 CAGGGACAAAAGCCAGGGGAAGG - Intergenic
1046182059 8:110663240-110663262 AAGTGACAGAAGCATGAAGAAGG - Intergenic
1046450558 8:114384938-114384960 CAAGGACAGAAGAATGAGAAAGG + Intergenic
1047353945 8:124102503-124102525 CATGGGCAAAAACATGAGAATGG - Intronic
1047971976 8:130092248-130092270 CAGAGACAAAAGCAAAAGGCTGG + Intronic
1047997641 8:130351859-130351881 CAGGACCAAAAGCATTAGCATGG + Intronic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1052271958 9:26636434-26636456 CAGGGCCAAAAGAATGTGGAAGG - Intergenic
1052882564 9:33612694-33612716 CAGGAAGAAAAGCAGCAGGAAGG - Intergenic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1055052363 9:71993505-71993527 TTGGGAGAAAAGCATGAGAAGGG + Intergenic
1055271168 9:74560479-74560501 CAGGGAAAATGGCATGAGCAGGG + Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055644107 9:78346661-78346683 GAGGGAGAAAACCATTAGGAGGG + Intergenic
1056237933 9:84614666-84614688 AAGGGTCGAAAGCATGTGGAAGG + Intergenic
1056488025 9:87078338-87078360 CAGGAATATAAGCATCAGGAGGG + Intergenic
1056488191 9:87079998-87080020 CAGGCAAGAAAGCATGTGGAGGG - Intergenic
1057854668 9:98593422-98593444 CAGGGACAATGGCAGGAGCAGGG + Intronic
1058296107 9:103309351-103309373 CAGGGACTGAAGCCTGAGGTAGG - Intergenic
1058746360 9:107995099-107995121 AAAGCAGAAAAGCATGAGGAGGG - Intergenic
1060102347 9:120851605-120851627 CAGGCACAAGGGCATGAGGATGG + Intergenic
1060134978 9:121144817-121144839 CTGGGACAGAAGTATGAGAAAGG - Intronic
1060365730 9:123011385-123011407 CATTAACAAAAGCATGGGGATGG + Intronic
1062016499 9:134293740-134293762 CAGAGACAGAAGCCTGTGGAGGG - Intergenic
1062391777 9:136336758-136336780 CAGGGGCGGAAGCCTGAGGACGG - Intronic
1203437211 Un_GL000195v1:149983-150005 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1185882109 X:3750724-3750746 CAGAGACGAAGACATGAGGATGG + Intergenic
1186728867 X:12386377-12386399 CAAGGACGAAAGTATGTGGATGG + Intronic
1187733615 X:22281874-22281896 CAGAGTCAAAAGCATGGGAAAGG - Intergenic
1188832976 X:34923841-34923863 CAGAGACATAAATATGAGGAAGG - Intergenic
1188951796 X:36384913-36384935 CACGGACAAAATTATGTGGACGG - Exonic
1189140630 X:38601824-38601846 AAGGTCCAAATGCATGAGGAGGG - Intronic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1190199507 X:48348209-48348231 CAAGGATAAATGCTTGAGGATGG - Intronic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190471270 X:50781853-50781875 CAGGGACAATAGCATCAAGCTGG + Intronic
1190666283 X:52698690-52698712 CAAGGATAAATGCTTGAGGATGG - Intronic
1190673135 X:52759720-52759742 CAAGGATAAATGCTTGAGGATGG + Intronic
1193079935 X:77396733-77396755 CAGAGACAAAAGCAAGATAATGG + Intergenic
1193184483 X:78495990-78496012 GAGGGAAACAAGCATGAGGCAGG + Intergenic
1193271623 X:79535857-79535879 TAGGGGCAATAGCAAGAGGAGGG + Intergenic
1196735757 X:118979627-118979649 CAGGGACATTAGAAAGAGGAAGG + Intronic
1198743001 X:139860914-139860936 CTGAGATCAAAGCATGAGGAAGG + Intronic
1199658166 X:150018835-150018857 AAGTGACAAAAGCATGCAGAGGG + Intergenic
1199698045 X:150357784-150357806 CAGGAACACAGGAATGAGGACGG - Intergenic
1199984928 X:152943668-152943690 CAGGGACAAATGGATGAACAAGG - Intronic
1200782865 Y:7232482-7232504 CAGAGACGAAGACATGAGGATGG - Intergenic