ID: 1004544323

View in Genome Browser
Species Human (GRCh38)
Location 6:16582658-16582680
Sequence GTGCTGTGACCTCAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004544323 Original CRISPR GTGCTGTGACCTCAGATCTG TGG (reversed) Intronic
900101068 1:962320-962342 GTCCTCAGACCTGAGATCTGGGG - Intronic
900428674 1:2592082-2592104 CTGCTCTGCCCTGAGATCTGAGG - Intronic
903268979 1:22176135-22176157 GTTCTCTGACTCCAGATCTGGGG - Intergenic
905389467 1:37626868-37626890 GTGCAGGGACCCCAGATCAGGGG + Intronic
905392295 1:37644572-37644594 GTGCTGTGATTACAGGTCTGAGG + Intergenic
907159312 1:52359341-52359363 CTGCTGGGGCTTCAGATCTGGGG + Exonic
907411086 1:54283787-54283809 GGCCTGTGACCTCAGACCTGGGG - Intronic
907484425 1:54767357-54767379 GTGGTGTGTCCCCAGAGCTGTGG - Intergenic
910977481 1:92921898-92921920 GTGCAGTAACCTCCAATCTGAGG - Intronic
911528373 1:99013548-99013570 GTGCTGGGACTTCAGGTGTGAGG - Intergenic
912397144 1:109354723-109354745 GAGCTGGGACATCATATCTGTGG + Intronic
912458946 1:109818557-109818579 GTTCTGGGACCCCAGATCAGAGG - Intergenic
916239429 1:162624134-162624156 GCTCTGTGATGTCAGATCTGAGG + Intergenic
917665787 1:177224040-177224062 GTGCTATCAGCTCAGATCTGTGG - Intronic
918647687 1:186921650-186921672 GTGCTGTGGCCTCAGGAGTGGGG + Intronic
921069893 1:211649974-211649996 GGGCTGGGGCCACAGATCTGGGG - Intergenic
1063852482 10:10208709-10208731 GTTTTATGACCTCAGCTCTGCGG - Intergenic
1064600673 10:16989175-16989197 ATCCTGTGACCTCAGCTCTAGGG - Intronic
1067925856 10:50507324-50507346 GTTGTGTGAACTCAGATCAGTGG - Intronic
1071503829 10:86221421-86221443 GTGCTGGGAACACAGAACTGAGG + Intronic
1072566703 10:96622309-96622331 AGGCTGTGACTTCAGTTCTGTGG + Intronic
1073452614 10:103618687-103618709 GTGCTGTGAGCTCAAAACAGCGG + Intronic
1074528276 10:114279485-114279507 GTGCTGTGAGCTCATCGCTGGGG - Intronic
1076604922 10:131683274-131683296 CTGCTCTGACCTCTGATGTGAGG - Intergenic
1080032202 11:27673617-27673639 ATGCTGTCACCACAGCTCTGGGG - Intronic
1080041609 11:27765077-27765099 ATGATGTTACCTCAGATCTGAGG - Intergenic
1082009106 11:47438381-47438403 CTGCAGTGAGCTGAGATCTGTGG - Intronic
1085049472 11:73372737-73372759 CTGCTGAGACCTCATATCGGGGG - Intergenic
1085406951 11:76269087-76269109 ATGGTGTGACCTCAGCTGTGTGG + Intergenic
1085596481 11:77815041-77815063 GTGGTGTGACTTCAGACATGAGG + Intronic
1087158267 11:94925317-94925339 GTGCTCTGGCCTCGGTTCTGGGG - Intergenic
1087177126 11:95106240-95106262 GAGCTGTGAGGTCAGAGCTGAGG + Intronic
1088583112 11:111334391-111334413 CTGATCTGCCCTCAGATCTGAGG - Intergenic
1088634002 11:111801830-111801852 CTGCTGTCCCCTCAGAGCTGGGG + Intronic
1089529293 11:119116245-119116267 GAGCTGGGTCCTCAGAGCTGGGG - Exonic
1090026013 11:123168294-123168316 GTGCCGTGGCCCCAGCTCTGGGG - Intronic
1090805470 11:130199509-130199531 GTTCTGTGACCTCACATCAGCGG + Intronic
1097261706 12:57724198-57724220 GTGCTGTGTCCTCAGTTCAGTGG + Intronic
1102644500 12:114395444-114395466 GTGATCAGACCTCAAATCTGGGG + Intronic
1103594058 12:122012628-122012650 GTGCTGGGATCTGTGATCTGTGG - Intergenic
1107431945 13:40348192-40348214 GTGCTGTGTCACCAGTTCTGAGG + Intergenic
1107473574 13:40713429-40713451 GGGCTCTGATCTGAGATCTGGGG + Intergenic
1107491013 13:40879885-40879907 GTGCTGTGGGCTCAGAAGTGGGG + Intergenic
1108514390 13:51185569-51185591 GTTCTGTTACCTCATTTCTGAGG - Intergenic
1114821065 14:26019695-26019717 CTGCTGTGAATTCAGCTCTGTGG - Intergenic
1116359756 14:43978845-43978867 GTCCTATGACCTCAGTTCTCTGG - Intergenic
1117255739 14:53975702-53975724 GTTCTGTGACCTCATCTCTAAGG + Intergenic
1118117650 14:62798993-62799015 GTGAGGTGTCCTCAGATGTGAGG + Intronic
1120143596 14:80955531-80955553 GGGCTGTGACCTCACCACTGTGG - Exonic
1123184846 14:106507015-106507037 TGGCTGTGTCCTCAGATCTCAGG + Intergenic
1123481817 15:20639483-20639505 CGGCTGTGTCCTCAGATCTCAGG + Intergenic
1123636196 15:22360882-22360904 CGGCTGTGTCCTCAGATCTCAGG - Intergenic
1123865730 15:24517862-24517884 CTGCAGTGACTTCAGTTCTGTGG + Intergenic
1128619725 15:69138434-69138456 CTTCTGTGACCCCAGATGTGTGG - Intergenic
1128780835 15:70357614-70357636 GTGGTGTGAGCACAGGTCTGGGG - Intergenic
1130613373 15:85380965-85380987 GCGCCGGGACCTCAGGTCTGCGG + Intronic
1131540531 15:93271432-93271454 GTCCTGTGACCTCAGGGCTAAGG - Intergenic
1131851092 15:96544004-96544026 TTGCTCTGACCTCAGCTCTTAGG + Intergenic
1132469536 16:94259-94281 GTGCTGTGCTCTCAGACCTCAGG - Intronic
1133048409 16:3102203-3102225 GTTCTGGGACCTCAGAGTTGTGG + Intergenic
1134810972 16:17166776-17166798 GTGCTGGGACCACAGACATGAGG + Intronic
1135153435 16:20031082-20031104 TAGCTGTGACCTCAAACCTGGGG - Intergenic
1135570974 16:23549188-23549210 GTGCTGGGGACTCAGATCTCAGG + Intronic
1135816638 16:25640280-25640302 GAAATGTGACCTGAGATCTGAGG + Intergenic
1136025907 16:27469088-27469110 GTGCTGTGCCCACACCTCTGTGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136553125 16:30992344-30992366 ATGGTGTGTCCACAGATCTGTGG + Exonic
1137569241 16:49554168-49554190 GAGCTGTGGCCTCAGGTGTGGGG - Intronic
1138261036 16:55622956-55622978 CAGCTGTGTCCTCAGAGCTGGGG - Intergenic
1138265097 16:55654886-55654908 GTGTTGTGACCACAGATGTGTGG - Intergenic
1139661292 16:68422669-68422691 TTGCAGTCATCTCAGATCTGTGG - Intronic
1139717583 16:68825866-68825888 GTGGAGTGATCTCAGATCTCAGG + Intronic
1140197647 16:72868545-72868567 GTGCGGAGCCCTGAGATCTGGGG - Intronic
1140940044 16:79712996-79713018 TGGCTGTAACCTCAGATCAGGGG - Intergenic
1141229112 16:82147729-82147751 GCTCTGTGACCTCAGTTCTCTGG - Intergenic
1141634088 16:85304466-85304488 GGGCAGTGCCCTCAGCTCTGTGG + Intergenic
1142225232 16:88873909-88873931 GCCCTGTCACCTCAGATCTTGGG - Intergenic
1142553603 17:756529-756551 GTGCGGGGGCCACAGATCTGTGG + Intergenic
1142706439 17:1697920-1697942 GTGCCCTGACCTGGGATCTGAGG + Intergenic
1142824221 17:2497855-2497877 GTGCTGTGACTGCAGGTATGAGG + Intronic
1144770962 17:17759194-17759216 GTGGTGTGACCTCAGACCCTGGG + Intronic
1145003514 17:19321843-19321865 GTGGTGTGACTTCAGGACTGCGG - Intronic
1145237017 17:21215128-21215150 GTGCTGCTGCCTCAGACCTGTGG + Intergenic
1146009763 17:29184541-29184563 GTGCTGTGATCTCAGCTCACTGG + Intergenic
1152632327 17:81415827-81415849 GTGCGGGGACCCCAGCTCTGGGG + Intronic
1152806115 17:82357189-82357211 GGGCTGTGTCCTGAGAACTGAGG + Intergenic
1152894175 17:82901253-82901275 GTGCTGTGACCGCCGCCCTGAGG + Intronic
1153334842 18:3912731-3912753 TTGCTGAGGCCTCAGCTCTGTGG + Intronic
1155262350 18:24056220-24056242 GCCCTGAGACCTGAGATCTGAGG - Intronic
1156148003 18:34209133-34209155 GTGGTGTGATCTCAGATCCCAGG - Intronic
1159105508 18:63999091-63999113 GTCCTGTGAACTCAGATACGGGG + Intronic
1159883899 18:73886127-73886149 GGCCTGTATCCTCAGATCTGCGG + Intergenic
1160060304 18:75523946-75523968 GTGCTGTGAGCTCAGAGCCCCGG + Intergenic
1161719992 19:5897353-5897375 GGCCTGAGACCTCAGTTCTGCGG + Intronic
1161807788 19:6455021-6455043 GTGCTGGGACTACAGATGTGAGG - Intronic
1163597679 19:18229836-18229858 GAGGTGTGAATTCAGATCTGAGG - Intronic
1163738620 19:18997054-18997076 GTGCTGTGAGCTCAGGTCTTTGG + Intronic
1163916509 19:20245133-20245155 GTGCTGTGGGCTCAGAAGTGGGG - Intergenic
1167060933 19:47145790-47145812 GTGCAGTGGCCTCACACCTGTGG - Intronic
1167705343 19:51078290-51078312 GGGCTGAGACCTCAGAGCTGGGG - Intronic
926103132 2:10133368-10133390 CTGCTGTGGCCTCTGACCTGAGG + Intergenic
927372953 2:22378782-22378804 GTGCTGGGATCACAGATGTGAGG + Intergenic
929077732 2:38092421-38092443 GTACTGTGGCCTCAGACCTGGGG + Intronic
929615468 2:43303818-43303840 GTACTGTTACCTCAGACCGGCGG + Intronic
930118795 2:47742880-47742902 GTGCTGGGATTTCAGATGTGAGG - Intronic
932432474 2:71684294-71684316 TTGCTGTGACCTGAGATCCGGGG + Intronic
934025674 2:87999904-87999926 TTTCTGTGACCTCAGATGTATGG - Intergenic
934219864 2:90072791-90072813 GTGCCCTGACCTCAGCTGTGGGG + Intergenic
935223973 2:101037657-101037679 GTGCAGTGACCACAGATTTGGGG - Exonic
937959956 2:127450043-127450065 GCCCTGTGGCCTCAGATCTCTGG + Intronic
940323210 2:152399134-152399156 GTGCTGGGATCCCAGACCTGAGG + Intronic
946005265 2:216519708-216519730 GTTCTGTGCCCTCACATCTATGG + Intronic
946428385 2:219611962-219611984 GCGCTGTGGCCTCCGCTCTGTGG + Exonic
946913750 2:224493427-224493449 CTGCTGACACCTCAAATCTGGGG - Intronic
949035467 2:241814020-241814042 GTGCTGTGGCCTCTATTCTGGGG + Intronic
1168751142 20:282351-282373 GTAATGTGACCTCTGATCTTAGG - Intronic
1168879665 20:1195747-1195769 GCTCTGTGGCCTCAGATCTCAGG - Intergenic
1169257178 20:4108531-4108553 GAGCTGTGACCTCAGAAGGGAGG - Intergenic
1173959871 20:47062646-47062668 GTTTTGTGATCTCAGATCTCGGG + Intronic
1174130371 20:48340107-48340129 GTGGTGTGACCGCAGCCCTGTGG + Intergenic
1174387413 20:50195296-50195318 GTGCTGGGTCCTTAGATATGTGG + Intergenic
1175829308 20:61953419-61953441 GTGCTCTGAACTGAGAGCTGCGG - Intergenic
1175922872 20:62458290-62458312 GTGCTGTTTCCTCAGATCAATGG - Intergenic
1176180059 20:63745601-63745623 GTGCTGTGCCTTCAGATGGGAGG - Exonic
1176183910 20:63767600-63767622 TTGCTTTGACCTCAGTGCTGCGG - Intronic
1178320154 21:31599026-31599048 GTGCTGGGATCACAGATGTGAGG + Intergenic
1179979025 21:44886962-44886984 GTGGGGTGACCTCGGACCTGTGG - Intronic
1180231420 21:46428994-46429016 GTGCTGTGCCGTCAGCTGTGTGG + Intronic
1180695368 22:17748610-17748632 TCGCTGTGACCCCAGCTCTGTGG + Intronic
1182080707 22:27526862-27526884 TTGCTGTGTCCTGAGATTTGGGG - Intergenic
1182114425 22:27747364-27747386 CTGCAGTGGCCTCAGGTCTGAGG + Intergenic
1183843698 22:40522323-40522345 GTCCTGTGCCCTCCGAGCTGAGG - Intronic
1184105434 22:42364963-42364985 GGGCTTTGACCTCAGGTCTCCGG + Intergenic
1184226974 22:43134696-43134718 GTGCTGTGACCACTGAGGTGTGG + Intronic
1184429766 22:44435222-44435244 CTTCTGTGACCTCAGATGTGTGG - Intergenic
1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG + Intronic
1184829409 22:46974758-46974780 GAGCTGTGGCCCCCGATCTGAGG - Intronic
1184859988 22:47168142-47168164 GTGCTGTGGGCTCAGTTTTGGGG + Intronic
949296234 3:2527235-2527257 GGGCTGTGACCTCAGAGCCTTGG + Intronic
949871879 3:8596068-8596090 GAGCTGTGATCGCAGATGTGGGG + Intergenic
950452273 3:13072140-13072162 GTGCAGTGACCTCAGACCTTAGG - Intronic
952032224 3:29157163-29157185 GTCCTGTGTCCTCAGATGTTAGG - Intergenic
953513953 3:43572035-43572057 GTGCTGTTCCTTCAGCTCTGGGG - Intronic
954366245 3:50147721-50147743 ATGCTCTGGCCTCAGATCTCTGG + Intergenic
955068911 3:55555970-55555992 GTGCTGTGAGCTCAGTCGTGGGG - Intronic
957772102 3:84707600-84707622 GTGCAGTGACATAAGAGCTGAGG - Intergenic
959628625 3:108482659-108482681 GTGCTGTGTCCTCTTCTCTGAGG + Intronic
959634224 3:108544066-108544088 GTCCTGTGACCTCAATTCTCTGG + Intergenic
963149199 3:142026366-142026388 TTGCTGTTAGCTAAGATCTGTGG - Intronic
964052456 3:152412391-152412413 GAGCTGTGACCACAGGTTTGAGG - Intronic
964785620 3:160392802-160392824 GTGCTGTGATCACAGGTGTGAGG - Intronic
968746676 4:2364097-2364119 GAGCTGTGACCTGAGGCCTGGGG - Intronic
969868442 4:10090512-10090534 GTGATGCGACCCCAGACCTGTGG + Intronic
972334787 4:38097975-38097997 GTGGTGTGAACCCAGCTCTGTGG - Intronic
974875952 4:67703037-67703059 GTTCTGTCACCTCATTTCTGAGG + Intergenic
976305558 4:83555903-83555925 CTCCTGTGACCCCAGATGTGTGG - Intronic
978721425 4:111914701-111914723 GTGCTTTGAGCTCAGTGCTGTGG - Intergenic
980779652 4:137479759-137479781 GTGCTGTGGCCTCAGGAGTGGGG - Intergenic
982930091 4:161393782-161393804 GAGCTGTGAATTCTGATCTGAGG + Intronic
985587604 5:748966-748988 GTGCTGTGACCCCAGCACTTAGG - Intronic
985836920 5:2278325-2278347 GGGCTGTGTCCTGAGAGCTGGGG - Intergenic
985959282 5:3287563-3287585 GAGCTGTGACCCCAGCTCTCAGG - Intergenic
989754469 5:44936049-44936071 GTGCTGGGACCTCAGCTGAGGGG + Intergenic
993050673 5:82922561-82922583 GTGCTGAGGCCTAGGATCTGTGG + Intergenic
993746991 5:91612626-91612648 GTGCGGGGACCTCAGTTCTTTGG - Intergenic
994299760 5:98133601-98133623 GTCCTGAGACCTGAGATATGTGG - Intergenic
997881781 5:137598414-137598436 GAGCTGTGTGCTCAGATCTGTGG - Intergenic
999116389 5:149167874-149167896 GGCCTTTGACCTGAGATCTGTGG + Intronic
999793525 5:154965922-154965944 ATGCTGAGACCTCACCTCTGTGG - Intronic
999989338 5:157034985-157035007 GTGGTGTGATCTCAGCTCTGTGG - Intronic
1000254833 5:159527637-159527659 GGGCTGTGACGTCAGATTGGTGG + Intergenic
1003235565 6:4292612-4292634 GTGTTGGGAGCTCAGATCTCAGG + Intergenic
1003504125 6:6725724-6725746 GTGGTGAGACCTCAGGGCTGGGG - Intergenic
1003715941 6:8646251-8646273 GTGGTGTGATCTCAGCTCTTGGG + Intergenic
1004544323 6:16582658-16582680 GTGCTGTGACCTCAGATCTGTGG - Intronic
1006525072 6:34597272-34597294 TTGCTGTTACATCAGATCTTTGG - Intronic
1007754887 6:44093095-44093117 GTGTTGTGCTCTCAGATTTGAGG - Intergenic
1009272572 6:61632802-61632824 TTATTGTGACCTGAGATCTGTGG - Intergenic
1009596723 6:65745738-65745760 GTGCTGTGAGCTCAAGACTGGGG - Intergenic
1009736458 6:67682596-67682618 GTGCTGTAACCCCAGAACTTTGG + Intergenic
1011973959 6:93268633-93268655 GTACTGAGACATCAGCTCTGTGG + Intronic
1015513124 6:134059331-134059353 GTGGTGTGATCTCAGCTCAGTGG - Intergenic
1016254232 6:142084839-142084861 GTGCTGTGACATCAGGTTGGTGG - Intronic
1017335902 6:153259572-153259594 GTCCTGTGACCTCATTTCTCTGG + Intergenic
1018551708 6:165005718-165005740 GTGCTTTGACCTCTTATCTTTGG + Intergenic
1019261509 7:84446-84468 GGTCTGTGACTCCAGATCTGAGG - Intergenic
1022050609 7:26665263-26665285 GTGTTGTGACCTCAAATAAGAGG - Intergenic
1022974296 7:35543672-35543694 GCCCTGTGACCTCAGTTCTCTGG - Intergenic
1024568291 7:50702402-50702424 GTGCTGTCTCCTCAGGGCTGTGG - Intronic
1025024352 7:55504263-55504285 GTGCTGCGGGCTCAGCTCTGTGG - Intronic
1025757796 7:64361737-64361759 GTCCTGTGATCTCAGAACTTTGG - Intergenic
1027230375 7:76268499-76268521 CTGCTGAGACCTGAGGTCTGGGG - Intronic
1029715385 7:102322590-102322612 GGTCTGTGACCCCAGGTCTGGGG - Intergenic
1033432239 7:141299842-141299864 GTGGTGTGATCTCAGCTCAGTGG + Intronic
1040072109 8:43196685-43196707 GTGCTCTGGCCTCACCTCTGTGG + Intronic
1040955034 8:52970827-52970849 GTGCTGAGACCTTAAAGCTGTGG + Intergenic
1041127793 8:54662663-54662685 GTACTGGGACCTCAGATATGGGG - Intergenic
1041560858 8:59215986-59216008 GTGCATTGAGCTGAGATCTGGGG - Intergenic
1047558207 8:125957262-125957284 GGGCTGTGACCTCACATGTTGGG - Intergenic
1048719061 8:137301293-137301315 GTGGTGGCTCCTCAGATCTGCGG + Intergenic
1048886660 8:138914612-138914634 TGGCTGTGACTTCAGCTCTGAGG + Intergenic
1048992177 8:139766894-139766916 GTGCTGTAGCCACAGGTCTGCGG - Intronic
1049613434 8:143566436-143566458 ATGCTGTGACCTCACCTCTCTGG - Exonic
1049642669 8:143722481-143722503 ATGCTGTGACCTCAGAGGGGAGG - Intergenic
1050111791 9:2224514-2224536 GTGCTGTGATTACAGATGTGAGG + Intergenic
1053054690 9:34987698-34987720 CTGCTGGCTCCTCAGATCTGGGG - Intergenic
1054809280 9:69422046-69422068 CTGCTGTGACCCCAGTTCTCAGG - Intergenic
1056629407 9:88280949-88280971 GCACAGTGCCCTCAGATCTGTGG + Intergenic
1057125533 9:92613408-92613430 GTTGTGTGTCCTCAGATGTGTGG + Exonic
1057251091 9:93502928-93502950 GAGGTCTCACCTCAGATCTGTGG + Intronic
1057795129 9:98150354-98150376 GTGCTGTGACCACAGAGTGGTGG - Intronic
1059003238 9:110373082-110373104 GTGCTGTAACCTCAGATGAAAGG + Intronic
1060066876 9:120510027-120510049 GGGCTAAGACCACAGATCTGAGG - Intronic
1062266406 9:135688364-135688386 GTGCAGTGACCACGGTTCTGGGG + Intergenic
1185948142 X:4401178-4401200 GTGCTGTAACCTCAGTCCTGGGG + Intergenic
1189303790 X:39971729-39971751 GTGCTGGCAGCTCAGTTCTGTGG - Intergenic
1192926068 X:75756748-75756770 GTGTTGTGACCTCAAATAAGGGG + Intergenic
1193456397 X:81736436-81736458 CTTCTGTGACCTCAAATTTGTGG - Intergenic
1196261019 X:113581751-113581773 GTCCTGTGACCTCTGGTTTGAGG + Intergenic
1197361007 X:125504126-125504148 GTGCTGAGTGCCCAGATCTGGGG + Intergenic
1199500645 X:148501808-148501830 GTGCATTGACATCAGAGCTGCGG - Intronic
1201735509 Y:17256556-17256578 GTGCTGTAACCTCAGTCCTGGGG + Intergenic