ID: 1004545058

View in Genome Browser
Species Human (GRCh38)
Location 6:16589706-16589728
Sequence AACAATACTGATAGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004545058_1004545061 8 Left 1004545058 6:16589706-16589728 CCATTATCACTATCAGTATTGTT 0: 1
1: 0
2: 2
3: 32
4: 441
Right 1004545061 6:16589737-16589759 TAAGCTGAATTTACAACTTATGG 0: 1
1: 0
2: 1
3: 18
4: 241
1004545058_1004545062 9 Left 1004545058 6:16589706-16589728 CCATTATCACTATCAGTATTGTT 0: 1
1: 0
2: 2
3: 32
4: 441
Right 1004545062 6:16589738-16589760 AAGCTGAATTTACAACTTATGGG 0: 1
1: 0
2: 0
3: 24
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004545058 Original CRISPR AACAATACTGATAGTGATAA TGG (reversed) Intronic
900276564 1:1833429-1833451 AACAATACTGTGAGGAATAAGGG + Intronic
901760850 1:11470311-11470333 AATAATAATAATAATGATAACGG + Intergenic
903177841 1:21591165-21591187 AATAATAATGATGATGATAATGG + Intergenic
905564438 1:38952494-38952516 AATAATAATAATAGTAATAATGG - Intergenic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907228652 1:52973900-52973922 AACAATAAAAATAGTGATCAGGG - Intronic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
907637933 1:56155475-56155497 AGCAATAGTGATGGTGATAGTGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909709227 1:78625527-78625549 AACACTGCTGACACTGATAAAGG - Intronic
909769297 1:79400078-79400100 AACAAGACTCAGTGTGATAATGG - Intergenic
910094043 1:83499617-83499639 AAAATTACAGATAGTGAAAAGGG + Intergenic
910422192 1:87078268-87078290 GACACTACTGTTAGTGAGAAGGG + Intronic
910553683 1:88505617-88505639 AAAAAAATTGATATTGATAAAGG + Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911642180 1:100301315-100301337 CACAATACTGTTTGTGATTAAGG - Intergenic
913156712 1:116106810-116106832 AAAAACACTGACAGTGAGAAAGG - Intergenic
914672291 1:149880421-149880443 AACAGTACTGAAAGATATAAAGG + Intronic
914724136 1:150313189-150313211 AATAATAATAATAATGATAATGG + Intergenic
916236084 1:162590372-162590394 AAGAATGCTGATAGTCAGAATGG + Exonic
916953815 1:169810562-169810584 AACACCAGTGATAGTGATTAAGG + Intronic
917414304 1:174792592-174792614 TACGGCACTGATAGTGATAATGG + Intronic
917609769 1:176675707-176675729 AACAATATTCAAAGAGATAATGG + Intronic
917815070 1:178700232-178700254 AACAATACTGGGAATGAAAAAGG - Intergenic
918752236 1:188287405-188287427 AACAATTCTGATAGTATTCATGG + Intergenic
918828436 1:189358169-189358191 AATAATAATAATAGTAATAATGG - Intergenic
919390686 1:196981363-196981385 AATAATACTGATAGTGAAGGGGG + Intronic
921042418 1:211446730-211446752 GAAAATACTGGTAGTGATACTGG - Intergenic
921078952 1:211723642-211723664 AACAAAGCTGAGTGTGATAACGG + Intergenic
921569899 1:216765292-216765314 AACAATAATAATGATGATAATGG + Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922577154 1:226669043-226669065 AATAATAATGATGATGATAATGG - Intronic
923375342 1:233356437-233356459 AACAGTAATAATAATGATAATGG - Intronic
923924434 1:238608680-238608702 AACATTATTGATAGTGACCAAGG - Intergenic
924185743 1:241488023-241488045 CACAAGACTGTTAGTGATACAGG + Intergenic
1064412805 10:15122133-15122155 AAAAATTCTGATATTGAGAAAGG - Intronic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1066308810 10:34174848-34174870 AAAAATAATGACACTGATAATGG + Intronic
1066499449 10:35975724-35975746 AACAATACTGAGAGTGAAAGGGG - Intergenic
1066547922 10:36521056-36521078 AACAATAATAATAGAGAAAAAGG + Intergenic
1066556582 10:36621079-36621101 AACAAAAAAGATAGTAATAAAGG - Intergenic
1067126265 10:43518199-43518221 GACATTACTGATAGTGACCAAGG + Intergenic
1067245970 10:44544229-44544251 AACCAGACAGATAGTGCTAATGG - Intergenic
1067383370 10:45795790-45795812 AATAATACTGCTGGTGATAGTGG - Intergenic
1067497165 10:46771902-46771924 AACAAAACAGAAAATGATAAAGG + Intergenic
1067880797 10:50042996-50043018 AATAATACTGCTGGTGATAGTGG + Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068785724 10:60971065-60971087 ATCAATAATGATAATGATGATGG - Intronic
1069121076 10:64570204-64570226 AATAATAATAATAATGATAATGG - Intergenic
1071017423 10:81014327-81014349 AGCAATACTGGTAGTGGTAATGG - Intergenic
1071606232 10:86993428-86993450 ACCAATAGTGATAGTGGTGACGG + Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073165173 10:101441513-101441535 ACCAATAATGGTAGTGATCAGGG - Intronic
1073386958 10:103133805-103133827 AAAAATATTGATAGTGACATGGG + Intronic
1073815831 10:107205537-107205559 AACCATACTCATAGTGTTATTGG + Intergenic
1074046742 10:109846355-109846377 ATCCATGCTGTTAGTGATAAGGG - Intergenic
1075067229 10:119297324-119297346 AATTATGGTGATAGTGATAATGG - Intronic
1075151548 10:119937227-119937249 AAAAATACTTATAATGACAAAGG - Intronic
1077872582 11:6274638-6274660 AAACATAATGATAATGATAATGG + Intergenic
1078343498 11:10520959-10520981 TACAATGCTGACATTGATAATGG + Intronic
1078421979 11:11219904-11219926 AATAATACTGATAGTTTCAATGG + Intergenic
1080599053 11:33804170-33804192 AACAATAATAATAATAATAATGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081688989 11:45063016-45063038 AACAAAATTGAAAGTGATTAAGG - Intergenic
1082225222 11:49698077-49698099 AAAAATAATGATAATAATAATGG - Intergenic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1086994861 11:93344766-93344788 AACACTTCTGAAAGTCATAATGG + Intronic
1087000118 11:93409838-93409860 AACAATTTTGTTAGTAATAATGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1089401588 11:118167536-118167558 AATAATAATGATGGTGATGATGG - Intronic
1091179044 11:133586934-133586956 AACAATAGTGATGGTGATGATGG + Intergenic
1091507323 12:1085470-1085492 AACAATAATAATAATAATAATGG - Intronic
1091507455 12:1086922-1086944 AACAATAATAATAATAATAATGG - Intronic
1091507653 12:1089073-1089095 AACAATAATAATAATAATAATGG - Intronic
1091557335 12:1584187-1584209 AAAAATAATAATAGTAATAATGG + Intronic
1092613153 12:10192550-10192572 AACAATAATGATGGTGATGGAGG - Intergenic
1092734227 12:11564782-11564804 AACAATAATAATAATGAAAATGG + Intergenic
1093359607 12:18207275-18207297 AACAATAATAATAGTCATAGTGG - Intronic
1093405683 12:18801306-18801328 TGCTATACTGATAGGGATAATGG + Intergenic
1093768896 12:22997318-22997340 AATAATAGTGATAGAAATAATGG - Intergenic
1094322283 12:29198566-29198588 AACATTACTGATAAACATAAAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096130395 12:49154387-49154409 AACAATAATAATAGTAATTAGGG - Intergenic
1096999366 12:55863256-55863278 AATAATAATAATAATGATAAAGG + Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097449640 12:59720798-59720820 AACAGTACTGATGGAGTTAAAGG - Intronic
1097625221 12:61991960-61991982 AAGAAGACTGAAAGTGATACGGG - Intronic
1097751147 12:63354390-63354412 AACATTACTTCAAGTGATAAAGG - Intergenic
1097963942 12:65559172-65559194 AATAATAATGATAATAATAATGG - Intergenic
1098949874 12:76628765-76628787 AACCATATTAATAGTAATAAAGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099878989 12:88443182-88443204 AACAAAACTGATAGAGCTGAAGG + Intergenic
1100698981 12:97125909-97125931 AAAAATAATAATAGTGGTAAGGG - Intergenic
1101035309 12:100700005-100700027 AAAAATAATAATAATGATAATGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101242662 12:102853742-102853764 AAGGATAGTGACAGTGATAATGG + Intronic
1101400567 12:104383252-104383274 AACAATAATAATAATAATAATGG - Intergenic
1101683384 12:106990831-106990853 AACAATACTAATAAAAATAATGG + Intergenic
1102241609 12:111328061-111328083 AACAATAATAATAATGATGAGGG + Intronic
1102431924 12:112890477-112890499 AAGAATACTGGTTGTGTTAAGGG + Intronic
1102909910 12:116705369-116705391 AATAAAATTGATAGTGGTAATGG + Intergenic
1104130052 12:125884768-125884790 GATAATAGTGATGGTGATAATGG - Intergenic
1104974155 12:132544743-132544765 GACAATGGTGATAGTGATTATGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106037341 13:26055886-26055908 AATAGTAATGATAATGATAATGG + Intergenic
1106399223 13:29412356-29412378 ACCAATACTGATAGATCTAAGGG - Intronic
1106509498 13:30400739-30400761 AACAATAATGACAATAATAATGG - Intergenic
1106739185 13:32620669-32620691 AAAAAAAGTGGTAGTGATAACGG + Intronic
1108012583 13:46034821-46034843 AAAAATACTAATAGTGGGAATGG + Intronic
1108303050 13:49100310-49100332 AACACTTCTGAAAGTGAAAAAGG - Intronic
1108902776 13:55433812-55433834 AGTAATACTGAAAGAGATAATGG + Intergenic
1109278525 13:60329099-60329121 AACAATGTTGCTACTGATAAAGG - Intergenic
1109316522 13:60755737-60755759 AAAAATAGTAATATTGATAACGG + Intergenic
1109825682 13:67717903-67717925 AATAGCAATGATAGTGATAATGG + Intergenic
1110252056 13:73391351-73391373 GTCATTACTGAAAGTGATAAGGG + Intergenic
1110381398 13:74855685-74855707 GACAATGGTGATAATGATAATGG + Intergenic
1111881516 13:93963163-93963185 AATAATACTCATAGTGATCTTGG - Intronic
1112204903 13:97315469-97315491 ATCAATACTGATATTGATAATGG + Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113155099 13:107311140-107311162 AACAGTACTGATAGTGGAGATGG - Intronic
1113264340 13:108600794-108600816 AACAGACCTGTTAGTGATAACGG + Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114805536 14:25831666-25831688 AACAATACTAATATTAATATTGG - Intergenic
1115042987 14:28954801-28954823 CATAATACTTATAATGATAATGG + Intergenic
1115088100 14:29541481-29541503 AAGAATAATGATAGTGGTAGGGG + Intergenic
1116075715 14:40108154-40108176 AACAATCCTGAAAGTGAAGATGG - Intergenic
1116400217 14:44497335-44497357 AACAGTACTGAAACTGACAAGGG + Intergenic
1118402631 14:65393950-65393972 AATAATAATAATAATGATAAGGG - Intergenic
1119098128 14:71853308-71853330 AATACCACTGATTGTGATAAAGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1122250740 14:100437632-100437654 AATAATACTAATAATAATAATGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1125617277 15:41026039-41026061 AACAAAGTTGATAGTGACAAGGG + Intronic
1126781264 15:52140643-52140665 AAGAAAACTTAAAGTGATAAAGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126888219 15:53175371-53175393 AAAAATAATGATGATGATAATGG + Intergenic
1128731127 15:70021989-70022011 AATAATAATAATAGTAATAAAGG + Intergenic
1129291598 15:74572422-74572444 TACAACACTGTAAGTGATAAGGG - Intronic
1131458305 15:92600346-92600368 AGCTATACTGATAATGACAATGG + Intergenic
1131791597 15:95971679-95971701 AACAGTACTGATACTGTGAAAGG + Intergenic
1131842982 15:96457918-96457940 GAGAAAACTGAAAGTGATAATGG - Intergenic
1132446735 15:101929156-101929178 AAAAATACTAAGAGTAATAATGG + Intergenic
1132774987 16:1588537-1588559 AATAATAATAATAGTAATAATGG + Intronic
1133856749 16:9556745-9556767 AAGAATAATGATAGTAATCATGG - Intergenic
1133987464 16:10679482-10679504 AACAATGATGATAATGATGATGG - Intronic
1134503018 16:14783930-14783952 AATAATAATAATACTGATAAAGG + Intronic
1134577545 16:15344966-15344988 AATAATAATAATACTGATAAAGG - Intergenic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1134679491 16:16114318-16114340 AATAATAATGATGATGATAATGG - Intronic
1134852500 16:17492028-17492050 AACAAAACTGATGGTGGTAGTGG + Intergenic
1135747325 16:25028218-25028240 CACATTACTGGTAGTGATCAGGG - Intergenic
1136534458 16:30891577-30891599 AATAATAGTGATAGTCATAGGGG - Intronic
1137291447 16:47054679-47054701 AAGATTACTGATATTGTTAAGGG + Intergenic
1137900720 16:52265602-52265624 AACAATACTGGTGATGATTAAGG + Intergenic
1139097123 16:63717903-63717925 AACAAAACTGCTAGTCTTAAAGG + Intergenic
1139711437 16:68779443-68779465 AGCAATACTCACAGTGGTAAGGG - Intronic
1140597356 16:76432000-76432022 AACAATAATGATATTTATATAGG - Intronic
1140993626 16:80239092-80239114 AAAAATACTGAGAATGAAAAAGG - Intergenic
1141029686 16:80576762-80576784 GACTATAGTGATGGTGATAATGG + Intergenic
1141813647 16:86393892-86393914 AATGATGGTGATAGTGATAATGG - Intergenic
1142111024 16:88331608-88331630 AACAATAGTGATGATGATGATGG - Intergenic
1142111040 16:88331749-88331771 AACAATAGTGATGATGATGATGG - Intergenic
1143418347 17:6767655-6767677 AACATCATTGAGAGTGATAAAGG - Intronic
1144086991 17:11818876-11818898 AATAATAATAATAGTAATAATGG - Intronic
1146479620 17:33194388-33194410 AACAACTCTGAGAGTGACAAGGG - Intronic
1146965268 17:37022820-37022842 AATAATAATGACAGTAATAATGG - Intronic
1147553121 17:41459030-41459052 AACAGTAATAATAGTAATAATGG - Intergenic
1148890329 17:50802452-50802474 AACAAGCCTGAGAATGATAATGG - Intergenic
1149667401 17:58375084-58375106 TACAATAGCGATAGTGAGAATGG - Intronic
1152411384 17:80125367-80125389 AACAATTCTGATATCCATAAAGG - Intergenic
1153353961 18:4114705-4114727 AAAAATATTGCTAGAGATAATGG - Intronic
1154015954 18:10617573-10617595 AATAATAATAATAATGATAAGGG + Intergenic
1154189556 18:12218070-12218092 AATAATAATAATAATGATAAGGG - Intergenic
1155392976 18:25355326-25355348 AACAATAAAGATATTGCTAAAGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157465255 18:47938509-47938531 AACAGTGCTGATAGTGAGAGTGG - Intergenic
1158083671 18:53625018-53625040 AACAATACTTATGGGGAAAATGG - Intergenic
1159647886 18:70941415-70941437 AAAAATACACATACTGATAAGGG - Intergenic
1160143180 18:76344242-76344264 AATAATGGTGATAGTGATGATGG + Intergenic
1160459597 18:79028085-79028107 AAAAATACTGAAAGAAATAATGG + Intergenic
1160638484 19:103060-103082 AAAAATACTAAGAGTAATAATGG - Intergenic
1165293997 19:34911437-34911459 AAGAATGGTGATAGGGATAAGGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1167325487 19:48822072-48822094 AACAATGGTGATGGTGATGATGG + Intronic
925205353 2:2001157-2001179 AAAAAAACTAATAGTGATAAAGG - Intronic
925554748 2:5117737-5117759 AATAATAATGATAGTCACAACGG + Intergenic
926112246 2:10190856-10190878 TACAATGCTGAGAGTGATGATGG + Intronic
926155505 2:10451579-10451601 AATAATAATAATAATGATAAGGG - Intergenic
928633181 2:33215143-33215165 AATAATAATAATAATGATAATGG + Intronic
930691177 2:54366734-54366756 AAAAATACTGAAAGTAATAATGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931213878 2:60223843-60223865 AACAATCCAGCTAGTGAGAAGGG - Intergenic
931801133 2:65759012-65759034 AATCACACTGATAGTAATAAAGG + Intergenic
931916960 2:66966893-66966915 AACAATAGTAAAAGTGATCAGGG - Intergenic
932647823 2:73523038-73523060 AACAACACTCATAGTCACAAAGG + Intronic
933067839 2:77820089-77820111 AAAAATACTTATTGTGATACAGG - Intergenic
933638114 2:84729211-84729233 AAGAATACTGAGAGGAATAAGGG - Intronic
935107379 2:100057538-100057560 AATAACACTGATAGTAATATTGG - Intronic
936292009 2:111233400-111233422 ATCAATACTGGAAGTGATAGAGG - Intergenic
936498753 2:113049017-113049039 CACAATAATGATACTGATGATGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937742503 2:125373196-125373218 AACAATAATAATACTAATAACGG + Intergenic
938749547 2:134315410-134315432 AAAAATAGTGATAGGAATAATGG + Intronic
939540496 2:143487866-143487888 GACATTTCTGATAGTGAAAAGGG - Intronic
939918981 2:148085224-148085246 AACAATAATAATAGTGATGTGGG - Intronic
940181227 2:150935424-150935446 AACAAGACTTATAGAAATAAGGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940482998 2:154259584-154259606 AACAATAATGTTAGTGAAAATGG - Intronic
940509121 2:154590202-154590224 AACAAGACTGCTAGAAATAATGG - Intergenic
940592207 2:155743802-155743824 AAATCTACTGATAGTCATAATGG - Intergenic
942762541 2:179416575-179416597 AAAAATAATAATAATGATAACGG + Intergenic
943101514 2:183492602-183492624 AACAATACTCAAAGAAATAATGG - Intergenic
943193720 2:184716028-184716050 TACAAAACTGATAGGAATAATGG - Intronic
944429020 2:199613462-199613484 AACACTCCTGACAGTGATCAAGG + Intergenic
944484781 2:200193729-200193751 GACATTACTGATTTTGATAAAGG - Intergenic
944938370 2:204593982-204594004 ACCAATATTAATAGTGATTATGG + Intronic
945347072 2:208731429-208731451 CACACTAGTGGTAGTGATAATGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946586128 2:221189726-221189748 AAAAATACTGCTGGTGAAAACGG - Intergenic
946667254 2:222063881-222063903 AACAAAATTGATAGTCATCAAGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947491711 2:230601518-230601540 AATAATAATAATAATGATAATGG + Intergenic
947569311 2:231219235-231219257 AAAAATACTGGTAGCTATAAGGG - Intronic
947738404 2:232472393-232472415 AAGTATACTGATAGTCATATGGG + Intergenic
1169934899 20:10872823-10872845 AACAATACTGAGAGCCATAGAGG - Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173459150 20:43228815-43228837 AAAAATAATGACAGTGAGAAGGG - Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1174126006 20:48306923-48306945 AATAATAGTGATAATAATAATGG + Intergenic
1174144767 20:48444505-48444527 AACAATATTGACAGTTAAAATGG + Intergenic
1174456257 20:50650719-50650741 AACAATAGCAATAGTGATATTGG - Intronic
1174919869 20:54690193-54690215 AATAATAATAATAGTGATCAAGG - Intergenic
1175127218 20:56761493-56761515 GATAATAGTGATGGTGATAATGG + Intergenic
1176192851 20:63821309-63821331 AAAAATAATAATAGTAATAATGG - Intronic
1176345436 21:5740435-5740457 AGCAAAACTGATAGAAATAAAGG - Intergenic
1176352250 21:5861019-5861041 AGCAAAACTGATAGAAATAAAGG - Intergenic
1176360363 21:5990505-5990527 AACAATCCTGAAATTCATAATGG - Intergenic
1176499391 21:7584020-7584042 AGCAAAACTGATAGAAATAAAGG + Intergenic
1176539757 21:8138505-8138527 AGCAAAACTGATAGAAATAAAGG - Intergenic
1176558708 21:8321550-8321572 AGCAAAACTGATAGAAATAAAGG - Intergenic
1177069627 21:16487314-16487336 GGCAACACTGATAGTGACAAAGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177673486 21:24266114-24266136 ATCAAGACTGTTAGTGATAATGG + Intergenic
1179763155 21:43548045-43548067 AACAATCCTGAAATTCATAATGG + Intronic
1180652351 22:17388519-17388541 AACAGTACTGCTAGTGAGACAGG + Intronic
1183105862 22:35614734-35614756 AATGATAATGATAATGATAATGG - Intronic
1203244708 22_KI270733v1_random:54860-54882 AGCAAAACTGATAGAAATAAAGG - Intergenic
949328936 3:2899867-2899889 AACAATGATGATAGTCTTAAAGG + Intronic
949779180 3:7666583-7666605 AACAATAATAACAATGATAACGG + Intronic
950128626 3:10526848-10526870 AACCATGATGATAGTGATGATGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951169746 3:19527286-19527308 AAGAATAGTTATAGAGATAACGG + Intronic
951338245 3:21451866-21451888 AACAATCTTGATGCTGATAATGG - Intronic
951458907 3:22927446-22927468 AACAATACTGAGAGAAATTAAGG + Intergenic
952112128 3:30136256-30136278 GACAATACAGACTGTGATAAGGG + Intergenic
953005732 3:38977552-38977574 AACAACACTAACAGTGGTAATGG - Intergenic
954274538 3:49533572-49533594 AACAGTACAGTTAGTGTTAAAGG - Exonic
954851142 3:53601663-53601685 AACAATAATGATAATAATCATGG + Intronic
956060391 3:65342760-65342782 AACAATGATGATGGTTATAAAGG + Intergenic
957299433 3:78372208-78372230 AATAATACTTATAGGCATAAAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG + Intergenic
960738835 3:120810542-120810564 AAAAATAATGATAATGAAAAGGG + Intergenic
961668314 3:128507935-128507957 AACAATACTGTGAGAGAAAAAGG + Intergenic
962298365 3:134214500-134214522 AACATTACTGACAGTCATATTGG + Intronic
962545072 3:136425927-136425949 AACAAGAATGACAGTGCTAATGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
964061081 3:152523501-152523523 AACAATACTAATAATAACAAAGG - Intergenic
964124425 3:153221401-153221423 AACAATTATGATAATAATAAAGG - Intergenic
964321552 3:155503506-155503528 AACAATACTTATATTGAGATTGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964708970 3:159651515-159651537 AACTATATTGTTAGTAATAATGG - Intronic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967585289 3:191206433-191206455 AAAAATACTGAAAGTGAAAGAGG + Intronic
967804228 3:193700523-193700545 AACAATACTTTCTGTGATAATGG - Intergenic
968592836 4:1467682-1467704 GACAATGGTGATGGTGATAATGG + Intergenic
968864753 4:3201190-3201212 AACAATACAGAAGGTTATAAAGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969234585 4:5856712-5856734 AGCGATAATGATAGTGATGACGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970937117 4:21585997-21586019 AACAATAATGATACTGTTTAAGG + Intronic
971470127 4:27015874-27015896 AACAATATTCAAAGAGATAATGG - Intronic
971903848 4:32699718-32699740 AACAATTTTGATAGTGACCAAGG + Intergenic
972087599 4:35239881-35239903 TACACTACTGATAGTGAACAAGG + Intergenic
972366548 4:38380832-38380854 AAGAATATTAATAATGATAATGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974365014 4:60935363-60935385 AATAATAATAATAGTAATAATGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975135298 4:70868690-70868712 AACAATACTGATAACTATTATGG + Intergenic
975223923 4:71847194-71847216 GACATTATTGATAGTGATGAAGG + Intergenic
976652259 4:87448463-87448485 AAAATTACTGGTAGTGAAAAAGG - Intronic
977374173 4:96180240-96180262 AATAATAATGATAATAATAATGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977820471 4:101465764-101465786 AATATTTCTGAAAGTGATAATGG - Intronic
978029502 4:103922123-103922145 AAACTTACTGAAAGTGATAACGG - Intergenic
978274426 4:106932468-106932490 TACAATACTGATATTGATCATGG + Intronic
978407853 4:108398740-108398762 AACAATTCTGATAATCATCAAGG - Intergenic
978542528 4:109833998-109834020 AACTATACAGATAATGATGAAGG + Intronic
978680218 4:111371283-111371305 AACAATAACAATAGTAATAATGG + Intergenic
979301688 4:119094039-119094061 AAACAGACTCATAGTGATAAGGG - Intergenic
979844242 4:125488550-125488572 AACCAAACTGTTAGTGATTATGG + Intronic
979959195 4:126995901-126995923 AATAATAATAATAATGATAAAGG - Intergenic
980146876 4:128996571-128996593 AACAAGACTGATAAGTATAAAGG - Intronic
980324318 4:131322788-131322810 CACAATACTGTTATTCATAATGG - Intergenic
980402966 4:132316756-132316778 AACGAAACTGATAAAGATAAGGG - Intergenic
980415103 4:132477377-132477399 TGGAACACTGATAGTGATAAAGG - Intergenic
980467278 4:133202453-133202475 AACATTATTGATAGTGACTAAGG - Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982194347 4:152895225-152895247 TACAATAGTGATAGTGGAAATGG + Intronic
982928699 4:161373609-161373631 ACCAATACTAATAGTGCTACTGG - Intergenic
982975277 4:162048514-162048536 AATAATACTGATAGTAGTGAAGG - Intronic
983323663 4:166226964-166226986 AACAATAGTGATGGTGACAATGG + Intergenic
983347853 4:166549579-166549601 AAAAATATTGATAGTCAGAAAGG + Intergenic
983649545 4:170025071-170025093 AATAATCCTAATAGTGTTAATGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983891889 4:173038076-173038098 AAAAATACAGATAGTGAAGAGGG + Intronic
984033670 4:174637974-174637996 AAGAATAAAGCTAGTGATAAGGG + Exonic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
984790175 4:183607800-183607822 TACTATACTGCTAGTGATACAGG - Intergenic
986812182 5:11372382-11372404 GAAAATAATGATAGTGGTAACGG + Intronic
987147875 5:15010474-15010496 AATAATAATGATAATGATACAGG + Intergenic
987251046 5:16101870-16101892 AACAACACTGTTAGTAATTAGGG + Intronic
988020200 5:25611292-25611314 AAAAATAATAATAATGATAATGG + Intergenic
988048561 5:25992174-25992196 CACAAAACTGTTAGTGATTAGGG + Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988954456 5:36300748-36300770 AAAAAGACTGATGGTGAAAATGG + Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989959100 5:50389139-50389161 AACAATACTAACAGTGTAAATGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990613869 5:57487361-57487383 AACAATAAAAATAGTGATTACGG + Intergenic
991239940 5:64446084-64446106 AAGTATACTGAGAGTGATCAAGG - Intergenic
992021509 5:72629254-72629276 AACAAAACTGAAAGTTAAAATGG + Intergenic
992157538 5:73970006-73970028 AACTATACTGTTAAAGATAAGGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993804686 5:92390357-92390379 AATAAGAATGATATTGATAATGG + Intergenic
993956606 5:94242320-94242342 AAGCATGCTGATAGTGGTAATGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994740622 5:103613285-103613307 AACAACTCTGATAGGGATGATGG + Intergenic
995875378 5:116783947-116783969 ATCATTTCTGATAGTTATAAGGG + Intergenic
996675005 5:126165178-126165200 AACAATACTGGGAGTGAGAGGGG - Intergenic
996726310 5:126675746-126675768 AACAATAATAATAATAATAAAGG - Intergenic
996932779 5:128910340-128910362 AGCACTTCTGATAGTGAAAAAGG + Intronic
997047589 5:130337597-130337619 AACAATAGAGATTTTGATAATGG + Intergenic
998034081 5:138898736-138898758 GACAATGCTGAAAGAGATAATGG - Intronic
999807337 5:155094776-155094798 AACAACAATGATGGTGATAAAGG + Intergenic
999909396 5:156181294-156181316 AATATTACTGAGAGTGATTAAGG + Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000800178 5:165715936-165715958 AACACATCTCATAGTGATAATGG - Intergenic
1000961780 5:167609224-167609246 AACAAAACTGAGAATGAGAAAGG + Intronic
1002799157 6:504532-504554 AACGTTACTGATAGTGACATTGG - Intronic
1003147697 6:3522672-3522694 ATGAATACTGATTGTGATAAAGG + Intergenic
1003185128 6:3823782-3823804 AACAATAATGATAGTAATGATGG - Intergenic
1004511411 6:16286947-16286969 AACAACCCTGATAGTGACAAAGG + Intronic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1004562833 6:16767262-16767284 AACAACACTGATACAGATATTGG + Intergenic
1007817958 6:44538129-44538151 GACAATGCTGATGGTGACAAGGG + Intergenic
1008266230 6:49430006-49430028 AAAAATAAGGATAGTAATAAAGG + Intergenic
1009008231 6:57812875-57812897 AATAATAATAATAATGATAAGGG + Intergenic
1009331393 6:62425142-62425164 AAAAATACTGGTAGTCAAAATGG + Intergenic
1009608812 6:65909612-65909634 AAAAATACTGATAACAATAAGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1009856194 6:69267404-69267426 CACAATACTGAAATTAATAATGG - Intronic
1010454190 6:76035832-76035854 AACAATACTGAGTTTGAGAAAGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010977610 6:82333600-82333622 AATAATACTGTTATTGAAAAAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012568263 6:100688103-100688125 AACAATATTGATTTTAATAAAGG + Intronic
1013746788 6:113355375-113355397 AATAATAATGATAATGATAATGG - Intergenic
1013947418 6:115737557-115737579 AGCAATATTGAAAGTTATAAAGG + Intergenic
1013984035 6:116168170-116168192 AACAATATTTTTAGAGATAATGG - Intronic
1015714313 6:136175268-136175290 AATAATAATGATTATGATAATGG - Intronic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1018196479 6:161359928-161359950 AACAATAATAATAGTGATAATGG + Intronic
1018371714 6:163174765-163174787 AACAATAATGATGATGATGATGG - Intronic
1018913742 6:168120075-168120097 AAAAATAATGATGATGATAATGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019918322 7:4147606-4147628 AATAATAATGATAGTGGTAATGG - Intronic
1020589120 7:10112647-10112669 GACAAGAATGATAATGATAATGG + Intergenic
1020790667 7:12624691-12624713 AAGAATAGTGATAATAATAATGG - Intronic
1023066913 7:36387642-36387664 AATGATGATGATAGTGATAATGG - Intronic
1026095471 7:67343092-67343114 CACAAAACTGATATTGATACTGG - Intergenic
1026249088 7:68651680-68651702 AACAAAACTAAAAGTGATTAAGG - Intergenic
1028235414 7:88355300-88355322 AACAATACTCAGAAGGATAAAGG + Intergenic
1028625980 7:92877479-92877501 AACAATTCTTATATTTATAATGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031323985 7:120368671-120368693 AACCAAACTGAAAATGATAAAGG - Intronic
1034826120 7:154264715-154264737 AATGATAGTGATAGTGACAATGG + Intronic
1034826125 7:154264817-154264839 AATGATAGTGATAGTGATGATGG + Intronic
1034826130 7:154264898-154264920 AATGATAGTGATAGTGATGATGG + Intronic
1034826136 7:154265003-154265025 AATGATAGTGATAGTGATGATGG + Intronic
1034826144 7:154265105-154265127 AATGATAGTGATAGTGATGATGG + Intronic
1034826150 7:154265180-154265202 AATGATAGTGATAGTGATGATGG + Intronic
1036836623 8:12075362-12075384 AACAATGCTGAAAGAAATAAGGG - Intergenic
1037873809 8:22526665-22526687 AACAACATTGCTGGTGATAAAGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039372429 8:37000313-37000335 TACAATACTAGAAGTGATAAAGG + Intergenic
1040704402 8:50108460-50108482 AACAATATTGAGAGTGAAGAAGG + Intronic
1040801034 8:51340516-51340538 AACAATTTTGAAAGTTATAATGG - Intronic
1043030289 8:75125830-75125852 AAGAATACAGAAAGTGTTAAAGG + Intergenic
1043576056 8:81657913-81657935 AAAAATAATAATAATGATAATGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044194388 8:89356877-89356899 AACAATATTAGAAGTGATAAAGG + Intergenic
1044696057 8:94923418-94923440 AACATTACTAATAGTTCTAAAGG + Intronic
1044792339 8:95860739-95860761 AATAATACTTGTAGTTATAAAGG + Intergenic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1047333200 8:123911339-123911361 AATAATAATAATAGTGACAATGG + Intronic
1047827134 8:128589132-128589154 AACAATTATGCTAGTGGTAACGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048766522 8:137850498-137850520 AATAATAATGTTAATGATAAGGG - Intergenic
1050697877 9:8299174-8299196 AGCCATAATGATTGTGATAAGGG + Intergenic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051929320 9:22366334-22366356 AATAATATTGATAGTAATAGTGG - Intergenic
1052324709 9:27205258-27205280 AACAATTTTGAGAGTGAAAAGGG + Intronic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1052873613 9:33533877-33533899 AATAATAATAATAATGATAATGG - Intronic
1053045816 9:34916180-34916202 AACACTATTTATAGTGATAGAGG - Intergenic
1055190850 9:73522060-73522082 AACAATACTCATATTAGTAAAGG - Intergenic
1057681874 9:97195276-97195298 AATAATAATAATAATGATAATGG + Intergenic
1058657601 9:107237853-107237875 AATAATAATGACAATGATAAGGG - Intergenic
1059025439 9:110623199-110623221 AACACTAATGATAGTATTAAGGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059676083 9:116541356-116541378 GACAATACAGAGAGTGAGAAAGG + Intronic
1060880591 9:127115427-127115449 GACAATATTGAGAGTGAAAAGGG - Intronic
1203461040 Un_GL000220v1:37943-37965 AGCAAAACTGATAGAAATAAAGG - Intergenic
1185683091 X:1905043-1905065 AATGATGGTGATAGTGATAATGG + Intergenic
1186089621 X:6031437-6031459 AACAATACTCAAAATGTTAAGGG + Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1189067942 X:37831302-37831324 AATAATAATAATAGTAATAATGG + Intronic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189530763 X:41880115-41880137 AACAACACTGAGAGAGATCAAGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193744436 X:85258576-85258598 AATAATAATAATAATGATAATGG + Intronic
1193802261 X:85950631-85950653 AACAATACTTATAAAGATATTGG + Intronic
1193868875 X:86772197-86772219 AATAATAGTAATAGTTATAAAGG - Intronic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194215039 X:91119917-91119939 ATCAATATTGATGGTGATAAAGG + Intergenic
1194675650 X:96790570-96790592 GACAATACTGTTTCTGATAAGGG - Intronic
1194699975 X:97102482-97102504 AACAATAATGTTAATGATAATGG - Intronic
1194806096 X:98330025-98330047 AACAATACAGATATTCAGAATGG + Intergenic
1194862625 X:99021450-99021472 AACAACACTGGAAGTGAAAAGGG - Intergenic
1196625045 X:117868812-117868834 GACATTACAGATTGTGATAAGGG - Intergenic
1197153532 X:123245809-123245831 ATCATTAGTAATAGTGATAAAGG + Intronic
1197410599 X:126110855-126110877 CACAAGACTGATAGTACTAAGGG + Intergenic
1198512457 X:137366196-137366218 GTCAATACTGATAGTCACAAAGG + Intergenic
1198755713 X:139980216-139980238 AACAATAGTAATAATAATAATGG - Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199539531 X:148943924-148943946 GACAATACTGATAAGGAGAATGG + Intronic
1199870958 X:151898398-151898420 AAAAATATTGATAATGATGATGG - Intergenic
1200069440 X:153520517-153520539 AACAATGATAATAGTTATAATGG + Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1200902300 Y:8444943-8444965 AACAATTCTGATTGTGGGAATGG + Intergenic