ID: 1004545453

View in Genome Browser
Species Human (GRCh38)
Location 6:16594270-16594292
Sequence CCATTCCTAGGCAATAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004545453 Original CRISPR CCATTCCTAGGCAATAACCC AGG (reversed) Intronic
900583230 1:3419482-3419504 CCACTCCCAGGCACTGACCCCGG - Intronic
901536694 1:9887047-9887069 CCATTCTTAGGGGATAAGCCTGG + Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
908033290 1:60024707-60024729 CCATTCCTATGCAATAAGCTAGG + Intronic
913347959 1:117826954-117826976 CCCTTCCTAGGCAATGACCTTGG + Intergenic
914689182 1:150010511-150010533 TCATTCCTCGGCAGTGACCCCGG + Exonic
921948382 1:220904749-220904771 CCATTCCCAGGAAATTACACTGG + Intergenic
1063887623 10:10595608-10595630 CCTTTCCATGGCAATGACCCAGG + Intergenic
1074821445 10:117182311-117182333 CCTTGCCTAGACAATCACCCAGG + Intergenic
1078204346 11:9215046-9215068 CTCTTCCAAGGCACTAACCCAGG + Intronic
1080302137 11:30796631-30796653 CCATTTCTAGACAATATGCCAGG - Intergenic
1081029134 11:38055759-38055781 CCATTACCAGTCAATATCCCTGG - Intergenic
1082075882 11:47975809-47975831 CTATTCATAGGCAATGACCGTGG + Intergenic
1082829088 11:57602165-57602187 CCATTCCTGGGCACTCACCTGGG - Exonic
1086968953 11:93059714-93059736 CCATCTCTAGGTAATTACCCAGG + Intergenic
1087506073 11:99022825-99022847 CAATTCCTAAGCAAAAACACTGG - Intronic
1090200115 11:124848005-124848027 CTATTCCAAGGCAATTACACTGG - Intergenic
1090424160 11:126595382-126595404 CCAATCCTGGGCGATAAACCTGG - Intronic
1092296878 12:7207893-7207915 CCTATCCTAGGCCATCACCCAGG - Intronic
1093134714 12:15437022-15437044 CCATTCCTAGGCAGAAATCTGGG + Intronic
1094637799 12:32243412-32243434 CTATCCCTAAGAAATAACCCTGG - Intronic
1095963519 12:47851101-47851123 CCATACCTAGGGAAGAGCCCTGG - Intronic
1097718491 12:62994440-62994462 CCATTTCTAGGCAATAGGCAAGG - Intergenic
1108222323 13:48248559-48248581 CCATTCCTAGGTATAAATCCTGG - Intronic
1115785835 14:36824900-36824922 CCATTCATAGTCTATACCCCTGG - Intronic
1117727719 14:58691019-58691041 CCATCCCTAGGGAATAATCAGGG - Intergenic
1117772064 14:59143414-59143436 TCATTCCTAAATAATAACCCTGG + Intergenic
1121061852 14:90918037-90918059 CCATTCCTGGGTAATTACCAAGG - Intronic
1121519839 14:94578428-94578450 CCCTCCCTAGGCAGTCACCCTGG + Intronic
1125611228 15:40972143-40972165 CCATTCCTAGGTACATACCCAGG - Intergenic
1125773073 15:42185075-42185097 CCATTCCCAGGCATTTGCCCAGG + Intronic
1131309088 15:91271386-91271408 CCAGACCTTGGCAATAACACTGG - Intronic
1131362127 15:91802566-91802588 CGGTTCAGAGGCAATAACCCAGG + Intergenic
1133595183 16:7284275-7284297 CCACTCCTAGGAATTTACCCAGG - Intronic
1138349006 16:56336532-56336554 CCATCCCCAGGCACTACCCCTGG - Intronic
1147675297 17:42201163-42201185 CCATTCCTACCCAAGAACACAGG + Exonic
1151646845 17:75438328-75438350 CCACTCCTAGGCATCTACCCAGG + Intergenic
1156360845 18:36383193-36383215 CCATTCCTAGGTGACATCCCAGG - Intronic
1157147327 18:45177185-45177207 CCATTCCTACTCAACTACCCTGG + Intergenic
1158729553 18:60007913-60007935 CCATTTCTAAGCAGTCACCCAGG - Intergenic
1160907402 19:1457913-1457935 CCATTCCCAGGAAATGTCCCAGG - Intronic
1162600401 19:11664326-11664348 CCATCCCCAGGCACTGACCCTGG - Intergenic
1165320014 19:35079460-35079482 CCATTCCTGGGCACTCACCCAGG + Intergenic
1165540254 19:36487326-36487348 CCACTCCTAAGTATTAACCCGGG + Intronic
929620091 2:43346019-43346041 CCATTCCTGGTGAATAACCAGGG - Intronic
938391649 2:130911435-130911457 CCATTCCCAGGACATAACCCTGG + Intronic
938830490 2:135045615-135045637 ACATTGCTAGGTAATAACCTTGG - Intronic
940003251 2:148987886-148987908 CCATTCCTAGGCCACACCCAAGG - Intronic
945895298 2:215474441-215474463 TCATTCCTAGGCAAAAAGCCAGG + Intergenic
948547136 2:238740800-238740822 CCACTCCTAGGCATGTACCCAGG + Intergenic
1171152229 20:22837342-22837364 CTATTCCCAGGCATTAACTCTGG - Intergenic
1171307253 20:24117095-24117117 CCATTCCTAGTTACTTACCCTGG + Intergenic
1172333678 20:34095936-34095958 CCATTCCCAGACAGTAACCCAGG + Intronic
1174920323 20:54695133-54695155 TCATTTCTAGGCACTAACACAGG + Intergenic
1175447797 20:59036418-59036440 CCATTCCCAGGAAATGAACCAGG + Intronic
1181367204 22:22387236-22387258 CCATTACGGGGCAATATCCCTGG + Intergenic
1182292129 22:29288499-29288521 CAATTCCAAGGCACTAACCAAGG - Intronic
1182837894 22:33359415-33359437 CCATTCCCAGCCAATCATCCTGG + Intronic
1203286846 22_KI270734v1_random:159006-159028 CCATGCCTAGGCATGAGCCCAGG + Intergenic
951232784 3:20199233-20199255 CCCTTCCTAGGCACTAGTCCAGG - Intergenic
955370552 3:58347725-58347747 CCATTCCTAGGCATTCACTCAGG - Intronic
959548184 3:107622430-107622452 CCACTCCTAGGTATTAACCCTGG - Intronic
961141582 3:124560890-124560912 GCATTCCCAGGCCCTAACCCAGG + Intronic
963231522 3:142912960-142912982 TCATTCCTAGGTAATGATCCAGG - Intergenic
965090145 3:164151111-164151133 CCATTCCTAGAGAAAAACCAAGG + Intergenic
968601206 4:1510408-1510430 CCACTCCTAGGCATTTACCCAGG - Intergenic
973228896 4:47819548-47819570 CCATTCCTATGCAAAAAAGCAGG + Intronic
980961722 4:139482140-139482162 TCATTCCTAGGCAACACCCTAGG + Intergenic
981355264 4:143782978-143783000 CTATTCTTAGGCAATCTCCCAGG + Intergenic
986484034 5:8217385-8217407 GCACTCCAAGGCAAGAACCCGGG + Intergenic
987962169 5:24824303-24824325 CCATTCCCAGGCAGTAATCCAGG - Intergenic
992783320 5:80147548-80147570 CCATTCCATGGCAGTTACCCAGG - Intronic
993498687 5:88638892-88638914 CCACTCCTAGGTATTTACCCAGG + Intergenic
993772110 5:91941729-91941751 ACATTCCTAGGCTATAAAACTGG - Intergenic
994886145 5:105564202-105564224 CCAGTACAAGGCAAGAACCCGGG + Intergenic
996620097 5:125490016-125490038 CCACTCCTAGGAATTTACCCAGG - Intergenic
997229752 5:132233899-132233921 CTGTCCCTAGGCAATATCCCTGG + Intronic
997628383 5:135347313-135347335 CCAGTCCTAGCCATTAGCCCTGG - Intronic
998350777 5:141499190-141499212 CCCTTCTTAGGCTGTAACCCAGG + Intronic
999682968 5:154076852-154076874 CCTTCTCTAGGCAAAAACCCAGG + Intronic
1001996358 5:176162684-176162706 CCATTCCTGGGCTGTATCCCAGG + Intergenic
1003473355 6:6458677-6458699 CCTTTCCTGGGCTCTAACCCTGG - Intergenic
1003594920 6:7465908-7465930 CCACTCCTAGGTAAGAAGCCTGG + Intergenic
1004173850 6:13321725-13321747 CCAGTCCGAGGCTAGAACCCAGG - Intronic
1004545453 6:16594270-16594292 CCATTCCTAGGCAATAACCCAGG - Intronic
1005307663 6:24529484-24529506 AGATTTCTTGGCAATAACCCTGG - Intronic
1006504654 6:34480732-34480754 CCATTCCTTTGCATAAACCCTGG - Intronic
1006837437 6:37007509-37007531 CTCTGCCCAGGCAATAACCCTGG + Intronic
1008876558 6:56335851-56335873 GCATTCCTTGGCAATTACCTTGG - Intronic
1011638986 6:89401772-89401794 CACTTCCTGGGCCATAACCCTGG + Intronic
1016528800 6:145035535-145035557 CCATTCCGAAGCAATAACAAAGG + Intergenic
1020845919 7:13283429-13283451 CCATTCTTGGACAATAACACTGG - Intergenic
1022298763 7:29082951-29082973 CCATTATTTGGCAACAACCCTGG - Intronic
1031243043 7:119270443-119270465 CCATTCCTATGCAGAGACCCTGG - Intergenic
1031501089 7:122517403-122517425 CCACTCCTAGGTATTTACCCAGG - Intronic
1031624663 7:123978141-123978163 CCACTCCTAGGCATTTACCGAGG + Intergenic
1032557475 7:132852260-132852282 CCATTCCTAGGACTTACCCCTGG - Intronic
1035824141 8:2626776-2626798 AAATTCCTAGGCAGTAACACAGG + Intergenic
1046210573 8:111069199-111069221 CAATTCCTAGGTATTAAGCCTGG + Intergenic
1047749248 8:127867425-127867447 ACATTCCTCGGCAGTATCCCGGG + Intergenic
1048960699 8:139574354-139574376 CCATTCCTAGGTATAAACCTAGG - Intergenic
1057012980 9:91622975-91622997 CTATTCCTAGGTATAAACCCAGG - Intronic
1057455880 9:95209765-95209787 CCATTCCAAGGTAATCACTCTGG + Intronic
1057603278 9:96478480-96478502 CCACTCCTAGGTATTTACCCAGG - Intronic
1186101797 X:6165195-6165217 CCATCTCTAGGAAATAACCAAGG + Intronic
1186980375 X:14952154-14952176 CAATGCCCAGGCAATAACCCAGG + Intergenic
1190623457 X:52312651-52312673 CCATTCCCCCACAATAACCCTGG + Intergenic
1191975193 X:66863860-66863882 CCATTCTTGGGCAAAAGCCCAGG + Intergenic
1200001293 X:153061700-153061722 CCATTCCTAGGTATTTACTCGGG - Intergenic