ID: 1004545802

View in Genome Browser
Species Human (GRCh38)
Location 6:16597188-16597210
Sequence AATTCTCCTCCTTCCACCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004545802_1004545807 -4 Left 1004545802 6:16597188-16597210 CCTCCGGTGGAAGGAGGAGAATT 0: 1
1: 0
2: 3
3: 8
4: 133
Right 1004545807 6:16597207-16597229 AATTCCTTTGGGCTTTGTAAGGG No data
1004545802_1004545810 23 Left 1004545802 6:16597188-16597210 CCTCCGGTGGAAGGAGGAGAATT 0: 1
1: 0
2: 3
3: 8
4: 133
Right 1004545810 6:16597234-16597256 TCGTCAGCCGCAAGAATCTCCGG 0: 1
1: 0
2: 1
3: 1
4: 21
1004545802_1004545812 25 Left 1004545802 6:16597188-16597210 CCTCCGGTGGAAGGAGGAGAATT 0: 1
1: 0
2: 3
3: 8
4: 133
Right 1004545812 6:16597236-16597258 GTCAGCCGCAAGAATCTCCGGGG No data
1004545802_1004545811 24 Left 1004545802 6:16597188-16597210 CCTCCGGTGGAAGGAGGAGAATT 0: 1
1: 0
2: 3
3: 8
4: 133
Right 1004545811 6:16597235-16597257 CGTCAGCCGCAAGAATCTCCGGG No data
1004545802_1004545806 -5 Left 1004545802 6:16597188-16597210 CCTCCGGTGGAAGGAGGAGAATT 0: 1
1: 0
2: 3
3: 8
4: 133
Right 1004545806 6:16597206-16597228 GAATTCCTTTGGGCTTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004545802 Original CRISPR AATTCTCCTCCTTCCACCGG AGG (reversed) Intronic