ID: 1004545803

View in Genome Browser
Species Human (GRCh38)
Location 6:16597191-16597213
Sequence AGGAATTCTCCTCCTTCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004545803_1004545806 -8 Left 1004545803 6:16597191-16597213 CCGGTGGAAGGAGGAGAATTCCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1004545806 6:16597206-16597228 GAATTCCTTTGGGCTTTGTAAGG No data
1004545803_1004545810 20 Left 1004545803 6:16597191-16597213 CCGGTGGAAGGAGGAGAATTCCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1004545810 6:16597234-16597256 TCGTCAGCCGCAAGAATCTCCGG 0: 1
1: 0
2: 1
3: 1
4: 21
1004545803_1004545812 22 Left 1004545803 6:16597191-16597213 CCGGTGGAAGGAGGAGAATTCCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1004545812 6:16597236-16597258 GTCAGCCGCAAGAATCTCCGGGG No data
1004545803_1004545807 -7 Left 1004545803 6:16597191-16597213 CCGGTGGAAGGAGGAGAATTCCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1004545807 6:16597207-16597229 AATTCCTTTGGGCTTTGTAAGGG No data
1004545803_1004545811 21 Left 1004545803 6:16597191-16597213 CCGGTGGAAGGAGGAGAATTCCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1004545811 6:16597235-16597257 CGTCAGCCGCAAGAATCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004545803 Original CRISPR AGGAATTCTCCTCCTTCCAC CGG (reversed) Intronic