ID: 1004545808

View in Genome Browser
Species Human (GRCh38)
Location 6:16597211-16597233
Sequence GGTTCCCTTACAAAGCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004545808_1004545814 15 Left 1004545808 6:16597211-16597233 CCTTTGGGCTTTGTAAGGGAACC No data
Right 1004545814 6:16597249-16597271 ATCTCCGGGGTATAAGACATAGG 0: 1
1: 0
2: 0
3: 1
4: 57
1004545808_1004545812 2 Left 1004545808 6:16597211-16597233 CCTTTGGGCTTTGTAAGGGAACC No data
Right 1004545812 6:16597236-16597258 GTCAGCCGCAAGAATCTCCGGGG No data
1004545808_1004545810 0 Left 1004545808 6:16597211-16597233 CCTTTGGGCTTTGTAAGGGAACC No data
Right 1004545810 6:16597234-16597256 TCGTCAGCCGCAAGAATCTCCGG 0: 1
1: 0
2: 1
3: 1
4: 21
1004545808_1004545811 1 Left 1004545808 6:16597211-16597233 CCTTTGGGCTTTGTAAGGGAACC No data
Right 1004545811 6:16597235-16597257 CGTCAGCCGCAAGAATCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004545808 Original CRISPR GGTTCCCTTACAAAGCCCAA AGG (reversed) Intronic