ID: 1004545811

View in Genome Browser
Species Human (GRCh38)
Location 6:16597235-16597257
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004545808_1004545811 1 Left 1004545808 6:16597211-16597233 CCTTTGGGCTTTGTAAGGGAACC No data
Right 1004545811 6:16597235-16597257 CGTCAGCCGCAAGAATCTCCGGG No data
1004545802_1004545811 24 Left 1004545802 6:16597188-16597210 CCTCCGGTGGAAGGAGGAGAATT 0: 1
1: 0
2: 3
3: 8
4: 133
Right 1004545811 6:16597235-16597257 CGTCAGCCGCAAGAATCTCCGGG No data
1004545803_1004545811 21 Left 1004545803 6:16597191-16597213 CCGGTGGAAGGAGGAGAATTCCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1004545811 6:16597235-16597257 CGTCAGCCGCAAGAATCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type