ID: 1004547113

View in Genome Browser
Species Human (GRCh38)
Location 6:16608522-16608544
Sequence CTAGTAGGAGAGCGCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004547109_1004547113 6 Left 1004547109 6:16608493-16608515 CCTTAAAATATGTTGGCATTCTT 0: 1
1: 0
2: 3
3: 43
4: 345
Right 1004547113 6:16608522-16608544 CTAGTAGGAGAGCGCCTGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004547113 Original CRISPR CTAGTAGGAGAGCGCCTGCA AGG Intronic
903571910 1:24311909-24311931 CTGGAAGGAGAGGGCCTGCTGGG - Intergenic
907159039 1:52358089-52358111 CCAGCAGGAGAGAGACTGCAGGG + Intronic
914984264 1:152442666-152442688 CTAGTAAGAGAGGCCCAGCATGG + Intergenic
922007824 1:221550349-221550371 CTGGTAGCAGAGGGTCTGCATGG + Intergenic
1062945039 10:1454142-1454164 CAGGTAGGAGAGCGTGTGCAGGG + Intronic
1064580017 10:16784699-16784721 CAAGTAAGAGAGCGTATGCAGGG + Intronic
1073466271 10:103696216-103696238 CTATTAGGGCAGCGCCTGCTCGG - Intronic
1075960045 10:126560580-126560602 CTACTAAGAGAGCCCCAGCACGG + Intronic
1077848491 11:6051124-6051146 CTAAGAGGAGGGCCCCTGCAAGG - Intergenic
1089379650 11:118018655-118018677 CCAGTAGGAAAGCACCAGCAGGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090172530 11:124617266-124617288 GGAGTAGGGGAGGGCCTGCAGGG - Exonic
1100756693 12:97759001-97759023 CCAGTAGGAAAGAGCCTTCATGG + Intergenic
1103984690 12:124759446-124759468 CTTCTAGGAGAGGGTCTGCAGGG + Intergenic
1104609212 12:130214889-130214911 CTTGTAGGAGAGCATCTGGAAGG + Intergenic
1114640498 14:24216441-24216463 CTGGTTGGAGAACGCCTTCAAGG - Intronic
1114693154 14:24604146-24604168 CTAGTAAGAGAGTGCCTGGTGGG - Intergenic
1119020583 14:71108741-71108763 CTAGTAGAAGAGCGCCGACAAGG - Exonic
1121533901 14:94677953-94677975 CTTGTAGGAGGGAGCCTGCAGGG - Intergenic
1124723711 15:32136044-32136066 ATAGTAGCACAGCCCCTGCACGG - Intronic
1133180699 16:4052076-4052098 CTGGCAGGAGAGTCCCTGCAGGG - Intronic
1133249187 16:4469166-4469188 CTAGGAGCAGAGCGCCTGGGAGG - Intronic
1134464160 16:14458544-14458566 CTACAAAGAGAGTGCCTGCAAGG - Intronic
1136359557 16:29769897-29769919 GTAGTATGAGAGAGGCTGCAGGG - Intergenic
1139599975 16:67980545-67980567 CAAGCAGGAGAGCGCCCCCATGG + Exonic
1141780401 16:86156249-86156271 GTAGCAGTAGAGCGCCTGCTGGG + Intergenic
1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG + Intronic
1144383919 17:14730976-14730998 CTACTAGGAGAGTGGCTGGAGGG - Intergenic
1146574197 17:33977627-33977649 CTCTTAGGAGAGGGCCTGAAAGG - Intronic
1148451512 17:47781119-47781141 CTAGTAAGGGAGGGCCTGAAGGG - Intergenic
1154466174 18:14643911-14643933 GTGGTAGGAGAGTGTCTGCAGGG + Intergenic
1163773392 19:19204089-19204111 CTAGTAGGCGCGCGCCACCACGG + Intergenic
1167385133 19:49158384-49158406 CTAGAGGGAGAGCGTCGGCAAGG - Intronic
925231709 2:2238675-2238697 TTAGTAGCAGAGCTCCTACACGG - Intronic
928279026 2:29927982-29928004 CTATCATGAGAGGGCCTGCAAGG + Intergenic
930155673 2:48105535-48105557 CGAGTAGGTGAGTGCCTGGAAGG + Intergenic
931894781 2:66716595-66716617 CTGGTAGGAGAGGTCCTTCATGG - Intergenic
937519495 2:122694541-122694563 CTTGTAGGATAGGGTCTGCAAGG + Intergenic
947303577 2:228717555-228717577 ATAGTAGGAGAGGGGCTACAGGG + Intergenic
1175295855 20:57908285-57908307 CCAGAAGGTGAGCTCCTGCAGGG - Intergenic
1175881678 20:62262968-62262990 CTAGGAGGGGAGCGCCTGAATGG - Intronic
1177289052 21:19086448-19086470 CTTGTAGGAGAGAGGCTGAATGG + Intergenic
1181105729 22:20574057-20574079 CCAGCAGGAGAGTGGCTGCAGGG - Intronic
1182903740 22:33920092-33920114 CGAGTAGGGCAGCGCCTGCCGGG - Exonic
1183405589 22:37629148-37629170 CTGGCAGCAGAGAGCCTGCAGGG - Intronic
1183832433 22:40425469-40425491 CTCCTAGGAGAGCCACTGCAAGG - Intronic
952268969 3:31814044-31814066 CTAGGAGGAGAGAGGCTGTAAGG - Intronic
967186666 3:186950038-186950060 CTAGATGGAGAGCTCCTCCAGGG - Intronic
968271036 3:197404044-197404066 CTAGTCGGGGAGCACCTTCAAGG - Intergenic
968642510 4:1721641-1721663 CAGGTAGGAGAGCGGCTACACGG + Exonic
973330409 4:48906358-48906380 CTTGGAGGGGGGCGCCTGCAGGG + Intronic
986254992 5:6094942-6094964 CAAGCAGAAGAGCGTCTGCATGG - Intergenic
990615583 5:57504156-57504178 CTAGAAGGAGAGAGACTGAAGGG - Intergenic
990871773 5:60439759-60439781 CTTGTAGGTGAGAGACTGCATGG - Intronic
1004547113 6:16608522-16608544 CTAGTAGGAGAGCGCCTGCAAGG + Intronic
1009494896 6:64334211-64334233 CTGTTTGGAGAGCACCTGCAGGG + Intronic
1022821707 7:33968659-33968681 CTTCTGGTAGAGCGCCTGCATGG + Intronic
1025834381 7:65081249-65081271 CTTCCAGGAGAGCGCCTGCGCGG - Intergenic
1030698934 7:112617583-112617605 TTAGTAGGAGAGCAGCTACATGG + Intergenic
1037931877 8:22885913-22885935 CTAGTCACAGACCGCCTGCAGGG + Intronic
1043358512 8:79441690-79441712 CTAGTAGGAGATCCACAGCAGGG - Intergenic
1057919882 9:99088254-99088276 CTAGGAGGGGAGCGCCTGCTAGG + Intergenic
1059398926 9:114056649-114056671 TTAGGAGCAGAGCACCTGCAGGG + Intergenic
1062262236 9:135668603-135668625 GTAGTGGGAGAGGGCCTGCTCGG - Intergenic
1186287947 X:8065708-8065730 CCAGCAGGAGTGCGCCTGCCAGG - Intergenic
1189882981 X:45511222-45511244 CTAGTTGGAGAGTGACTGGAGGG + Intergenic
1199688860 X:150290920-150290942 CTGGTAGGAGAGAGCCTAGAAGG - Intergenic
1200137818 X:153883491-153883513 CAAGTAAGACAGCGACTGCAGGG + Intronic