ID: 1004549394

View in Genome Browser
Species Human (GRCh38)
Location 6:16632115-16632137
Sequence CTCACTGGCCAGAGAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004549394 Original CRISPR CTCACTGGCCAGAGAGGAAA AGG (reversed) Intronic
900697573 1:4021727-4021749 CTAGCTGCCCAGTGAGGAAATGG + Intergenic
900848942 1:5126783-5126805 CTGACTGGTCAGAGATGAAATGG - Intergenic
901452588 1:9345059-9345081 CTGCCTGGCCTGAGAGGAAGAGG - Intronic
901869676 1:12130582-12130604 ATCACAGGCCAGAGAGGGGAGGG + Intronic
903367172 1:22812221-22812243 CTGCCTGGCCAGGGAGGGAAGGG + Intronic
905091500 1:35434434-35434456 CTCGCTGGGCAAAGAGGAAGTGG - Exonic
906048707 1:42852956-42852978 CTGACTTGCCATAGAGCAAATGG - Intergenic
906654363 1:47537004-47537026 TTCACAGGCCAAACAGGAAAGGG + Intergenic
906668881 1:47640683-47640705 CTCAAGGGCCAGAGAAGACATGG - Intergenic
906669666 1:47645346-47645368 CTCTCTTCCCAGAAAGGAAAGGG + Intergenic
907111862 1:51934028-51934050 CTCTCTGCCCAGTGAGGAGAGGG - Intronic
907418198 1:54328954-54328976 CCCACTAGCCAGAGACGAAGAGG - Intronic
907810159 1:57861167-57861189 CTCACTGGCCACAGAGCACCTGG + Intronic
907822374 1:57983448-57983470 CTCACTGGGCAGAGTAGAAGAGG + Intronic
908802803 1:67897604-67897626 CTCCAGGGCAAGAGAGGAAAGGG - Intergenic
909355168 1:74700372-74700394 CTCACTAGTAATAGAGGAAATGG - Intergenic
912544637 1:110441829-110441851 TTCACTGCCCAGAGGGGAGATGG - Intergenic
912951088 1:114121025-114121047 CTAACTGGCCAGAGAGGGACAGG + Intronic
914903159 1:151723043-151723065 CACACAGTCCAGAGGGGAAATGG - Intronic
916055768 1:161068287-161068309 CTCACTGGGCAGAGTGGAGGTGG - Intronic
916170829 1:162000372-162000394 GTCACTGGTCAGAGAGGCAGTGG + Intronic
916602102 1:166303282-166303304 CTCACTGACCAGCGTGGAGAAGG - Intergenic
919908392 1:202094153-202094175 CTGACTGGGGAGAGAGGCAATGG - Intergenic
920108944 1:203573745-203573767 CTCGCTGGCCAGGGGAGAAAGGG + Intergenic
920400853 1:205675543-205675565 CTCACTGGGGAGAGACCAAAAGG - Intronic
920455476 1:206097938-206097960 CTTATTGTCCAGAGAGGCAAAGG + Intronic
922930404 1:229384634-229384656 CTCATTTGCCAAATAGGAAATGG - Intergenic
923078550 1:230632179-230632201 CTCATTGGTCACAGAGGTAAGGG - Intergenic
923218191 1:231869583-231869605 CTCTCTGGCCAGAGATCACATGG - Intronic
924277599 1:242404109-242404131 CTCACTGTCTAGAGAGGAGAGGG + Intronic
1064174533 10:13062966-13062988 CTGATTGGTCAGAGATGAAATGG - Intronic
1064225741 10:13483131-13483153 CTTAATGGCAAGAGAGGAAGGGG + Intronic
1064388912 10:14924223-14924245 CTCACTGGCCACATAAGAATGGG - Intronic
1064918267 10:20486679-20486701 CTTACTGGCCAGAGAGAAGAGGG + Intergenic
1065920672 10:30389819-30389841 CTCAAAGGCAAGAAAGGAAAGGG + Intergenic
1067528283 10:47051526-47051548 TTTAGTGGTCAGAGAGGAAAGGG - Intergenic
1068324549 10:55467314-55467336 CTCACTCCCATGAGAGGAAAAGG + Intronic
1069608380 10:69755602-69755624 GCCAATGGCCTGAGAGGAAAAGG - Intergenic
1070684423 10:78470414-78470436 CTCACTGGCCAGCCAGGACAAGG - Intergenic
1072018841 10:91379052-91379074 CTCACTGGTCAGTGGGGAGAAGG - Intergenic
1072849926 10:98878926-98878948 ATATCTGGCAAGAGAGGAAAGGG + Intronic
1073085082 10:100883172-100883194 CTCACTGGGCAGTGGGGAGATGG + Intergenic
1074427940 10:113368655-113368677 CTCACTGGACAGGGCAGAAATGG + Intergenic
1075907398 10:126093572-126093594 CTCACTGGGCAGAGTGGAGATGG - Intronic
1076244557 10:128936358-128936380 CTCCATGGCCAGTTAGGAAATGG - Intergenic
1076597782 10:131636426-131636448 CTCATGCACCAGAGAGGAAATGG + Intergenic
1077135752 11:997446-997468 CTCCCAGGCCTGAGAGGATAAGG + Intronic
1077547836 11:3183551-3183573 CTCTCTGGCCAGGGAGTAAAGGG + Intergenic
1077867016 11:6230784-6230806 TTCACTGGGCAGAGAAGAAAAGG + Intronic
1077960950 11:7076522-7076544 CTGAGTGGCCAGAGAGGATCAGG - Intergenic
1078050807 11:7963348-7963370 CCCACTGGCCAGAGGGGAGTTGG - Exonic
1078450077 11:11434223-11434245 CTCTCTCGCCAGAGAGGAATGGG + Intronic
1078908254 11:15707455-15707477 CTCACAGGCCACAGGGGAGATGG + Intergenic
1080564041 11:33491804-33491826 GTCACTGGTCAGAGTGGAGAAGG - Intergenic
1081429510 11:42961219-42961241 CTCACAAGACAGAGAGAAAATGG + Intergenic
1081600523 11:44489499-44489521 CTGACAGGCCAGAGAGCAAGAGG + Intergenic
1083276060 11:61597773-61597795 CTCACTGGCTGGAGGGGAACGGG - Intergenic
1083299653 11:61733742-61733764 CTCACTGCCCAGCGAGGAGGCGG + Intronic
1083503671 11:63135034-63135056 CTTAGTGGTCCGAGAGGAAAAGG - Intronic
1084731645 11:71077408-71077430 CTCAATGGGAAGAGATGAAACGG + Intronic
1084739213 11:71128130-71128152 CTCATGGGCCAGACAGGAAAGGG - Intronic
1085482755 11:76836479-76836501 CTCACAGGCCAGTGGGGAGAAGG - Intergenic
1086296573 11:85374152-85374174 CTCACTGGCCAGAGAGCCACTGG - Intronic
1086475716 11:87170979-87171001 TGCCCTGGCCAGAGAGCAAAGGG + Intronic
1087181912 11:95150174-95150196 CGCAATAGCCGGAGAGGAAAGGG - Intergenic
1087593348 11:100220872-100220894 CTAACTTACTAGAGAGGAAAAGG + Intronic
1088746563 11:112809153-112809175 CTCACTGGCCAGGGGGGAGTGGG - Intergenic
1089606655 11:119645274-119645296 CCCAATGACCAGAGAGGCAAGGG + Intronic
1089984784 11:122803120-122803142 CTGATTTGCCGGAGAGGAAAAGG - Intronic
1090206983 11:124890777-124890799 CTCACTTCTCAGAGAGGAATGGG - Intronic
1090457490 11:126862562-126862584 CTCACTGCCCAGAAGGGACAGGG - Intronic
1090601696 11:128379045-128379067 CTCACATGGCAGAGAGGAAGAGG + Intergenic
1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG + Intergenic
1091556208 12:1575512-1575534 ATCACTGACCAGTGAGGAAGAGG - Intronic
1091712771 12:2753356-2753378 CCCGCTGGGCAGAGAGGAGAGGG + Intergenic
1094055999 12:26270123-26270145 GTCACTTGCCAGGGAAGAAAAGG - Intronic
1095704720 12:45224075-45224097 CTCACTGTCTAGAAAGGAAACGG + Intronic
1096072024 12:48780689-48780711 ATGCCTGGCCAGAGAGGAAGGGG + Intronic
1097234044 12:57527909-57527931 CCAACTGGCCAGAGAGAAGAGGG - Exonic
1097266483 12:57748466-57748488 CTCAGTGTCCAGAAGGGAAATGG + Exonic
1098449984 12:70609464-70609486 TTCTCTGGCCAGAGGGCAAAAGG - Intronic
1100670952 12:96812314-96812336 CTGACTGGGCACAGAGGGAAAGG - Intronic
1101048957 12:100841014-100841036 CTCACTGGCTAGAGAAAAATAGG - Intronic
1101180148 12:102207534-102207556 CTCACTGGCATTAGAGGAAATGG - Intergenic
1102536990 12:113589043-113589065 CTCACTGGGTTGAGAAGAAAAGG - Intergenic
1103882588 12:124177543-124177565 CACACTGGGCAGAAAGGCAAAGG + Intronic
1104221633 12:126790147-126790169 CTCACTGGCCACAGGGAGAATGG - Intergenic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1107315200 13:39123855-39123877 TTCACATGCTAGAGAGGAAATGG - Intergenic
1108123032 13:47210265-47210287 CTCACTGGTCAGTGAGTAGAAGG - Intergenic
1108525363 13:51281312-51281334 CTCAGTGGCCAGAGGGGCAGTGG - Exonic
1110484609 13:76023598-76023620 CTCACTGTGCAGAAAGGAGAAGG - Intergenic
1110688636 13:78405064-78405086 CTGAGTGGCCAGTGAGGTAAGGG + Intergenic
1112430504 13:99346568-99346590 CATTCTGGGCAGAGAGGAAAGGG - Intronic
1113776863 13:112952889-112952911 GCCACTGGCCAGAGAGAACACGG + Intronic
1114600638 14:23953451-23953473 CCCACTTCCCAGAGAAGAAAAGG + Intergenic
1115416460 14:33140465-33140487 CACACTGGCCAGTGAGTAACGGG - Intronic
1115473830 14:33795466-33795488 CTCACATGCCAGACAGAAAATGG + Intronic
1115546250 14:34467055-34467077 CGCTCTGCCCAGAGAGGAGAAGG + Intergenic
1117591262 14:57270344-57270366 ATCAATGGCCAGAGAATAAAAGG - Intronic
1119897579 14:78232843-78232865 CCCACTGGCCAGGGAGGAGGGGG + Intergenic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120077326 14:80173329-80173351 GTCACTGGCCATAGAGGACTGGG + Intergenic
1120098673 14:80419589-80419611 CTCACCAGGCAGAGATGAAAAGG + Intergenic
1120416667 14:84227876-84227898 CTCACATGCCAGAGAGGGAGAGG + Intergenic
1121016362 14:90551771-90551793 GACACTTGCCAGAGAAGAAAGGG - Intronic
1121919618 14:97868617-97868639 CTCACGGGCCCGTGAGGAAGAGG - Intergenic
1122137651 14:99644261-99644283 CTCACTGGACAGAGAAGATGGGG + Intergenic
1122157611 14:99759626-99759648 GGCCTTGGCCAGAGAGGAAAGGG + Intronic
1122290101 14:100676128-100676150 CACACTGGCCTGAGATGAAGAGG + Intergenic
1122508334 14:102246514-102246536 GTCTCTTGCCAGAGAGGAATTGG - Intronic
1126095766 15:45088870-45088892 GTCACTGGCCAGGGAAGATAAGG + Intergenic
1126910247 15:53409907-53409929 CACACTGAGCAGAGAGGAAAGGG - Intergenic
1126983786 15:54278393-54278415 CTATCTGGCGAGAGAGGAATTGG + Intronic
1127057739 15:55149817-55149839 CTGATTGAGCAGAGAGGAAAAGG + Intergenic
1127285466 15:57529045-57529067 CTCATTGTCTTGAGAGGAAATGG + Intronic
1127629441 15:60813229-60813251 CTTCCTGGGCAGAGAGGATATGG - Intronic
1128259843 15:66225359-66225381 CTCTCTGCCCAGAAAGGCAATGG + Intronic
1128508869 15:68301457-68301479 CACACTGGCCATAGATGGAAGGG + Intronic
1128793226 15:70448266-70448288 CTCCCTTGCCAGAGGGGAAGCGG - Intergenic
1129404981 15:75310799-75310821 CTCAAAGGCAAGAAAGGAAAGGG - Intergenic
1130510489 15:84584996-84585018 CTCAAAGGCAAGAAAGGAAAGGG + Intergenic
1130543349 15:84837989-84838011 CACTATGGCCAGAGAGGTAAGGG + Intronic
1130584477 15:85170255-85170277 CTCAAAGGCAAGAAAGGAAAGGG - Intergenic
1132555842 16:572295-572317 CTCTCTGACCACTGAGGAAATGG + Intronic
1133569383 16:7026106-7026128 GTCACAGGCCAGGGTGGAAATGG + Intronic
1134038730 16:11051693-11051715 CTCCCAGACCAGGGAGGAAAGGG + Intronic
1134247780 16:12552828-12552850 CTGACCTGCCAGAGAGGAGAGGG + Intronic
1135904655 16:26500153-26500175 GTCACTTATCAGAGAGGAAAGGG + Intergenic
1138652648 16:58470302-58470324 TCCAGTGGACAGAGAGGAAAAGG + Intronic
1138903796 16:61305732-61305754 CTCAATGGCCAGAGAAGTCAGGG - Intergenic
1140491267 16:75337907-75337929 GTCACTTGAAAGAGAGGAAAAGG - Intronic
1140670420 16:77272177-77272199 CCCACTCGGCAGAGAGGAAAGGG + Intronic
1142930188 17:3277960-3277982 ATCACTGACCTGAGAGGTAATGG - Exonic
1143721903 17:8818315-8818337 GCCACTGGGTAGAGAGGAAATGG + Intronic
1143740589 17:8950442-8950464 CTCAGTGGGGAGAGAGGGAAGGG - Intronic
1144247082 17:13377515-13377537 CTTACTGGCCAGAGCATAAAAGG - Intergenic
1146460091 17:33039351-33039373 CACACGGGTCAGTGAGGAAAGGG - Intronic
1146554140 17:33809008-33809030 CTCACTGGACAGAGTGGAAGAGG - Intronic
1147705975 17:42424997-42425019 CTCATTTGACAGACAGGAAAAGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151114265 17:71716224-71716246 TTGACTGGCCAGAGATGGAAGGG - Intergenic
1151860408 17:76756895-76756917 CACAGAGGCCAGAGGGGAAAAGG + Intronic
1151941617 17:77295808-77295830 AGCAAAGGCCAGAGAGGAAAGGG - Intronic
1153503152 18:5769154-5769176 CTTACTGGGAAGAGAGGAGAGGG + Intergenic
1153624245 18:7008163-7008185 GGCACTGGGGAGAGAGGAAATGG + Intronic
1154498061 18:14977014-14977036 CTCAGAGGCCAGGGAGGCAATGG + Intergenic
1155064273 18:22255128-22255150 CTCAATGGCCAAAGAAGGAAAGG - Intergenic
1155325080 18:24657000-24657022 CTGAATGGCCAGAAAGAAAATGG - Intergenic
1156603139 18:38634286-38634308 CTCACTGGCCAGTGTGGAGTGGG + Intergenic
1159799720 18:72883183-72883205 ACCCCTGGACAGAGAGGAAATGG - Intergenic
1161594610 19:5144691-5144713 CTCACTTGCCAGCGCGGAGAGGG + Intronic
1162367308 19:10257256-10257278 CTGCCTGGTCAGAGAGGGAAAGG - Intronic
1162429789 19:10621389-10621411 GTCATAGGACAGAGAGGAAAGGG + Intronic
1162766439 19:12922674-12922696 GTCACTGGCCAGGGATGCAAAGG + Exonic
1162855887 19:13468391-13468413 CACTATTGCCAGAGAGGAAAAGG - Intronic
1165731660 19:38149760-38149782 CTCATTGGCCAGAGCTGCAAGGG + Intronic
1166176780 19:41078827-41078849 CACACTGGCAAGAGATGGAAGGG + Intergenic
1167300386 19:48674288-48674310 CTCAGTGTCCAGAGAGGGAGGGG + Intergenic
1167356496 19:49007290-49007312 CTCTCTGGCTAGGGAGGAGACGG + Exonic
925329227 2:3045237-3045259 GTCATTGGCCAGTGAGGACATGG - Intergenic
926520339 2:13903096-13903118 CTCACGTGCCAGACAGCAAAAGG + Intergenic
926619982 2:15038809-15038831 CTGCCTGGCCAGAGAGGAAGTGG + Intergenic
927441230 2:23119475-23119497 CTCTCTGGCCTCTGAGGAAAAGG + Intergenic
928118780 2:28566822-28566844 CTCACTCGCCAGGGTGGTAACGG - Exonic
928174760 2:29026159-29026181 CTCGATGGGCAGAGGGGAAATGG - Intronic
929335492 2:40739223-40739245 CTCACTGCCCAGGGAAGGAAAGG - Intergenic
930815772 2:55596640-55596662 TTCACAGGACAGACAGGAAAAGG + Intronic
931664280 2:64599128-64599150 CTGACTGTCCAGAGAGTAAGGGG - Intergenic
931795045 2:65700683-65700705 CTCACTGGCCACAGAGGTTGGGG + Intergenic
932063074 2:68527682-68527704 CTCACTGCCCAGACAGGGCAGGG + Intronic
932405630 2:71511178-71511200 TGCACCGGCCAGAGAGGAGAGGG - Intronic
932420241 2:71597188-71597210 CTCAGTGGCCTCAGAGGTAATGG - Intronic
934686613 2:96326090-96326112 CTCCCTGGGCAGAGAGGGAGAGG + Intronic
934769526 2:96899034-96899056 CTGACAGGCCAGACTGGAAAGGG + Intronic
934857784 2:97739662-97739684 CTCCCCAGCCAGAGAGGACAGGG - Exonic
935690085 2:105723208-105723230 CTGATTGGCCACAGATGAAAGGG + Intergenic
936149632 2:110008144-110008166 CACCCTGGCGGGAGAGGAAAGGG - Intergenic
936195046 2:110363225-110363247 CACCCTGGCGGGAGAGGAAAGGG + Intergenic
936283171 2:111160255-111160277 ACCACTGGCCAGAGAGGAAGTGG - Intronic
936561578 2:113543125-113543147 GTTACAGGACAGAGAGGAAAGGG - Intergenic
936681062 2:114771913-114771935 CATACTGGCCTGAGAGTAAAGGG - Intronic
937787808 2:125922946-125922968 CTCACTAGCCAGAATGGAACAGG + Intergenic
938994427 2:136662498-136662520 CTCTCTGGGCAGAGAGGTCAGGG + Intergenic
941689925 2:168490278-168490300 CTCACAGGCCAAAGAGGATGGGG - Intronic
942427521 2:175875855-175875877 CTCACTGTCCAAAGAAAAAAAGG - Intergenic
943386191 2:187206125-187206147 CTAAGTTGCCTGAGAGGAAATGG + Intergenic
943920393 2:193699577-193699599 CTCACAGGACTGACAGGAAAAGG - Intergenic
946727092 2:222671659-222671681 CTGGCTGGGCGGAGAGGAAAAGG - Intergenic
946863033 2:224018171-224018193 GTCACTGGCGACTGAGGAAATGG + Intronic
947444606 2:230154533-230154555 CTCCTTGGCCAGACAGGTAAAGG + Intergenic
947574332 2:231260686-231260708 GGCAATGGCCAGGGAGGAAACGG - Intronic
947887476 2:233585121-233585143 CTCTCTGCCCAGAAAGGAACTGG - Intergenic
948776772 2:240293294-240293316 CTCCCTGCCCAGTGAGGCAAGGG + Intergenic
1168860397 20:1042273-1042295 CTCCATGGTCAGAGAGGTAAGGG + Intergenic
1172181831 20:33008302-33008324 CGCAATGCCCAGAGAAGAAATGG - Intronic
1172344097 20:34183482-34183504 CTCTCTGGACAGAGATGGAATGG - Intergenic
1173410164 20:42803111-42803133 CTCACTGTCCACAGAGGCAGCGG + Intronic
1174351288 20:49970197-49970219 CTCACAGGCGAGGGGGGAAAGGG - Intergenic
1176032164 20:63017847-63017869 TCCACTGGCCAGAGGGGGAAAGG - Intergenic
1176668344 21:9708422-9708444 CTTACTGGCCAGCCAGAAAATGG + Intergenic
1177860966 21:26453558-26453580 CTCACTGGACTCAGAGAAAATGG + Intergenic
1178155264 21:29846061-29846083 CCCACTGGCCAAATAGAAAATGG + Intronic
1179049797 21:37879437-37879459 CTCAGTGGGCAGAGTGGTAAGGG + Intronic
1181362976 22:22352974-22352996 CTCACTGCACAGGTAGGAAAAGG + Intergenic
1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG + Intergenic
1183573090 22:38668952-38668974 CACACATGGCAGAGAGGAAAGGG - Intronic
1183661307 22:39223134-39223156 CACTCTGGCCAGAGAGGATGAGG - Intergenic
949539300 3:5019941-5019963 AGCTGTGGCCAGAGAGGAAAGGG - Intergenic
950316086 3:12003583-12003605 CTCACTGGTCAGTGAGGAGGGGG + Intergenic
950365999 3:12484601-12484623 CTCCAGGGCGAGAGAGGAAAGGG + Exonic
950760343 3:15217624-15217646 TTCACTAGCAAGAGAAGAAATGG - Intronic
952106353 3:30074063-30074085 ATAGCTAGCCAGAGAGGAAATGG + Intergenic
952758634 3:36894261-36894283 CACACTGGGAAGAGAGGACAAGG + Intronic
953239376 3:41135075-41135097 CTCAGTGGCCACGGTGGAAAAGG - Intergenic
953743369 3:45555473-45555495 CTCCCTGGCCTGCCAGGAAAAGG + Intronic
955231213 3:57100578-57100600 GGCACTGGCCAGAGAGAACAGGG - Intronic
955251107 3:57283314-57283336 CAAACTGGGCAGAGAGGACATGG - Exonic
955995728 3:64678658-64678680 CCCTCTTGCCAGAGAGAAAAGGG - Intronic
956990173 3:74752925-74752947 TTCATTGGCCAGGTAGGAAAAGG + Intergenic
957227242 3:77465374-77465396 CTCTCTGCACAGAAAGGAAATGG + Intronic
961043235 3:123692245-123692267 GTCTCTGGACAGAGAGGACAGGG - Intronic
961213692 3:125143805-125143827 CTCCCTGGCCTGGGAGGGAAGGG + Intronic
962424766 3:135260006-135260028 CTCAATGGGAAGAGAGGAGAGGG + Exonic
963219160 3:142787944-142787966 CTCAGTGGCAAGAGAGAGAATGG + Intronic
963349918 3:144139461-144139483 CTCAGTGGGAAGTGAGGAAAGGG + Intergenic
963854100 3:150236634-150236656 CTCAGAGACCAGAGAGGTAATGG - Intergenic
965666989 3:171105637-171105659 CACACTGGACAGAGATGAGAGGG - Intronic
965925269 3:173971322-173971344 GTCAATGTTCAGAGAGGAAAAGG + Intronic
966086332 3:176071505-176071527 CTCAATGCCCAGACAAGAAACGG + Intergenic
967950237 3:194834956-194834978 CTCCCGGGCCAGAAGGGAAAAGG + Intergenic
968489831 4:883977-883999 CTCACTGGGCACACAGGGAAGGG + Intronic
968504928 4:967275-967297 GTCACAGGCCTGAGAGGAAGGGG + Exonic
968759271 4:2433654-2433676 GGCGCTCGCCAGAGAGGAAAGGG - Intronic
969241648 4:5902641-5902663 CTCATTTGCAAGACAGGAAAAGG - Intronic
969661531 4:8532482-8532504 CTCTCTGCCAAGAGAGGACAGGG - Intergenic
969905053 4:10386021-10386043 CTCAAAGATCAGAGAGGAAAGGG + Intergenic
972046590 4:34672576-34672598 CTGACTGGCTAGAGAAGAAAAGG + Intergenic
975126671 4:70790267-70790289 CTAAGTTGCCAGAGAGAAAATGG - Intronic
975328947 4:73091830-73091852 CTCAAAGGCCTGACAGGAAACGG + Exonic
975722512 4:77261952-77261974 CTCCCTGAGCAGAGAGCAAAAGG - Intronic
975857838 4:78643222-78643244 CTCACTGGCCAGACAGCAGGTGG + Intergenic
976145265 4:82036536-82036558 CTGATTGTCCATAGAGGAAAAGG + Intronic
977486404 4:97652388-97652410 CTCAATGGTCAGAGACAAAAAGG - Intronic
978414207 4:108458567-108458589 CACATTTGCCAGAGAGGAAGGGG + Intergenic
978964330 4:114723581-114723603 TTCACTGGCGAGAGTGGCAAGGG + Intergenic
979016226 4:115437153-115437175 CTCACTGGCTAGAGTGGTTATGG + Intergenic
981323349 4:143418021-143418043 CTGACTGGCCAGAGAGGAAGCGG - Intronic
982539372 4:156648771-156648793 CCCAGTGGACAGAGATGAAAAGG - Intergenic
985406437 4:189643089-189643111 CTTACTGGCCAGCCAGAAAATGG - Intergenic
987430884 5:17831602-17831624 TTCACTGGCCTGAGAATAAATGG + Intergenic
988287337 5:29237198-29237220 ACCACTGGGCAGAGAGTAAAAGG - Intergenic
994741419 5:103624392-103624414 CTCAATGTTCAGAGTGGAAAGGG - Intergenic
995165118 5:109030776-109030798 CTCCCTTGCCAGAGATGACAGGG - Intronic
995192825 5:109337516-109337538 CTGATTGGGCAGGGAGGAAAAGG - Intronic
997125683 5:131224784-131224806 CTGAATGGCCACAGAGAAAAGGG + Intergenic
997356898 5:133268371-133268393 CACACAGGCCAGGGAGGAATTGG - Intronic
997468955 5:134105944-134105966 CTCTCCGGCCTGAGAGGGAAGGG + Intergenic
999602464 5:153282402-153282424 CTCAGGGTCCAGACAGGAAAGGG + Intergenic
999658358 5:153832807-153832829 TTCATTGGCCAGAGAGGAAGTGG - Intergenic
1000131535 5:158304897-158304919 CACACTGGCCTCAGAGGGAAAGG - Intergenic
1000353909 5:160374820-160374842 CTAACTGGGCAGAAAGGGAAAGG - Intergenic
1000978176 5:167787681-167787703 TTCTCTGGCCACAGAGGACAGGG - Intronic
1003378069 6:5597400-5597422 CTCATAGGCCAGAGGGGAAAGGG - Intronic
1004549394 6:16632115-16632137 CTCACTGGCCAGAGAGGAAAAGG - Intronic
1005190685 6:23219010-23219032 AGAACTGCCCAGAGAGGAAATGG + Intergenic
1006525565 6:34601868-34601890 ATGACTGTCAAGAGAGGAAAGGG + Intronic
1007079498 6:39088938-39088960 CTCACTAGACTGAGAGAAAAGGG - Intergenic
1007180085 6:39923463-39923485 CTCACTGGTCAGGGAGGTACAGG - Intronic
1007574393 6:42915869-42915891 CTCACGGGCCAGGGAGCACAGGG - Intergenic
1007659987 6:43477963-43477985 CTGGCCGGCCAGAGGGGAAAGGG + Intronic
1009226972 6:61029119-61029141 TTCACTATCCAGAGAGGTAAAGG - Intergenic
1011262878 6:85486942-85486964 CTCAGTAGCCAGATGGGAAAGGG + Intronic
1011597449 6:89029688-89029710 CTCACTGGCCAGTTGGGAAATGG + Intergenic
1015137418 6:129889235-129889257 CTCTCTGGGAAGAGAGGAAAGGG - Intergenic
1015343913 6:132132977-132132999 CTCACTGGCAATGGAGGACAAGG + Intergenic
1015694317 6:135963398-135963420 TTCACTGTTCAGAGAAGAAACGG + Intronic
1016587536 6:145706991-145707013 CTCACATGGCAGAGGGGAAAAGG - Intronic
1017021237 6:150142491-150142513 CTCACAATCCAGAGAGGAAGTGG + Intergenic
1017035289 6:150261856-150261878 CTCTATGGAGAGAGAGGAAAGGG - Intergenic
1018076196 6:160215799-160215821 CACACTGGCCAGAGATGGGAAGG - Intronic
1018581976 6:165315569-165315591 CTCACTGGGCAGAGAAGATATGG - Intergenic
1018615466 6:165682569-165682591 CTCACATGGCAGAGAGGCAAAGG - Intronic
1018717689 6:166546304-166546326 CCCACTGCCCAGACCGGAAATGG - Intronic
1018881355 6:167884852-167884874 CTCTCTAGCTAGAGAGGAGAAGG - Intronic
1021052305 7:16002727-16002749 CCCAATGGCAAGAGAGGAATAGG + Intergenic
1021304201 7:19011398-19011420 CTCACGGCACAGACAGGAAATGG + Intergenic
1022379283 7:29844573-29844595 CTCAATGGCCAGAAAGGCAGGGG - Intronic
1022472976 7:30693043-30693065 CTCTCTTGCCACAGAGGAACAGG + Intronic
1022538480 7:31113491-31113513 GACACTGGCCTGAGAGGAAAAGG - Intergenic
1023224772 7:37957908-37957930 CCCACTGGCGACAGAGGAAAAGG + Intronic
1023463893 7:40432292-40432314 CTCACTGACCAGAAGGGAATAGG - Intronic
1024279778 7:47709680-47709702 CTCACTGTCTAGAGAGAAACAGG - Intronic
1026325971 7:69310877-69310899 GCCACTTGCCAGAAAGGAAATGG + Intergenic
1027457574 7:78412638-78412660 CTCACTGGGTTGAGAGAAAAGGG + Intronic
1028732247 7:94165068-94165090 CAAGCTGGCCAAAGAGGAAAGGG - Intergenic
1029361418 7:100091067-100091089 CACTCTGGCCACAGAGGAAGCGG + Exonic
1029626724 7:101724541-101724563 CTCACAGGCCAGGGAGGATCTGG - Intergenic
1029956699 7:104647859-104647881 TTCGTTGGCCAGAGAGGAAAGGG + Intronic
1029966382 7:104745158-104745180 TTTGTTGGCCAGAGAGGAAAGGG - Intronic
1030089862 7:105849159-105849181 ACCACTGGCCTGAGAGGAGATGG + Intronic
1031762577 7:125733348-125733370 TTCACTGGACCAAGAGGAAAAGG - Intergenic
1031789620 7:126084595-126084617 CTCACTGGACTGAGAGGAGTGGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032360494 7:131250397-131250419 CCCACTAGCTAGAGAGGAAGAGG + Intronic
1033549814 7:142436793-142436815 CTCACAGTCCAGAGGGGTAAAGG - Intergenic
1036123627 8:6044085-6044107 CACAGTGGGAAGAGAGGAAAGGG - Intergenic
1036506097 8:9357794-9357816 TCCACTGTCCAGAGAGAAAAAGG - Intergenic
1036664177 8:10728383-10728405 CTTTCTGACCTGAGAGGAAAAGG - Intronic
1036959757 8:13231036-13231058 CTAGCTGGGAAGAGAGGAAAGGG + Intronic
1037616050 8:20519898-20519920 CTCAGTAGGCAGAGAGGAAGTGG - Intergenic
1038643026 8:29342489-29342511 CTCAAAGGCCAAAGAGGAACCGG + Intronic
1040729040 8:50420519-50420541 CTCTCTCAACAGAGAGGAAATGG + Intronic
1041064718 8:54071238-54071260 ATCTCAGGCCAGAAAGGAAACGG + Intronic
1042081808 8:65061786-65061808 CTCCCTGGCCAGAGTGGCAATGG + Intergenic
1042480396 8:69296022-69296044 CTCACTGGACAAAGACGAATGGG - Intergenic
1046143941 8:110132659-110132681 TTCACTGGCTAGAAAAGAAAAGG + Intergenic
1047147059 8:122214226-122214248 CTCACAGGGCAGGGAGGAAGAGG - Intergenic
1047211719 8:122845968-122845990 ATCACTGCCCAGAGTGGAGAAGG + Intronic
1047749689 8:127870969-127870991 GTCACTGGACAGAGAGGAGGAGG - Intergenic
1049468821 8:142766092-142766114 CTCACTAGCCACAGAGGAACAGG - Intronic
1052379643 9:27756185-27756207 TTCACTTGCCAGAGAGGTGAAGG - Intergenic
1054938370 9:70713343-70713365 CTCACTGACCAGAGAAGGGAAGG - Intronic
1054940061 9:70731336-70731358 CTCACTGACCAGAGAAGGGAAGG - Intronic
1057007028 9:91569254-91569276 TTCTCAGGCCAGAGAGGAAAGGG + Intronic
1057046282 9:91888753-91888775 ATCACTGGCAAGACTGGAAAGGG + Intronic
1059118369 9:111619029-111619051 GTCTCTTGCCAGACAGGAAAAGG - Intergenic
1060803104 9:126557053-126557075 CTCACTTGGCAGAGAGGAAGTGG + Intergenic
1061382748 9:130268239-130268261 CTCAGTGCCCAGAGAGGAGAGGG - Intergenic
1061790479 9:133056455-133056477 CTCACTGGGATGAGAGGAGATGG + Intronic
1061799027 9:133104182-133104204 CACCGTGGCTAGAGAGGAAAGGG + Intronic
1061879589 9:133562147-133562169 CTCACTGGCCAGAGACTGCAAGG - Intronic
1203657522 Un_KI270753v1:12533-12555 CTTACTGGCCAGCCAGAAAATGG - Intergenic
1185527563 X:791529-791551 CCCACTGTGCAGAGAGAAAAAGG + Intergenic
1186126357 X:6418779-6418801 GTCACTTGCCAGAGAAGACAGGG + Intergenic
1186557797 X:10578704-10578726 CAGACTGGACAGAGAGGAAGAGG + Intronic
1187766818 X:22651762-22651784 CTCACAGTCCAGTGAGGGAAGGG - Intergenic
1188634962 X:32418134-32418156 CTCAGAGGCCAGAAAGCAAAGGG + Intronic
1189280576 X:39817891-39817913 CTCCCTGGCCAGAGAGCGAGCGG + Intergenic
1189842483 X:45095385-45095407 CTGACTGTCTTGAGAGGAAAAGG + Intronic
1190106940 X:47567580-47567602 CTCATTTCCCAGAGGGGAAAGGG - Intronic
1190211482 X:48452078-48452100 TTCAGTGGCCACAGAGGACAAGG + Intergenic
1193766781 X:85539233-85539255 CTCAATTGACAGAGATGAAATGG + Intergenic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1201144051 Y:11052988-11053010 CTCACAGGCCAGACAGGAAAGGG - Intergenic