ID: 1004549629

View in Genome Browser
Species Human (GRCh38)
Location 6:16634194-16634216
Sequence AAACTAACCCCATCTAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004549626_1004549629 -9 Left 1004549626 6:16634180-16634202 CCCTTAATCCATCTAAACTAACC 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1004549629 6:16634194-16634216 AAACTAACCCCATCTAGTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1004549624_1004549629 0 Left 1004549624 6:16634171-16634193 CCACTTCCTCCCTTAATCCATCT 0: 1
1: 0
2: 1
3: 55
4: 596
Right 1004549629 6:16634194-16634216 AAACTAACCCCATCTAGTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1004549625_1004549629 -6 Left 1004549625 6:16634177-16634199 CCTCCCTTAATCCATCTAAACTA 0: 1
1: 0
2: 2
3: 34
4: 1927
Right 1004549629 6:16634194-16634216 AAACTAACCCCATCTAGTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1004549627_1004549629 -10 Left 1004549627 6:16634181-16634203 CCTTAATCCATCTAAACTAACCC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1004549629 6:16634194-16634216 AAACTAACCCCATCTAGTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004549629 Original CRISPR AAACTAACCCCATCTAGTTC TGG Intronic
902751715 1:18518425-18518447 AAATTAAAACAATCTAGTTCAGG - Intergenic
905879295 1:41453200-41453222 AAACTAGCCCCAGATAGATCTGG - Intergenic
916199171 1:162253557-162253579 AGATTAACCCTGTCTAGTTCTGG + Intronic
916476566 1:165174953-165174975 AAACTAACCCAAACTCTTTCAGG - Intergenic
916885673 1:169065293-169065315 AAGCTAACACCTTTTAGTTCTGG - Intergenic
919955670 1:202412444-202412466 AAAATAAGCCCAGCTAGTCCAGG - Intronic
922932486 1:229401274-229401296 AAGCTCAGCCCATCTATTTCTGG + Intergenic
924331873 1:242947697-242947719 AAACTCTCCCCATCTCTTTCAGG - Intergenic
1071210005 10:83330154-83330176 AAACTAATCCCATCAAATTCAGG + Intergenic
1080325907 11:31073056-31073078 AAACTATTTCCATCTAGTTAAGG - Intronic
1081724623 11:45319563-45319585 AAACTAGCCCCTCCTCGTTCAGG - Intergenic
1085707560 11:78800389-78800411 AAACTAACATGATCTAGGTCTGG + Intronic
1087402862 11:97689587-97689609 CAATTGACCCCATTTAGTTCAGG - Intergenic
1097332458 12:58346559-58346581 AGACTAACCCTTTCTATTTCTGG + Intergenic
1098736932 12:74117016-74117038 GAACGAACCCCATCTTTTTCTGG + Intergenic
1106879612 13:34114934-34114956 AAACTAAATTCATCTATTTCTGG + Intergenic
1113384677 13:109837691-109837713 AAAATAACCCCATGAAATTCTGG + Intergenic
1121026518 14:90620409-90620431 AAAGTACTCCCATCTTGTTCTGG - Intronic
1121090960 14:91182365-91182387 TACCTAACCCCATCTGCTTCTGG - Intronic
1124898367 15:33798683-33798705 TAACAAACCCCATTTTGTTCAGG - Intronic
1125299400 15:38238409-38238431 AAACTCAGGCCATCTTGTTCCGG - Intergenic
1126033892 15:44529587-44529609 AAACCAACCCCTTTTAATTCTGG - Intergenic
1127318053 15:57816072-57816094 AAAGTAACCCCATTTTGTTCTGG + Intergenic
1133996444 16:10752133-10752155 AAACTCATCCTATCTTGTTCAGG - Intronic
1139432905 16:66920627-66920649 AAACCATCCCCATCTGGTGCTGG - Intergenic
1139432951 16:66920858-66920880 AAACCATCCCCATCTGGTGCTGG - Intergenic
1150270186 17:63859132-63859154 TAACTCACCCCATCTAGGGCAGG + Intergenic
1150466204 17:65394810-65394832 CAACTTACCCCATCTAGTGTTGG - Intergenic
1155416885 18:25607798-25607820 TAACAATGCCCATCTAGTTCAGG - Intergenic
1157146352 18:45166810-45166832 TAAGTAACCACATCTAGTTTAGG - Intergenic
1157769653 18:50334683-50334705 AAACTAACCACATCTATGCCTGG - Intergenic
1159642146 18:70876306-70876328 AAACTAACCCCTCCTTGCTCAGG + Intergenic
1167030975 19:46960140-46960162 AAAGTAACCCGATCTTGTTGAGG + Intronic
1168195743 19:54772434-54772456 ACACTAACCCCTTCCAATTCTGG - Intronic
925325315 2:3015611-3015633 ACAGTAAAGCCATCTAGTTCTGG - Intergenic
930441464 2:51412821-51412843 AAACCAACACCATCTGGCTCTGG - Intergenic
931708940 2:64970785-64970807 TAAACAACCCCATCTTGTTCAGG - Intergenic
932079484 2:68698809-68698831 AAACAAAACCCATCTGCTTCTGG + Intronic
938268563 2:129948345-129948367 AAAATAACCTCATCTATTCCCGG + Intergenic
946631210 2:221671279-221671301 TAACTAGCCCCAGCTAGTTATGG - Intergenic
1174408031 20:50315109-50315131 AAACTAACACCACCAAGTGCTGG - Intergenic
1174554018 20:51381259-51381281 AAACTGACCCCATCTCGGCCTGG - Intergenic
1174763416 20:53229132-53229154 AAACTAATGCCATCCAGCTCAGG - Intronic
1174817102 20:53696535-53696557 AAACCAACCCCAGCTAGCTTAGG - Intergenic
1181905797 22:26194940-26194962 AAGCTGACCCCAACCAGTTCTGG - Intronic
1182650067 22:31844456-31844478 AAACAAACCCCATGAAGCTCAGG + Intronic
952161977 3:30703029-30703051 AAACAGACCCTCTCTAGTTCAGG - Intergenic
953760010 3:45679122-45679144 AAACAAATCCCAGCTACTTCTGG - Exonic
965784847 3:172324717-172324739 AATATAACCCCAGCCAGTTCTGG - Intronic
967212905 3:187184670-187184692 ACGCTAAGCCCATGTAGTTCTGG + Intergenic
968181177 3:196596458-196596480 AAGGTAACCCCATCAAGTACTGG + Intergenic
973538586 4:51910225-51910247 AAACTGACCGCTTGTAGTTCTGG + Intronic
974215749 4:58844257-58844279 AAAGTGACACCATCTATTTCAGG + Intergenic
976262185 4:83156145-83156167 AAACTAACCCCCTCTTGTTTGGG + Intergenic
986850613 5:11808430-11808452 AAACTAACCCCAACTTTCTCTGG + Intronic
986958118 5:13180833-13180855 AAAATAACCACTTCTAATTCAGG + Intergenic
987523861 5:19022866-19022888 AAACAAAAGCCATCTATTTCAGG + Intergenic
996035708 5:118756549-118756571 AACAGAACCCCATGTAGTTCAGG + Intergenic
998897898 5:146819566-146819588 AAACTAGCTCCATCTAGCTTTGG + Intronic
1000107670 5:158075805-158075827 AAACCAAATCCATCTAATTCTGG + Intergenic
1000621183 5:163488765-163488787 AAACTAATCCAATCAAATTCTGG + Intronic
1004549629 6:16634194-16634216 AAACTAACCCCATCTAGTTCTGG + Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1016609901 6:145976929-145976951 AAAATAATCCCATCCAATTCAGG + Intergenic
1021460037 7:20876086-20876108 AAAAAAACCCCAGCAAGTTCAGG - Intergenic
1024149531 7:46556572-46556594 GAACTGACCCCATTTAGTTACGG - Intergenic
1033682198 7:143605372-143605394 GAGCTAACCCTACCTAGTTCTGG - Intergenic
1033702691 7:143856541-143856563 GAGCTAACCCTACCTAGTTCTGG + Intronic
1041713219 8:60911481-60911503 AAACTTTCCCCAGCTAGTTTAGG - Intergenic
1043514552 8:80984099-80984121 TAACTAGGCCCATCTACTTCAGG - Intronic
1045734008 8:105274352-105274374 AAACTAAAACCAACTATTTCTGG + Intronic
1046508101 8:115162167-115162189 AAACAAACCCCAACTAATACTGG + Intergenic
1046778939 8:118194701-118194723 AAACTCACCACAACTATTTCTGG + Intronic
1047759522 8:127943933-127943955 AAAATCATCCCATCTACTTCAGG + Intergenic
1052407604 9:28082120-28082142 AGACTACCCCCACCTACTTCTGG - Intronic
1057013510 9:91630101-91630123 AAACTAACCCAATCAAATTCTGG + Intronic
1057432735 9:95008927-95008949 AAACTCACCTCTTCTACTTCTGG + Intronic
1185947849 X:4397837-4397859 AGTCTAACACCATATAGTTCAGG - Intergenic
1186360658 X:8837591-8837613 AAACTATCCCCACCTACTCCAGG + Intergenic
1188328570 X:28838428-28838450 ATACTAACCCCTTTTACTTCCGG - Intronic
1192695515 X:73411335-73411357 ACACAAACCCCAGCTTGTTCTGG + Intergenic
1196606556 X:117663829-117663851 AGACTATCTCTATCTAGTTCTGG - Intergenic
1197937434 X:131753876-131753898 AAACTAACACAGACTAGTTCAGG - Intergenic
1198558377 X:137821176-137821198 AAACTAATCCAATCAAGTTGTGG + Intergenic
1201229216 Y:11846862-11846884 AAACTCTCCCCATCTCTTTCAGG - Intergenic
1201735243 Y:17253088-17253110 AATCTAACACCATGTAGTTCAGG - Intergenic