ID: 1004549773

View in Genome Browser
Species Human (GRCh38)
Location 6:16635787-16635809
Sequence CTGAAAACATGAGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 2, 2: 3, 3: 29, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004549767_1004549773 7 Left 1004549767 6:16635757-16635779 CCACTGTAGCCAGAAGCATCCAA 0: 1
1: 0
2: 0
3: 5
4: 146
Right 1004549773 6:16635787-16635809 CTGAAAACATGAGTGGAGGAAGG 0: 1
1: 2
2: 3
3: 29
4: 337
1004549768_1004549773 -2 Left 1004549768 6:16635766-16635788 CCAGAAGCATCCAAAAGCATCCT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1004549773 6:16635787-16635809 CTGAAAACATGAGTGGAGGAAGG 0: 1
1: 2
2: 3
3: 29
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004549773 Original CRISPR CTGAAAACATGAGTGGAGGA AGG Intronic
900392912 1:2441513-2441535 CTCAGCAGATGAGTGGAGGATGG - Intronic
902158393 1:14508754-14508776 CTGAAACCATGAAGGGAGAACGG - Intergenic
903296196 1:22344598-22344620 GTGAAAACATGACTGGAGTGTGG + Intergenic
903316160 1:22509016-22509038 ATGAAGAGTTGAGTGGAGGAAGG + Intronic
904094106 1:27964520-27964542 ATGAAAACCTGACTGGATGAAGG - Intronic
904965588 1:34370027-34370049 CTGGAAACCTGAGGGCAGGATGG - Intergenic
906229839 1:44152689-44152711 CTGAAAACATGATTAGCAGATGG - Intergenic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907533562 1:55126831-55126853 CTCAAAGCATGAGCAGAGGATGG - Intronic
907924737 1:58944678-58944700 GTGAAAACAGGAGTGGAGCTGGG + Intergenic
908386377 1:63646098-63646120 CTGAAAAGATGAAGAGAGGAAGG + Intronic
908532841 1:65049938-65049960 ATAAAAAGATGACTGGAGGAGGG - Intergenic
909450246 1:75790380-75790402 CTGAATATTTGAGTGGAGGGAGG + Intronic
910354219 1:86336826-86336848 CAGAAAACAGAAGTGGAGGCAGG + Intergenic
910892803 1:92035027-92035049 TTGAAGAAAAGAGTGGAGGATGG + Intronic
911627331 1:100139517-100139539 ATGAAGAAATGAATGGAGGAAGG + Intronic
912380278 1:109243861-109243883 ATGAATACATGAATGGAGGATGG - Intergenic
914709463 1:150199792-150199814 TTTAAGACATCAGTGGAGGAAGG - Intergenic
915002730 1:152608338-152608360 CTGAAAACCACAGTGGAGCAGGG + Intergenic
915663250 1:157421201-157421223 CTGAAATAATGAGAGGAAGATGG - Intergenic
916076972 1:161206672-161206694 CTTAAAACGTGAGGGGAGGAAGG + Intronic
917075812 1:171203526-171203548 TGGAAAACATGAGAGGAGGGAGG + Intronic
918117294 1:181508407-181508429 CTGAAAACATGCTTGGGCGATGG - Intronic
918671308 1:187220243-187220265 CTGAAAAAAATAGAGGAGGAGGG - Intergenic
919625584 1:199907134-199907156 CTGCTACTATGAGTGGAGGAAGG - Intergenic
920108700 1:203572281-203572303 TCGAAAACATGGGTGGGGGAGGG - Intergenic
920129918 1:203724114-203724136 TTGAAAACTTGAGTGGGGGTGGG - Intronic
920420687 1:205831252-205831274 TTGAAACCAGGAGTGGAAGATGG - Intronic
921195262 1:212750402-212750424 TTTAAAACATGAGAGAAGGAAGG + Intronic
922790944 1:228310688-228310710 ATGAATACATGAGTGGATGGGGG - Intronic
923577225 1:235170440-235170462 TTAAAAACATAAGTGGAGGCCGG + Intronic
923747143 1:236711844-236711866 TTGAAAACAAGAGAGGAGGTTGG + Intronic
1062838437 10:651181-651203 CTGTAGATATGCGTGGAGGACGG - Exonic
1062939895 10:1413233-1413255 GTGAGAACATGAGTGGGAGATGG + Intronic
1063764710 10:9125528-9125550 CTGAAAGCATGATGGCAGGAAGG + Intergenic
1064665483 10:17646313-17646335 CTAAAATCATGAGTGGGGGCTGG - Intronic
1068419985 10:56779033-56779055 CTGAAATCATGGGGGGAGGAGGG - Intergenic
1069251612 10:66273846-66273868 GTGAAAAGAAGAGTAGAGGAGGG + Intronic
1069494168 10:68887889-68887911 TGGAAAACATTAGTGGAGGCCGG - Intronic
1070746948 10:78939489-78939511 CTGAAAGGATGGGTGTAGGAGGG - Intergenic
1070795911 10:79216146-79216168 CTGAAAGCAAGAGGGGAGGAGGG - Intronic
1071334005 10:84586935-84586957 CTGAAAACATGAGTGTTAGTAGG - Intergenic
1072600941 10:96928548-96928570 TTCAAGACATCAGTGGAGGAAGG - Intronic
1073302569 10:102480010-102480032 CTGTAAACATTAGTGTAGCAAGG + Exonic
1073543429 10:104330181-104330203 CTGAATACATGAATGGAGTTAGG + Intronic
1073592324 10:104769068-104769090 ATGAAAACAGGAGAGGTGGAAGG - Intronic
1074947357 10:118294144-118294166 ATGAGAACATGTGTGGAGTAGGG - Intergenic
1075049397 10:119171445-119171467 CTGAGAATAGGAGTGAAGGAGGG - Intronic
1075339939 10:121638788-121638810 CTGGAAACCTTAGTGGAGAAAGG - Intergenic
1075484806 10:122813542-122813564 ATACAAACATGAGTGGAAGAAGG - Intergenic
1075940490 10:126387391-126387413 CGGAGAAACTGAGTGGAGGAAGG + Intronic
1076103784 10:127804036-127804058 CAGAAAGCATGTGTGGATGATGG - Intergenic
1076848574 10:133082024-133082046 CTGGACACTTGAGTGGGGGAGGG - Intronic
1077086728 11:756278-756300 CTGACTACAGGAGGGGAGGAGGG - Intronic
1077621981 11:3733615-3733637 TTGAAAACATAAGTGAAGGCCGG - Intronic
1077730518 11:4724316-4724338 CTGAAAACAGAAGTGGAAGATGG + Intronic
1079485516 11:20932442-20932464 CTGCAAACGTGAGTTGCGGATGG + Intronic
1079924523 11:26477415-26477437 CTAAAAACATGAATGGAGAAAGG - Intronic
1080467486 11:32511394-32511416 CTGGAATCCTGAGTGTAGGACGG - Intergenic
1085308756 11:75503610-75503632 CTGAATAAATGAGCGAAGGAAGG + Intronic
1087493189 11:98854177-98854199 TTGAAAACATTAGAGAAGGATGG - Intergenic
1087505852 11:99020538-99020560 GTGAAGACAGGAGCGGAGGAAGG + Intergenic
1090590610 11:128262943-128262965 GAGAAAACATGAGTAGAGAATGG + Intergenic
1090612259 11:128481968-128481990 CTGAATGGATGAGTGGAGGAAGG - Intronic
1092062519 12:5563126-5563148 CTGACAGAATGAGTGTAGGAAGG - Exonic
1093379465 12:18474949-18474971 CTGAAATCATCAGTAGAGGTTGG - Intronic
1093831792 12:23770132-23770154 CTGAAAACATGACAGGACAAAGG - Intronic
1095237866 12:39820521-39820543 CTGAAACCAAGAGAGTAGGAAGG + Intronic
1096197555 12:49658336-49658358 CTGGAAGCAAGAGTGGAGGGAGG + Intronic
1096704894 12:53414277-53414299 CTGAAAACCTGAAAGGATGAGGG - Intronic
1097136626 12:56862432-56862454 ATGATAACGTGAGTGGAAGATGG - Intergenic
1097405337 12:59182417-59182439 CTGAATAAATGAGTGCAGTAGGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098146636 12:67504214-67504236 GTCAAAACAACAGTGGAGGAGGG + Intergenic
1098169172 12:67728857-67728879 TTGAAAACAAGAGGGAAGGATGG + Intergenic
1098311647 12:69154762-69154784 CTGGAAACCTGAGGGAAGGAAGG - Intergenic
1098433931 12:70449326-70449348 CTGAAAAGAGGATTGGAGCAGGG - Intergenic
1098567698 12:71954282-71954304 CTGCAGACATGAGTGTGGGAAGG + Intronic
1100152964 12:91763585-91763607 GTGAAAACATAAGTGTGGGAGGG - Intergenic
1102839750 12:116106033-116106055 CTGCCAACATGAGTTGTGGAGGG + Intronic
1103155469 12:118680835-118680857 CTGACAAAATGACTGGAGGAGGG + Intergenic
1104017044 12:124968460-124968482 CTGAAAGCACGAGTGTGGGAGGG - Intronic
1104599314 12:130141861-130141883 CTGTAACCATGGGTGGAGGGTGG - Intergenic
1105607332 13:21937021-21937043 ATGAAACGATGAGGGGAGGATGG + Intergenic
1106093927 13:26625563-26625585 CAGAACAAAAGAGTGGAGGAAGG - Intronic
1106872709 13:34038950-34038972 CTGAGAACCTGAGTGGGGGTGGG - Intergenic
1106895845 13:34301552-34301574 CAAGAAACATCAGTGGAGGAAGG - Intergenic
1107014102 13:35695199-35695221 CCTAAAACAGGAGTGGAGAAGGG - Intergenic
1108061579 13:46538481-46538503 CAGAAAAATTGAGTGGAGGGTGG + Intergenic
1108439710 13:50438447-50438469 CAGAGAAAATGTGTGGAGGAGGG + Intronic
1109556563 13:63983491-63983513 CTCAAGACTTCAGTGGAGGAAGG - Intergenic
1110345527 13:74443263-74443285 ATGAAAACATGGGAGGAGGGAGG + Intergenic
1111195949 13:84874545-84874567 GGGAAAACATGTGTGGTGGAAGG + Intergenic
1111620127 13:90714608-90714630 TTGAAAACATGAGCCTAGGAAGG + Intergenic
1112159173 13:96850458-96850480 CTGTAGACATGAGTGGAGTCTGG - Intergenic
1112739125 13:102454222-102454244 GTGAAAACAAGATTTGAGGATGG + Intergenic
1113204711 13:107903103-107903125 CTCAAAAAATGAGTGTAGGCTGG - Intergenic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1113974473 13:114216249-114216271 CTGAAAACAAGCCGGGAGGAGGG - Intergenic
1116864075 14:50017269-50017291 CTTAATAAATGAGAGGAGGATGG + Intergenic
1117074139 14:52084402-52084424 CTCAAGACTTCAGTGGAGGAAGG - Intergenic
1118443334 14:65831069-65831091 CTGAAGAGATGATGGGAGGAAGG + Intergenic
1118680022 14:68231316-68231338 GAGAAAACAAGATTGGAGGAAGG - Intronic
1118906111 14:70024552-70024574 CTGGAAACATGAGTAGGAGATGG + Intronic
1121994791 14:98593428-98593450 CTGAGACCATGAATGGAGGCGGG - Intergenic
1122283423 14:100637625-100637647 CTGGACACATGAGAGGAGGGAGG + Intergenic
1124127316 15:26947793-26947815 CTGGCGACATCAGTGGAGGAGGG + Intronic
1125304924 15:38300634-38300656 CATAAAACATTAGTGTAGGAAGG - Intronic
1129686964 15:77691845-77691867 CTGAGAAAATGAGTGCAGGTGGG + Intronic
1130334840 15:82949967-82949989 CTGAAAAGATGGGAGGAGGAAGG + Intronic
1130999891 15:88931552-88931574 CTGAAAAACTAAGTGGATGATGG + Intergenic
1132371631 15:101303397-101303419 GTGAAAACAAGAGTGGGTGAGGG - Intronic
1133566046 16:6994382-6994404 CTGAAAACATGAATAGTGCATGG + Intronic
1133993454 16:10728607-10728629 CTGAAAACGGGGGTGGAGGGTGG + Intergenic
1134224205 16:12379086-12379108 CAGGAAACAGGAGTGGAGTATGG - Intronic
1135076259 16:19396322-19396344 AGGAAAACATGTGTGGTGGAAGG - Intergenic
1135285747 16:21191379-21191401 CTCAAAATATGGCTGGAGGAAGG - Intergenic
1135311790 16:21410743-21410765 ATGAAAACAAGAATGTAGGAAGG + Intronic
1135364741 16:21843195-21843217 ATGAAAACAAGAATGTAGGAAGG + Intronic
1135408860 16:22218190-22218212 CTGAACACATGACTCGAGGGTGG + Intronic
1135447101 16:22528142-22528164 ATGAAAACAAGAATGTAGGAAGG - Intronic
1135695643 16:24583899-24583921 CAAAAAATATGAGTGGAGGGTGG - Intergenic
1136321909 16:29491276-29491298 ATGAAAACAAGAATGTAGGAAGG + Intronic
1136436590 16:30231249-30231271 ATGAAAACAAGAATGTAGGAAGG + Intronic
1137531875 16:49283063-49283085 CTGAGAAGATGAGGAGAGGAAGG + Intergenic
1137558434 16:49488093-49488115 CTGAATGGATGAGTAGAGGAAGG + Exonic
1137858719 16:51823358-51823380 CTGGAAGCAGGAGTGGAGGGAGG - Intergenic
1138278600 16:55755327-55755349 TAGAAACCATGAGTGAAGGAAGG + Intergenic
1138289954 16:55838294-55838316 TAGAAACCATGAGTGAAGGAAGG - Intergenic
1138766675 16:59613453-59613475 CTGAAAACAAGAGTCAGGGAAGG - Intergenic
1139673382 16:68506778-68506800 CCGAAAAGATGTGTGGAGGTGGG + Intergenic
1140549005 16:75843474-75843496 TTCAAGACATCAGTGGAGGAAGG - Intergenic
1140837581 16:78809591-78809613 CTGAAAAACTGATAGGAGGAGGG - Intronic
1141998752 16:87651579-87651601 CTCAAGACTTCAGTGGAGGAAGG + Intronic
1142500075 17:327400-327422 CTGAAGACAGGAGAGGAGCAGGG + Intronic
1142660559 17:1426234-1426256 CTGAGCACACGTGTGGAGGAAGG + Intronic
1142660570 17:1426300-1426322 CTGAGCACAAGTGTGGAGGAAGG + Intronic
1143108596 17:4541453-4541475 CTGCAAACATGAGGTGAGGCGGG - Exonic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1144742601 17:17592219-17592241 AGGAAAAAATGAGTGGAGGAGGG - Intergenic
1145122515 17:20273320-20273342 CTAAAAACATTAGTGGGGCATGG + Intronic
1145978214 17:28996444-28996466 CAGCAAACCTGAGTGGGGGAGGG + Intronic
1146076257 17:29732398-29732420 ATGAAAACATGCCTGGAGGGTGG - Intronic
1147217137 17:38907406-38907428 CTGAGAACAGGTGTGGAGCAGGG - Intronic
1147290751 17:39440890-39440912 ATGAAAACAGGAGAGGAGAAAGG - Intronic
1147311262 17:39597275-39597297 CGGAAAACGTGGGGGGAGGACGG + Intergenic
1149669770 17:58396496-58396518 CTAAAATAATGAGTGGAAGAGGG + Intronic
1150130671 17:62667080-62667102 CTGAAGAGGTGAGTGGAGGCTGG - Intronic
1153910454 18:9702036-9702058 CTGAACACAAGTGTGCAGGAGGG + Intergenic
1153976917 18:10277185-10277207 CTCAAGACTTGAGTGGAGGAAGG - Intergenic
1155626527 18:27841371-27841393 CTCAAGACCTCAGTGGAGGAAGG + Intergenic
1155875552 18:31082583-31082605 TTGAAATCATGAGGGGTGGATGG + Intronic
1155904933 18:31438829-31438851 CCAAAAACAGGAGTGAAGGAGGG + Intergenic
1156482691 18:37446063-37446085 CCGCAAGCATGAGGGGAGGATGG - Intronic
1157354347 18:46918716-46918738 CTTAAAACTTGAGGGGAGGCCGG - Intronic
1158706537 18:59797364-59797386 CTAAAAAAATGAGGGGAAGAGGG + Intergenic
1159552123 18:69906018-69906040 CAGAAAATATGAGAAGAGGAAGG - Intronic
1159935382 18:74361492-74361514 CTGAAGACATGAGAGGTGGTCGG + Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160488045 18:79311329-79311351 CTTAAAATATTGGTGGAGGAGGG - Intronic
1160605317 18:80045613-80045635 CTGGAGACAGGAGTGAAGGAAGG - Intronic
1161711463 19:5851008-5851030 CAGAAAAGATGAGTGGGGGGAGG + Intronic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1164533431 19:29065359-29065381 GTGAAAACATGAGGGGAGGAAGG + Intergenic
1165687338 19:37833173-37833195 CTGATAACATGAGGTGAAGAAGG + Intergenic
1165708601 19:37993706-37993728 CTGAAAAAGTGTGTGAAGGAGGG + Intronic
1165733839 19:38163593-38163615 CGGAAACCTTGAGTGAAGGAAGG + Intronic
1165749331 19:38250791-38250813 CTGCAAAGATGAGAGGAAGATGG - Intronic
925160863 2:1682641-1682663 CTTAAAAAATGGGTGGAGGCCGG + Intronic
926284928 2:11481748-11481770 CGGAAAAAATGAGTGAAGGAAGG - Intergenic
929959802 2:46487944-46487966 CTGATAGTATGAGTGGAGGGGGG + Intergenic
930485877 2:52010099-52010121 GTGAAGACAAGAGTTGAGGATGG - Intergenic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
931001571 2:57790288-57790310 CTGAAAAAAATAGGGGAGGAGGG - Intergenic
933186046 2:79280311-79280333 CTAAAAACATGTGAGGGGGATGG + Intronic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933394857 2:81718205-81718227 TTGATAAAATGAGAGGAGGATGG + Intergenic
933419529 2:82028504-82028526 AGGAAAACATGTGTGGTGGAAGG + Intergenic
934026681 2:88006830-88006852 ATGAATACATGAGTGAAGAAAGG + Intergenic
934050502 2:88206541-88206563 CTGAACACATGCCTGGAGGGTGG + Intergenic
935575333 2:104703656-104703678 CTGCAAAGAGGAGAGGAGGATGG + Intergenic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937510366 2:122588599-122588621 CTGAAACCATGAATGGAGATGGG + Intergenic
939396632 2:141638797-141638819 ATGAAAGCATCAGTGGAAGAAGG + Intronic
939485389 2:142805866-142805888 CAGAATACTTGAGTGGAGCATGG - Intergenic
939664553 2:144934876-144934898 CTGAAATGAGGAGAGGAGGAGGG + Intergenic
940162160 2:150724854-150724876 CTGAAGACAGGAGGGAAGGAAGG + Intergenic
941504585 2:166326411-166326433 CTGATAACATCTTTGGAGGAAGG + Intronic
943259751 2:185643926-185643948 CTGGAGACAAGAGTAGAGGATGG + Intergenic
947405972 2:229777866-229777888 CCGAAAACATGAGAAGAGCACGG + Intronic
947413545 2:229869218-229869240 ATGAAAACATGATTGGAGTAAGG - Intronic
947674678 2:231967143-231967165 ATGAAATCATGAGGGGAGAAGGG + Intronic
948405227 2:237712305-237712327 ATAAAAACAAGAGTGGAGGAGGG + Intronic
948570561 2:238914750-238914772 CTGGAAATATGTGTGGAGGATGG - Intergenic
1170132196 20:13032645-13032667 CTGAAGAAATGAGTGAATGAGGG - Intronic
1170260702 20:14404080-14404102 ATGAAAACATGAGTGAATTAGGG + Intronic
1170501445 20:16978660-16978682 CTCTAAACATGTGTGGGGGATGG - Intergenic
1170510987 20:17076445-17076467 CAGAAGACATGAGTGGAGGAGGG + Intergenic
1170868932 20:20187041-20187063 CTGAACACCTGGGTGGGGGATGG + Intronic
1173072037 20:39777452-39777474 CTGAAAGCAAGAGAGGAAGAGGG + Intergenic
1174281917 20:49445679-49445701 CTGAAAACAGGGGTGCAGGATGG + Intronic
1175384577 20:58586121-58586143 CTTGAGACATGAGTGGAGCATGG - Intergenic
1175942291 20:62543027-62543049 CTGGAAAGATGTGTGAAGGAGGG + Intergenic
1177829821 21:26125511-26125533 CAGTAAACAGGAGTGGAGGTAGG + Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178712428 21:34930364-34930386 CTGATGACATGACTAGAGGAGGG + Intronic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1180288852 22:10778449-10778471 CTGAAAACATTGTTGCAGGATGG - Intergenic
1180632196 22:17237385-17237407 CAGAAAACAGGAGAGGAGGAGGG + Intergenic
1181884748 22:26011398-26011420 ATGAGAACATGAAGGGAGGAGGG + Intronic
1183000842 22:34857363-34857385 CCACATACATGAGTGGAGGAGGG - Intergenic
1184782484 22:46656139-46656161 CTGAAACCATGCTTGGAGAAGGG + Intronic
949482220 3:4504601-4504623 GTGAAAACGTGTGGGGAGGAGGG + Intronic
950357977 3:12427814-12427836 CTGAAAACTGGAGGGGAGGCAGG - Intronic
950574019 3:13820273-13820295 ATGAAAGAATGAATGGAGGAAGG + Intronic
950863765 3:16172992-16173014 CTGCAACCAAGAGTGGAGGGGGG - Intergenic
950940399 3:16885121-16885143 CTGAAAGCCGGAGTGGGGGAAGG + Intronic
950954015 3:17031415-17031437 CTGCAGACATGAAAGGAGGAAGG - Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952387205 3:32850691-32850713 CTGAAATACTGAGTGCAGGATGG + Intronic
952494008 3:33900346-33900368 CTGAAAAAATGAATGAATGAGGG + Intergenic
953569610 3:44060824-44060846 CTGAAAACTTGTGTGGTTGAAGG + Intergenic
954363736 3:50135584-50135606 CTTAAAAAAGAAGTGGAGGAAGG + Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955718441 3:61856006-61856028 AGGAAAACATGATGGGAGGAAGG - Intronic
955892419 3:63664474-63664496 CTGCAAACATGTCTGAAGGAAGG - Exonic
956699763 3:71948518-71948540 CTGAACAAATCAGGGGAGGATGG + Intergenic
956799897 3:72747689-72747711 CTGAAAAGATGAGAGGGGGCTGG + Intergenic
958741475 3:98078795-98078817 CTGAAAACATCCATGGAGCAGGG - Intergenic
959148096 3:102573966-102573988 CTGAAAATATGAGAAGAAGAAGG - Intergenic
959545621 3:107592796-107592818 CTTAAGACATGTGTGGAGGTGGG - Intronic
959900199 3:111652008-111652030 CTGAAGACTTGACTGGAGGCTGG - Exonic
960157238 3:114308514-114308536 GTGAAAAAATGAGATGAGGATGG - Exonic
960948982 3:122986880-122986902 CATAAAACATGAGTTTAGGAGGG + Intronic
962015544 3:131436181-131436203 CTCAAAAAATAAGTGGAGGAAGG + Intergenic
962631692 3:137282857-137282879 CTGAAGAAATGAGTTGAAGAGGG + Intergenic
963095119 3:141528970-141528992 CTTAAAACTTGAATTGAGGAAGG + Intronic
964046415 3:152333005-152333027 CTGAAACCAACATTGGAGGAAGG - Intronic
965437603 3:168671771-168671793 ATGAAAACATCAGTGCAGCAAGG + Intergenic
966470346 3:180282110-180282132 CTGGAAAGTTGAGTAGAGGAAGG + Intergenic
967650101 3:191975016-191975038 CTGAGTACATGAGTGTAGTAAGG + Intergenic
967833676 3:193943253-193943275 CTGAAAACAGGGTAGGAGGAGGG - Intergenic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
970948671 4:21726638-21726660 CTGAAAACATGAGGAGATAAGGG - Intronic
971128084 4:23776080-23776102 ATGAATGCATGAGTGAAGGAAGG - Intronic
971780110 4:31022654-31022676 CTGAAAGTAGGAATGGAGGAAGG - Intronic
972218437 4:36923798-36923820 TTGAAAGCATGAGTGGGAGATGG - Intergenic
972339936 4:38143389-38143411 TTGAACACATGAATGGAGGGGGG - Intergenic
972872855 4:43321778-43321800 TTGAAACTATGAATGGAGGACGG - Intergenic
973637303 4:52871879-52871901 CTGAAATGATGAAAGGAGGAAGG - Intergenic
973753796 4:54051849-54051871 TTCAAAACATTAGTTGAGGAAGG - Intronic
976809012 4:89080382-89080404 GTGAAAATATATGTGGAGGATGG - Intronic
978878179 4:113667298-113667320 CTGAATAAATGAATGAAGGATGG + Intronic
978924516 4:114226782-114226804 CTGAAAGGATGAGTGGAGATGGG - Intergenic
979490020 4:121315286-121315308 CTGTTAAAATGAGTGGTGGATGG - Intergenic
981021130 4:140030174-140030196 CTGAAAATGGGAGGGGAGGAGGG - Intronic
981128105 4:141130728-141130750 TTTAAAACCTCAGTGGAGGAGGG - Intronic
981831728 4:149009532-149009554 GTAAAAACTTGAGTGGAGAAGGG + Intergenic
982254660 4:153440282-153440304 CTGAATAAATGAGTGGGGGATGG + Intergenic
983080424 4:163378677-163378699 CTGAAAACAATAGTAAAGGAAGG - Intergenic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
984268955 4:177527573-177527595 GTGAACACATGACTGGAGTAGGG - Intergenic
985852254 5:2397403-2397425 CTGAAACCATGAATGGGGAATGG + Intergenic
988869341 5:35371752-35371774 CTTGAAAAATGAGTGGTGGAAGG + Intergenic
990967734 5:61467918-61467940 CTGGAATCTTGAGGGGAGGAGGG - Intronic
991029280 5:62066040-62066062 CTGAAAACATCTGTGGAGGCTGG + Intergenic
992169311 5:74086368-74086390 CTGAAAAAATGAGTGGGACAGGG - Intergenic
996615309 5:125434373-125434395 CTTAAAAAAAAAGTGGAGGAGGG + Intergenic
996625438 5:125564805-125564827 CTGAAAACATCATTGGAGCAGGG - Intergenic
996831243 5:127742994-127743016 CTGAAAAGATGAGTTGGGAAGGG - Intergenic
997586075 5:135044428-135044450 TTGAACACATGATTGGAGGCTGG + Intronic
998467952 5:142360953-142360975 CAGCAAACAAGAGCGGAGGAGGG + Intergenic
998842420 5:146269139-146269161 CAGAAAAAATGAGTTGAGAATGG + Intronic
999780416 5:154845201-154845223 CTGAAAACATGTCTGCAGGCGGG - Intronic
1000318668 5:160117161-160117183 ATGAAAACAGGAGTGCAGGCCGG + Intronic
1000786294 5:165548581-165548603 CTGGAAACAGGAGTGGAAGGTGG + Intergenic
1001052128 5:168422090-168422112 CTGAAAAGGTGAGTGGTGGGCGG + Exonic
1001170081 5:169410960-169410982 CTGAAAACAAGAGTGGAGGAAGG - Intergenic
1001238080 5:170046464-170046486 CAGAAAACATGTGGGGAGGATGG - Intronic
1003213324 6:4087481-4087503 CTGAGAACATGAGGAGTGGATGG - Exonic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004549773 6:16635787-16635809 CTGAAAACATGAGTGGAGGAAGG + Intronic
1005368579 6:25105936-25105958 TTGGAAACATGAGTTGAGAATGG - Intergenic
1005477883 6:26226051-26226073 CTCAAAACACTAGTGGAGTAAGG - Intergenic
1005732845 6:28715771-28715793 CTGAAAACAGGATTTGTGGAGGG + Intergenic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1007346346 6:41232235-41232257 CTGAAAACACTCCTGGAGGAAGG + Intronic
1008090184 6:47285946-47285968 TTGGGAACATAAGTGGAGGAAGG + Exonic
1008141223 6:47834685-47834707 CTGGGAAAATGAGTGGAGAAGGG - Intergenic
1008270717 6:49486222-49486244 CTGAAGACAAGAGAGGAGAATGG - Intronic
1010435988 6:75831601-75831623 CTTTAAAAATGTGTGGAGGATGG + Intronic
1010802373 6:80191550-80191572 ATTAAAACATGAGGGGGGGAAGG - Intronic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1011260881 6:85468584-85468606 ATGAATACATGAGAGCAGGAAGG + Intronic
1012413513 6:98987374-98987396 CTGACATCTTGAGGGGAGGAGGG - Intergenic
1012536238 6:100300543-100300565 CTAAAAACATGATTGGAGGATGG - Intergenic
1012959188 6:105604730-105604752 CTGAAAACCTGTGTGGTGGATGG + Intergenic
1013439861 6:110152901-110152923 TTGGAAACATGAGGGGAGGAAGG - Intronic
1015745706 6:136507325-136507347 CAGAAAACAAGAGAGAAGGACGG + Intronic
1017822960 6:158061969-158061991 CTGAAAAGAGGAGGGGAGGGCGG - Intronic
1019220821 6:170471359-170471381 CTGAACACATGTGTGCTGGAGGG + Intergenic
1019499255 7:1356136-1356158 CTGAGAAGCTGAGTGGAGGACGG - Intergenic
1019855276 7:3599717-3599739 GTGAAAAATTCAGTGGAGGAGGG - Intronic
1020647744 7:10835760-10835782 CTGAACAAATGAGTGGCAGAGGG + Intergenic
1021294256 7:18884755-18884777 TTGAAAACATGAAGGGAGGCAGG + Intronic
1021609717 7:22445406-22445428 CTGACAAGACGAGGGGAGGATGG - Intronic
1022200690 7:28114213-28114235 GTGAAAGCATCAGTGGAGCATGG - Intronic
1022642026 7:32196097-32196119 CTGACATCATGATGGGAGGAAGG + Intronic
1023509528 7:40936441-40936463 CTAAAATCATGAGTGAAAGAGGG - Intergenic
1023518670 7:41029089-41029111 CTGAGGACATCAGGGGAGGAGGG - Intergenic
1024234841 7:47390205-47390227 TTGACAACTTTAGTGGAGGAGGG - Intronic
1024774510 7:52767101-52767123 ATGAAAACAGGAGTTGAGGGTGG + Intergenic
1024997849 7:55287565-55287587 CTGAGCACCTAAGTGGAGGAGGG + Intergenic
1025609822 7:63068272-63068294 CAGGAAACATGAGAGGAGGCGGG - Intergenic
1026507833 7:71001300-71001322 TTGAAGACTTCAGTGGAGGAAGG + Intergenic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1029364799 7:100109840-100109862 CTGAAAACATGAGGCAAAGATGG + Intronic
1031699947 7:124912501-124912523 CTGTAAACATGAGAAGGGGAGGG - Intronic
1031772166 7:125857549-125857571 CTGAAAGCATCATTGAAGGAGGG + Intergenic
1032245719 7:130210007-130210029 ATAAAAAAATGAGTGGGGGAGGG - Intronic
1032341939 7:131082030-131082052 CTCAAAATATGAGTGGTGAATGG + Intergenic
1032851552 7:135799545-135799567 CTGAAAACAGGAGTGGAGGATGG - Intergenic
1033644510 7:143290356-143290378 GTTAAAACATGAGGGGAGGCCGG - Intronic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034292786 7:149945928-149945950 CTGGGAACAGGTGTGGAGGAGGG + Intergenic
1034615312 7:152411307-152411329 CTGAAAACATTGTTGCAGGATGG - Intronic
1035676309 8:1458793-1458815 ATGAAAACAGGAGTGGGAGAAGG + Intergenic
1036007902 8:4687769-4687791 CTGAAATCATTAGTGAAGGAGGG - Intronic
1036071298 8:5442488-5442510 CTGGAAAAATGATTTGAGGAGGG - Intergenic
1037462422 8:19125445-19125467 CTGGAAACCTGAGAAGAGGATGG - Intergenic
1039440143 8:37589314-37589336 TTGAAAACATCAGTGCTGGAGGG - Intergenic
1039850162 8:41358034-41358056 ATAAAAATATAAGTGGAGGAGGG - Intergenic
1039947943 8:42146135-42146157 CTGATTACATGAGGGGATGAGGG + Intergenic
1040799381 8:51324148-51324170 ATGAATACATGAGTTGAGCAAGG - Intronic
1041157390 8:55002686-55002708 TGGAAAAGATGAGTGGAGTAAGG + Intergenic
1043392447 8:79804743-79804765 CTGAAAAACTGTGTGGAAGATGG + Intergenic
1045568664 8:103347425-103347447 CTGTAAACATGAGGGAATGATGG + Intergenic
1046104979 8:109654263-109654285 GTGAGTACATGAGTGGAGTAGGG - Intronic
1046658884 8:116927124-116927146 CTGAAAAAATGAGTAGGGGCGGG + Intergenic
1047166338 8:122443248-122443270 CTTATAATATGATTGGAGGATGG - Intergenic
1048955755 8:139534730-139534752 CTCATAACATGAGTGGAAGCGGG + Intergenic
1049733882 8:144193021-144193043 CTGAAAAGAAGTGTGGAGGTGGG + Intronic
1049876923 8:145029970-145029992 AGGAAAACATGTGTGGTGGAAGG + Intergenic
1051807920 9:21016696-21016718 TTGAAAACATGTTTGGAGGTGGG + Intronic
1052511376 9:29425635-29425657 CTGAAAGCAACAGTGGAGAAGGG + Intergenic
1052543190 9:29837558-29837580 TTGAAGACTTCAGTGGAGGAAGG - Intergenic
1052636458 9:31112302-31112324 AGGAAAAAATGAATGGAGGAAGG - Intergenic
1053033491 9:34803506-34803528 GTGAAAACAGGAGTGTAAGAGGG + Intergenic
1053041582 9:34878184-34878206 CAGAAAAATTGAGTGGAGTATGG - Intergenic
1053178706 9:35949153-35949175 TTAAAAATGTGAGTGGAGGAGGG + Intergenic
1055259344 9:74414590-74414612 TGGAAAAAATGAGTTGAGGAGGG + Intergenic
1055762329 9:79622183-79622205 ATGAAGACATGAGTGTAGCATGG - Intronic
1055812699 9:80168327-80168349 CTCAAGACTTCAGTGGAGGAAGG - Intergenic
1056175113 9:84026943-84026965 CTCAAAACTTCACTGGAGGAAGG + Intergenic
1058002413 9:99879593-99879615 TTGGAAACCTGAGTGGATGATGG + Intergenic
1058757814 9:108100137-108100159 CTCAAAATAAGAGTGGGGGAAGG - Intergenic
1059461220 9:114431557-114431579 GTGAGAACAAGAGAGGAGGAAGG - Intronic
1059667593 9:116463422-116463444 CTGAGAAGTTGAGAGGAGGATGG - Intronic
1060527927 9:124330921-124330943 CTGAAAAGATGAGTTAAAGACGG + Intronic
1060748347 9:126152477-126152499 GTGAAATCATGAATGGAAGATGG - Intergenic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1186575375 X:10759748-10759770 CTGAAAAGAGGAGTTGAGAATGG - Intronic
1188343596 X:29036217-29036239 GTAAAAACAGGAGTGGAAGATGG - Intronic
1188445646 X:30250608-30250630 CCTAAAACAGGAGAGGAGGAGGG - Exonic
1189188389 X:39073608-39073630 CTTAAAAGAAGAGTTGAGGAGGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193913669 X:87338735-87338757 CTGAAAACAAAAGAGGAAGAAGG + Intergenic
1197408109 X:126079989-126080011 CTTAAAAACTGATTGGAGGATGG + Intergenic
1198679958 X:139170701-139170723 CAAGAAACATGAGTGCAGGATGG - Intronic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1201892155 Y:18954395-18954417 CTCAAACCATGAGTGGAGCTTGG + Intergenic